EEPD1 Promotes Cell Survival upon Replication Stress

In a survey of proteins induced by the topoisomerase IIα poison VP-16 in embryonic stem cells, we found that expression of EEPD1, an uncharacterized human protein (Uniprot Q7L989, AAH65518.1), was markedly increased. EEPD1 is a 569 aa protein with two amino terminal helix-hairpin-helix (HhH) DNA binding domains related to RuvA, a carboxy terminal DNase I-like domain that places it in the exonuclease-endonuclease-phosphatase (EEP) family, and a conserved D-D-N/D/E nuclease active site that overlaps with the HhH domain and the DNase I-like domain (S1 Fig) [32]. It is located at 7p14.2, but is not involved in any known neoplastic translocations (Catalogue of Somatic Mutations in Cancer). EEPD1 is evolutionarily conserved from some insects to humans and expressed at variable levels in a wide variety of primary human tissues and human cell lines (S1B Fig). It is more highly expressed in the testis, leukocytes, and brain, as are many other DNA DSB repair components [33,34]. EEPD1 depletion moderately altered cell cycle progression in asynchronous or synchronized cells (S2 Fig), increasing the fraction of cells in S and G2 phases in both situations.

EEPD1 alone is required for proper clonogenecity; plating efficiency is reduced by almost 50% from EEPD1 depletion alone (Fig 1A). EEPD1 deficiency also significantly slows cell growth (Fig 1B), and increases the fraction of cells expressing cyclin A, without an increase in the fraction of cells with phosphorylated histone H3 (Fig 1C and 1D). This suggested a potential role in DNA replication. To investigate whether EEPD1 is important for survival after exposure to agents that stress replication forks, we tested whether EEPD1 regulates sensitivity to VP-16, hydroxyurea (HU), camptothecin (CPT), UV light, cisplatin, and ionizing radiation (IR) (Fig 1E). EEPD1 depletion resulted in 3.5-fold less clonogenic survival after 18 h exposure to 10 uM VP-16, compared to controls. EEPD1 depletion also decreased survival to continuous 0.4 mM HU (12-fold), 18 h exposure to 10 uM CPT (6-fold), continuous 0.4 mM HU (10-fold), 18 h exposure to 10 uM CPT (6-fold), continuous 5 uM cisplatin (4-fold), 15 J/m² UV (12-fold), and 4 Gy IR (4-fold).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. EEPD1 deficiency reduces clonogenicity and growth rate, extends S phase, and sensitizes cells to replication stress.

(A) A549 cells were transfected with control siRNA or siRNA targeting EEPD1 and plating efficiencies were determined (mean ±SEM). (B) Relative growth rates of control and EEPD1 deficient cells (mean ±SEM). (C,D) Immunofluorescence microscopy of control and EEPD1 deficient A549 cells stained with DAPI, cyclin A (S phase marker), and phospho-H3 (M phase marker) at indicated times after siRNA transfection. Representative data are shown in panel C. Quantitation of 4–12 determinations (124–468 nuclei/determination) scored per time point is shown in panel D; values are mean percentages (±SEM) of cyclin A- or phospho-H3-positive nuclei. (E) Clonogenic survival of A549 cells transfected with si-EEPD1 or control siRNA, and then treated with various replication stress agents. EEPD1 repression was confirmed by Western blot, above (n = 6–9 in triplicate, means ±SEM). *, **, *** indicate P≤0.05, 0.01, 0.001 (t tests), respectively, in this and all subsequent figures unless otherwise specified.

https://doi.org/10.1371/journal.pgen.1005675.g001

EEPD1 Promotes Replication Fork Restart after Replication Stress

To investigate the mechanism by which EEPD1 promotes cell survival during replication stress we used two techniques to measure replication fork restart after stalling. First, BrdU incorporation into nascent DNA after release from HU replication stress was measured by immunofluorescence ([35,36]. By 2 h after release from an 18 h HU exposure, when replication fork restart was maximal in control cells (as indicated by the number of BrdU foci), EEPD1-depleted cells restarting forks were reduced by 5-fold (Fig 2A). This is a specific EEPD1 effect, as the fork restart defect in EEPD1 depleted cells was rescued by expression of an siRNA-resistant version of EEPD1 (Fig 2A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. EEPD1 promotes replication fork restart after stress.

(A) Replication recovery assayed as percentage of cells with ≥3 BrdU foci 2 h after release from 18 h treatment with 10 mM HU. Representative data (left) and quantitation (right) for cells transfected with control siRNA or si-EEPD1 targeted to 3’ UTR, with or without expression of siRNA-resistant FLAG-tagged EEPD1 (n = 11–23 determinations per condition, >100 cells scored/condition, means ±SEM). EEPD1 expression is shown by Western blot below for each condition. (B,C) Restart of stalled forks by DNA fiber analysis with HEK-293 cells transfected with empty vector (CMV), CMV-EEPD1 overexpression vector, control siRNA, or EEPD1 siRNA analyzed 15–30 min after release from HU replication stress. Representative images of fibers with IdU stained red and CldU stained green (B) and fiber quantitation (C) shown as percentage (means ±SD) of restarted forks (red + green fibers), stopped forks (red fibers), and new forks (green fibers) for >3 distinct determinations per condition (121–211 fibers/condition). (D) Fiber lengths and symmetry were measured in control and EEPD1 deficient cells to determine replication speed (left), and the percentage of bidirectional fibers (right), defined as red fibers with flanking green segments.

https://doi.org/10.1371/journal.pgen.1005675.g002

We next used DNA fiber analysis to measure replication fork restart after release from a 1 h HU treatment, as well as replication speed and replication fork symmetry [32,35]. We found that 20 min after HU release, EEPD1 depletion reduced replication fork restart by 2.3-fold (Fig 2B and 2C). Interestingly, over-expressing EEPD1 increased fork restart; however, by 30 min nearly all forks restarted even in EEPD1-depleted cells. New fork initiation is rare under these conditions, and EEPD1 depletion had no significant effect on this endpoint (Fig 2C). By measuring fiber lengths, we determined that EEPD1 depletion significantly reduces replication speed (Fig 2D). Consistent with EEPD1 promoting fork restart, EEPD1 depletion significantly reduced the percentage of bidirectional forks, reflecting restart at both ends of a replicon (Fig 2D). These results indicate that EEPD1 accelerates restart of stressed replication forks, and that it increases the speed of replication during recovery from stress, implying that EEPD1 also assists in normal fork progression.

EEPD1 Inhibits NHEJ and Promotes HR

Based on the above observations, we investigated the role of EEPD1 in the major DNA DSB repair pathways by using two previously described assays. EEPD1 depletion increased cNHEJ by 2.3-fold in the EJ5 cell reporter system (Fig 3A) [37,38], implying that EEPD1 inhibits cNHEJ. EEPD1 depletion reduced HR repair of I-SceI induced DSBs by 6.4-fold in the HT256 reporter system (Fig 3B) [39]. This reduction in HR raised the question of whether EEPD1 depletion increased gene conversion tract lengths. Cells with defects in HR components display longer gene conversion tracts among residual HR products [30,31,40–46]. Consistent with these prior studies, HR products from EEPD1-depleted cells had significantly longer conversion tracts compared to controls (Fig 3C and 3D). The longer gene conversion tracts are thought to reflect unstable heteroduplexes [40] and/or defective resection preventing efficient 5’ end-capture by the invaded template [30,46]. In the case of EEPD1 depletion, we hypothesize that defective end resection (shown below) results in less efficient 5’ end-capture. If true, then this implies that less efficient SS end-capture reactively stimulates synthesis along the invaded template, an idea supported by several published reports [30,31,42].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. EEPD1 promotes HR DSB repair and suppresses cNHEJ.

(A,B) cNHEJ repair of I-SceI-induced DSBs was measured in EJ5 cells with or without EEPD1 depletion by EEPD1 or control lentiviral shRNA, and assayed as percentages of GFP⁺ cells by flow cytometry (n = 12 in triplicate, means ±SD). HR repair of I-SceI-induced DSBs was measured in HT256 cells with or without EEPD1 depletion assayed as frequencies of G418-resistant colonies per viable cell (n = 15 in triplicate, mean ±SD). (C) HT256 gene conversion tract spectra with or without EEPD1 depletion were determined by mapping 12 silent restriction site markers in the neo gene. Bars indicate converted markers for each tract type; the number of products of each tract type is listed with percentages. (D) Tract lengths of each product are plotted; bars indicate mean ± 95% confidence intervals. (E) Clonogenic survival of A549 cells treated with olaparib for 18 h at indicated doses with or with EEPD1 repression (n = 3 in triplicate, mean ± SEM).

https://doi.org/10.1371/journal.pgen.1005675.g003

Cells with HR defects, such as those with BRCA1 or BRCA2 mutations, are hypersensitive to PARP1 inhibitors, due to an increase in unrepaired DSBs arising during replication [47–49]. We therefore repressed EEPD1 in BRCA1/2 proficient cells and assessed the effect of the PARP1 inhibitor olaparib on cell survival. EEPD1 repression markedly increased the cytotoxicity of olaparib (19-fold, Fig 3E), in the absence other genotoxins, consistent with EEPD1 playing a significant role in HR repair.

There are two DSB repair pathways that use 5’ end resection to initiate the repair cascade, microhomology-mediated end joining (MMEJ), and HR. The frequency of utilization of these two pathways can be compared at a single induced DSB in the EGFP-based MMEJ/HR-Mlu1 reporter (Fig 4A) [19]. Upon DSB induction with I-SceI transduction, repair by either MMEJ or HR results in loss of the I-SceI site and generation of EGFP, allowing repaired cells to be sorted by flow cytometry (Fig 4B). The repaired EGFP loci were PCR amplified, and analyzed for repair by HR versus MMEJ. Cells repaired by MMEJ have a 9 nt duplication containing a BssHII site, while cells repaired by HR have an MluI site (Fig 4C). The fraction of BssHII cleaved products among the total PCR products represent the fraction repaired by MMEJ, while the fraction cleaved by MluI represents HR repair.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. HR requires EEPD1 to a greater extent than MMEJ.

(A) Schema of the MMEJ/HR-MluI reporter system and Western blot confirming EEPD1 knockdown. (B) Flow cytometry of cells with and without I-SceI transduction. (C) Representative results of PCR amplified EGFP⁺ products digested with BssHII (MMEJ) or MluI (HR). The percentage of the total product digested by each enzyme indicates the relative utilization of each repair pathway. (D) Graphical representation of the densitometric analysis of the cleaved PCR products over total products, showing relative fractions of HR and MMEJ in cells with or without EEPD1 depletion (n = 3).

https://doi.org/10.1371/journal.pgen.1005675.g004

Depletion of EEPD1 resulted in an average decrease of 2.5-fold in EGFP-positive cells in the MMEJ/HR-MluI reporter system. The EGFP locus was PCR amplified from EGFP-positive cells, and digested with BssHII or MluI. This revealed that EEPD1 depletion resulted in a 9-fold reduction in HR and a 50% increase in MMEJ (Fig 4D). This implies that when MMEJ and HR are competing at a single DSB site, EEPD1 pushes that repair decision towards HR, and away from MMEJ. This may mean that EEPD1 is important for initiating long range end resection used in HR, consistent with its interaction with Exo1/BLM as noted below.

EEPD1 Promotes End Resection

Since the key step for determining DSB and replication fork repair pathway choice is 5’ end resection [16–18], we therefore assessed the role of EEPD1 in 5’ end resection after DSB formation using two approaches. First, we measured the generation of SS DNA at IR-induced DSBs by immunostaining newly incorporated BrdU in non-denatured SS DNA [50,51]. We found that depletion of EEPD1 reduced the number of cells with SS BrdU after IR by 5-fold (Fig 5A and 5B). In the second approach, we assessed resection around an induced I-SceI DSB [52,53]. Using this technique, we found that EEPD1 depletion reduced end resection by 3-fold, nearly the same extent as CtIP depletion (Fig 5C). Thus, EEPD1 is important for end resection after both a transduced restriction enzyme (I-SceI) and exogenous IR.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. EEPD1 promotes end resection and downstream replication stress signaling.

(A,B) End resection after IR measured by the fraction of cells with ss BrdU present in non-denatured DNA. Representative images (A) and quantitation (B) are shown as mean ±SD, n = 11–19 per condition, 139–180 cells/condition. (C) End resection adjacent to a single I-SceI DSB in HT1904 cells was measured in control cells and in cells depleted for EEPD1, CtIP and/or Exo1, alone or together (n = 3, means ± SD). For depletion of each protein, see S6 Fig. (D,E) Phospho-S4/S8 RPA32, gamma-H2Ax, and RAD51 nuclear foci formation in A549 cells after replication stress with and without EEPD1 depletion. DAPI nuclear counterstain is blue. (F,G) Phosphorylation of ATR (T1989), Chk1 (S345), and RPA32 (S4/S8) analyzed by Western blot in HU or mock-treated A549 cells with and without EEPD1 depletion. Representative blot (F) and quantification (n = 3–4 blots, means ±SD) (G) presented as relative protein levels normalized to β-actin loading controls. (H) Representative results (left) of alkaline single cell electrophoresis assays in untreated or HU-treated A549 cells with or with EEPD1 depletion, and quantitation (right) showing means ±SEM (n = 5).

https://doi.org/10.1371/journal.pgen.1005675.g005

We next tested whether EEPD1 functions in the same end resection pathway as Exo1 or CtIP (Fig 5C). We depleted EEPD1 with or without co-depletion of Exo1 or CtIP. There is no significant difference in end resection when EEPD1 and Exo1 are co-depleted compared to individual depletion, suggesting that these enzymes function in the same resection pathway. Co-depletion of EEPD1 and CtIP also yielded similar results as individual depletions. These results suggest that EEPD1 functions in the same resection pathway(s) as Exo1 and CtIP.

EEPD1 Is Required for Loading DNA Repair Components onto Damaged Replication Forks

When a replication fork collapses, SS DNA arises by end resection, or by uncoupling of the polymerase complex from the helicase [10,54,55]. Such ss DNA is coated by RPA, which recruits ATRIP, leading to ATR activation and phosphorylation of RPA, H2Ax, and Chk1 which mediate cell cycle arrest and replication fork repair [56–58]. To define the epistatic position of EEPD1 in HR, confocal immunofluorescence microscopic studies of fork repair components were performed in cells treated with HU for a prolonged period, which causes replication fork collapse. We found that EEPD1 depletion significantly decreased foci formation by RPA32 (2.7-fold), gamma-H2Ax (3.3-fold), and RAD51 (3.5-fold) (Fig 5D and 5E). The decrease in RPA32 foci was consistent with its decreased phosphorylation, detected by Western blotting (Fig 5F and 5G). Consistent with the decreased formation of RPA32, gamma-H2Ax, and RAD51 foci, and the requirement for SS DNA to trigger ATR and Chk1 signaling, EEPD1 repressed cells also showed decreased phosphorylation of ATR (3-fold) and Chk1 (11-fold) (Fig 5F and 5G). EEPD1 did not co-localize with gamma-H2Ax foci after damage (S3 Fig), not surprisingly, since EEPD1 appears to act upstream of gamma-H2Ax.

NBS1, 53BP1 and BRCA1 Foci Are Intact in EEPD1-Repressed Cells

The Mre11-Rad50-NBS1 (MRN) complex is a first responder to DSB damage [59–61]. NBS1 recruits BRCA1 to stalled replication forks in an alternative pathway to the canonical gamma-H2Ax/MDC1/RNF8/BRCA1 recruitment pathway [62,63]. Confocal immunofluorescence studies were performed to investigate whether EEPD1 depletion impairs these early regulators of DSB repair. While HU-induced RPA32, gamma-H2Ax, and RAD51 foci were significantly decreased in EEPD1 depleted cells (Fig 5D and 5E), BRCA1, 53BP1, and NBS1 foci were unaffected (S3 Fig), indicating the initial 53BP1 recruitment step of cNHEJ was functional, and that NBS1 and BRCA1 have upstream roles in repair of stressed forks. These data imply that MRN/BRCA1 and EEPD1 act in distinct repair pathways.

For 5’ end resection to take place at a stalled replication fork, there must be a free DNA DSB end [3,4,8–12]. This can occur via fork reversal to form a chicken foot structure, but the majority of stalled forks do not reverse [20]. For those stalled forks that do not reverse the fork must be nicked to create this required free DNA DSB end [3,13,14,17]. If this is true, then DNA nicking should be increased after HU nucleotide depletion to stall replication forks. We assessed the occurrence of DNA nicking using alkaline single cell electrophoresis assays with and without EEPD1 depletion (Fig 5H). We found that after HU exposure, DNA nicking increases 3.5-fold. However, EEPD1-depletion completely abolishes this increase, implying that EEPD1 is directly or indirectly responsible for DNA nicking in response to HU-induced replication stress.

EEPD1 is expressed primarily in the nucleus, consistent with it functioning as a nuclease (S4 Fig). Since EEPD1 has homology to RuvA, which binds to heteroduplex chicken foot structures, and it has a nuclease domain, we examined whether EEPD1 has nucleolytic activity on chicken foot structures. We found that recombinant EEPD1 protein did not nick any of the four double-stranded regions of the regressed fork, but it does have specific 5’ overhang endonuclease activity (S5 Fig), cleaving at a single site at the joint of the overhang. Chicken foot structures with 5’ overhangs are difficult for Exo1 to process [64]; EEPD1 could promote further 5’ end resection by presenting Exo1 with a more amenable structure. These data demonstrate that EEPD1 is a 5’ endonuclease, consistent with the marked reduction in HU-induced nicks in EEPD1 depleted cells.

We next assessed the effect of EEPD1 depletion and co-depletion of three other resection components, CtIP, Exo1, and Dna2, on cell proliferation with or without HU-induced replication stress (S6 Fig). EEPD1 depletion alone suppressed cell proliferation, as did depletion of CtIP and Dna2. Co-depletion of EEPD1 with CtIP or Dna2 did not further affect proliferation, with or without replications stress. By contrast, Exo1 depletion only modestly suppressed proliferation, and only with replication stress. Again, there was no further effect on proliferation with co-depletion of EEPD1 and Exo1 than with EEPD1 depletion alone.

We also compared the effects of EEPD1, CtIP, Exo1, and Dna2 depletion singly and in pairs on the formation and resolution of after HU-induced replication stress (S7 Fig). As above (Fig 5D and 5E), EEPD1 depletion strongly suppressed the formation of gamma-H2Ax foci 4 and 24 h after HU, with similar or greater effects than CtIP depletion. Co-depletion of EEPD1 and CtiP did not further suppress gamma-H2Ax foci 4 h after HU. Exo1 depletion had similar effects as CtIP depletion, with or without co-depletion of EEPD1. Dna2 depletion enhanced gamma-H2Ax focus formation, even in the absence of replication stress, indicating that Dna2 plays a key role in preventing endogenous DNA damage. Co-depletion of Dna2 and EEPD1 did not significantly suppress gamma-H2Ax foci in untreated cells or after HU exposure. The enhanced gamma-H2Ax foci with co-depletion of EEPD1 and CtIP may also reflect enhanced or more persistent DNA damage caused by the genomic lesions, independently of induced replication stress.

EEPD1 Is Recruited to Stalled Replication Forks

Western analysis revealed that after replication stress with HU, EEPD1 is enriched in the nuclear chromatin fraction (Fig 6A and 6B), suggesting that EEPD1 is recruited to chromatin containing damaged replication forks. We next assessed EEPD1 recruitment to stalled replication forks using Isolation of Proteins on Nascent DNA (iPOND) [65,66]. iPOND showed that EEPD1 is recruited to replication forks within 30 min of HU treatment, coinciding with the appearance of gamma-H2Ax (Fig 6C) which marks DSBs at stalled/collapsed replication forks [65]. PCNA was absent from the HU-stalled forks, consistent with replisome unloading from collapsed fork Okazaki fragments [65]. A control iPOND assay using a thymidine chase confirmed the specificity of EEPD1 recruitment to stalled forks (Fig 6D). By using chromatin immunoprecipition [52] we also demonstrated that EEPD1 is recruited to an I-SceI induced DSB (Fig 6E). Interestingly, EEPD1 constitutively co-immunoprecipitates with Exo1, RPA32, and BLM in the presence of DNase, whether or not replication stress is present, indicating that these proteins reside in the same complex (Fig 6F and 6G). However, EEPD1 does not co-immunoprecipitate with Dna2, indicating that it is likely not in the RPA/Dna2/MRN end resection complex [28]. Significantly, depleting EEPD1 reduced Exo1 and BLM protein levels, suggesting that EEPD1 promotes stability of the complex in which EEPD1, Exo1, and BLM reside (Figs 6H and S6B), indicating that EEPD1 resides in an obligate complex, perhaps to prevent aberrant nuclease activation and improper DNA cleavage.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. EEPD1 is recruited to replication forks in response to HU replication stress.

(A,B) HEK-293 cells over-expressing wild-type V5-tagged EEPD1 treated with 10 mM HU for 18 h, chromatin was isolated 0–2 h after HU release and probed for EEPD1, and histone H3 as loading control (n = 4). Immunoblots (A) and densitometric measures of EEPD1 (B) are shown as average relative protein levels (means ±SD, n = 4) normalized to H3 as a chromatin loading control. (C) iPOND analysis of HEK-293 cells over-expressing V5-tagged EEPD1. Cells were incubated for 10 min in medium with 10 uM EdU to label nascent DNA, and then treated with 3 mM HU for indicated times to stall replication forks. (D) Control iPOND assay using a thymidine chase confirms the specificity of EEPD1 recruitment to nascent DNA. (E) Chromatin immunoprecipation of EEPD1 recruited to single DSB within neo locus in HT1904 cells. Schema showing PCR primer pairs relative to DSB site (above) and PCR results (below). (F,G) Co-immunoprecipitation of EEPD1 with Exo1, CtiP, BLM, and RPA32, but not Dna2. (H) Degradation of Exo1 and BLM when EEPD1 is depleted. Representative blot above, quantitation (mean ±SEM) of three replicate blots, below.

https://doi.org/10.1371/journal.pgen.1005675.g006

EEPD1 Maintains Genome Stability

Proper replication stress responses are required to prevent gross chromosomal instability, which can be assessed by the formation of micronuclei and nuclear bridges that result from mis-segregation of fused chromosomes [27,67]. We found that EEPD1-depleted cells display severe nuclear anomalies, with 6- and 7-fold increases in nuclear bridges and micronuclei, respectively (Fig 7A–7D). Chromosome fusion events occur when collapsed forks are aberrantly repaired, as in BRCA1-deficient cells with unopposed 53BP1 [22,23]. 53BP1 depletion alone did not alter nuclear anomalies, but 53BP1 depletion largely suppressed both bridges and micronuclei associated with EEPD1 depletion.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. EEPD1 maintains genome stability and is overexpressed in colorectal cancers.

(A) A549 cells were transfected with control siRNA or si-EEPD1 were stained with DAPI and analyzed for nuclear aberrations. Arrows indicate micronuclei and nuclear bridges. (B) Confirmation of 53BP1 and/or EEPD1 depletion by Western blot analysis of A549 cells transfected with cognate siRNAs; loading control is eEF2. (C,D) Representative images of unstressed A549 cells from panel B, with arrows indicating micronuclei (C), and quantitation of nuclear bridges and micronuclei plotted as mean percentages of nuclear aberrations (n = 10, 142–190 nuclei/determination) ± SD. (E) Representative photomicrographs of chromosome aberrations. (F) Quantification of chromosome aberrations in A549 cells treated with HU, IR or untreated, and with depletion of EEPD1 and/or 53BP1 (n = 3 metaphase spreads per condition, 102–374 metaphases scored per spread). (G) EEPD1 expression was determined in colorectal carcinomas and adjacent normal mucosa samples. Box and whisker plots are shown with median (heavy line) and upper/lower quartiles indicated (bars). EEPD1 expression is 2.3-fold higher in tumor samples (P = 9×10⁻³⁰).

https://doi.org/10.1371/journal.pgen.1005675.g007

Metaphase analysis further demonstrated EEPD1 repression causes genome instability, revealed as significant increases in chromatid breaks and radial chromosomes, both of which arise in S/G2 cells (Fig 7E and 7F). Interestingly, IR induced these S/G2-associated events, and at lower frequencies, G1-associated chromosome breaks and double minutes. EEPD1 depletion alone did not increase G1-associated events, nor did it affect the frequency of IR-induced these events (Fig 7F). Thus, EEPD1 specifically suppresses S/G2 events. Although more chromatid breaks were observed in EEPD1-depleted cells treated with HU than with HU alone, the difference was not significant (P = 0.17); EEPD1 depletion did significantly increase IR-induced chromatid breaks compared to IR alone. Interestingly, 53BP1 repression fully suppressed spontaneous and HU-induced chromatid breaks seen in EEPD1 depleted cells as well as HU-induced chromatid breaks in cells with normal EEPD1 expression (Fig 7F). These results indicate that EEPD1 plays a critical role in maintaining genome stability, under stressed and non-stressed conditions, and suggest that EEPD1 promotes genome stability by mediating accurate HR repair of stressed replication forks.

EEPD1 Is Frequently Overexpressed in Colorectal Cancer

Cancer cells experience continuous replication stress due to metabolic alterations and checkpoint defects that permit DNA replication despite significant DNA damage. To manage this stress, it is reasonable to suppose that EEPD1 would be up-regulated in cancers. We tested this by analyzing mRNA expression of EEPD1 in newly resected colorectal cancer versus adjacent normal tissue. In the present study we analyzed EEPD1 expression in 181 new colorectal cancers, and found that EEPD1 was expressed an average of 2.3-fold higher than adjacent normal tissue in 171 of 181 cases (Fig 7G).

Cell Culture, Transfection and Survival Assays

A549, HEK-293, HEK-293T, HT256 reporter cells, and the various U2OS reporter cells (EJ5, MMEJ/HR), were cultured in D-MEM supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. HT256 cells were cultured in Alpha-MEM supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. EEPD1 was depleted using two mechanisms, shRNA and siRNA, to control for variation in the method of mRNA destruction. EEPD1 was depleted either by 1) EEPD1 lentivirus shRNAs produced from 293T cells (pLKO.1, Thermo Scientific, Pittsburgh, PA); or 2) SMARTpool ON-TARGETplus EEPD1 siRNA from Dharmacon RNAi Technologies (GGACUGACCUUCACCGCCA; CUGAGAAGCCCUCGAGUCA, GGAAGUUGACCUCGGGGUA; UGCGAGAGGUGGUGUGCAU) (Pittsburgh, PA). EEPD1 3’UTR On-Target plus siRNA also from Dharmacon (GGAAGUUGACCUCGGGUA). 53BP1siRNA(h) is a pool of 3 different siRNA duplexes from Santa Cruz Biotechnology (sc-37455). All other siRNAs were from Dhamarcon SMARTpools. All nucleic sequences are listed 5’ to 3’ in this Supplement.

Polyethylenimine (PEI) was used to perform plasmid transfections according to the manufacturer’s instructions (Thermo Scientific). Briefly, PEI was incubated with plasmid DNA at 3:1 ratio in Opti-MEM at RT for 20 min before addition to cells. After 6 h incubation, cells were washed and placed in fresh media. RNAiMAX (Invitrogen, Grand Island, NY) was used to transfect siRNA pools. Briefly, RNAiMAX was incubated with 50 nM of siRNA in Opti-MEM at RT for 20 min before addition to cells. After 24 h cells were washed and placed in fresh media. EEPD1 repression was confirmed by western blotting for every experiment. At least two clones were used for each Lentiviral shRNA experiment, to control for clonal variation in repression. There was no difference in phenotypes obtained between the shRNA and the siRNA repression of EEPD1.

Experiments were repeated using both techniques for EEPD1 depletion to control for off-target effects of the mechanism of repression. All experiments were performed at least three times, in at least two cell lines, to control for experimental and cell line variation. A549 lung cancer cells were used for most replicative experiments since this cell line has high EEPD1 expression. All studies in A549 were also repeated at least once in HEK-293 cells to control for cell lineage variability. Clonal survival after treatment with DNA damaging agents was determined by seeding 2,000 cells per 10 cm dish in either control media or media with varying concentrations of genotoxic chemicals, or exposure to varying doses of IR or UV light. Cells were exposed to etoposide or olaparib for 18 h, then washed and incubated in fresh media for 12 days. Colonies were stained with 0.1% crystal violet in methanol and counted. A colony greater than 50 cells was counted as a surviving clone. For HU, cells were treated continuously for 12 days before colonies were stained and scored. Plating efficiency was calculated as the number of colonies divided by the number of cells plated without genotoxin treatment. In all of these assays, survival was normalized to untreated cells transfected with control or EEPD1 si or shRNAs. Survival fractions were calculated as the number of colonies formed after exposure to a given genotoxin divided by the number of cells plated, then multiplied by the plating efficiency. Unpaired Student t tests were used for all statistical analysis, unless otherwise indicated. Each experiment was performed 6–9 times in triplicate.

Western Blot Analysis and Antibodies

EEPD1 expression was monitored by standard western blotting protocol [36] using a custom-produced rabbit polyclonal antibody to EEPD1 peptide (CAEFYTEKDWSKKDAPRNHS, Lampire Biological Laboratories, Pipersville, PA). Phosphorylated RPA32 (S4/S8) and total RPA32 antibodies were from Bethyl Laboratories (Montgomery, TX). Phosphorylated ATR (T1989) antibody was from Genetex (Irvine, CA, cat. Gtx128145). Total ATR, phosphorylated Chk1 (S345), and total Chk1 antibodies were from Cell Signaling Technology (Danvers, MA). 53BP1 and BLM antibodies were from Abcam (Cambridge, MA), Exo1 antibody was from Proteintech (Chicago, IL), and beta-actin antibody was from Sigma-Aldrich (St. Louis, MO). When protein levels were quantitated, each western analysis was performed at least 3 times, with densitometric measures of band intensities normalized to loading controls. Student t tests were used for statistical analysis of the protein intensity differences.

Immunoprecipitation and Chromatin Immunoprecipitation

Immunoprecipitation was performed with the Pierce Crosslink Magnetic IP/Co-IP kit according to manufacturer’s instructions (Thermo Scientific Cat.88805) as we described [36]. Briefly, HEK-293 cells overexpressing V5-tagged EEPD1 were treated, harvested and washed by PBS before lysis using IP lysis/wash buffer, then 5 ug of V5 mouse antibody (Invitrogen) were coupled to protein A/G magnetic beads and cross-linked with 20 uM disuccinimidyl suberate. The antibody cross-linked beads were incubated with cell lysate (0.8–1.2 mg) in a 500 ul of diluted lysate solution for 1 h at RT on a rotator. Beads were collected, washed and incubated with 100 ul of elution buffer for 5 min at RT. Antigen recovery was achieved by collecting the supernatant on a magnetic stand. Protease and phosphotase inhibitors were present in all buffers. ChIP was performed in HT256 cells using the procedure and GAPDH primers as we described [52]. ChIP primers for neo in HT256 152 nt from the I-SceI DSB site: Neo671 Forward: GACGGGCGTTCCTTGCGCAGCTG; Neo830 Reverse: CCAGATCATCCTGATCGACAAGAC. Primers 650 nt distant from the I-SceI site: Neo1 Forward: AAGCTTCACGCTGCCGCAAGCAC; Neo152 Reverse: GAACCTACCTGCTTTCTCTTTGC. GAPDH Forward: TCGGTTCTTGCCTCTTGTC; GAPDH Reverse CTTCCATTCTGTCTTCCACTC. Each immunoprecipitation was performed at least 3 times. Real time PCR to quantify immunoprecipitated sequences was performed using the SYBR green reagent (Applied Biosystems, Thermo Scientific) with the ABI 7000 sequence detection system, normalized to GAPDH amplification.

Replication Fork Restart

Two methods were used for measuring stalled replication fork restart. In the first method, replication fork restart after arrest was measured by immunofluorescent detection of BrdU foci after DNA denaturation (BrdU in DS DNA), as we described previously [36]. Log phase A549 cells expressing normal or repressed levels of EEPD1, with or without expression of siRNA-resistant FLAG-tagged EEPD1 were incubated with 10 mM HU for 18 h and then released into media with 10 uM BrdU for 30 min. After washing, cells were fixed at different time points. Replication recovery was shown as percentage of cells with ≥ 3 BrdU foci 2h after release from HU. Cells without HU treatment served as controls for background staining from normal cell proliferation, which was used as threshold for measurement. Values are averages (± SEM) for 11–23 distinct determinations (>100 cells scored per condition).

The second method was DNA fiber analysis, as we previously described [32,35]. Both A549 and HEK-293 cells were tested to control for cell line differences. 600,000 cells were incubated overnight at 37°C in six-well plates. 20 mm IdU was added to growth medium and incubated for 20 min at 37°C. The IdU media was removed and cells washed in fresh medium, cells were treated with 5 mm HU for 60 min or mock-treated. The HU-containing medium was replaced with fresh medium containing 100 mm CldU. Cells were then incubated for varying times at 37°C. The CidU medium was removed, cells harvested, resuspended in PBS, and 1,000 cells were transferred to a positively charged microscope slide (Superfrost/Plus, Daigger), and processed for DNA fiber analysis as we described previously [32]. Slides were mounted in PermaFluor aqueous, self-sealing mounting medium (Thermo Scientific), and DNA fibers were visualized using a confocal microscope (Olympus, FV1000D, 63× oil immersion objective). Images were analyzed using the Olympus Fluoview software.

DNA Damage Foci and Nuclear Structure Assays

Confocal immunofluorescence foci assays were performed as we described [35] with minor modifications. In brief, cells were cultured on coverslips followed by siRNA transfection and HU treatment. Cells were pre-extracted with 0.5% Triton X-100 and fixed with 4% paraformaldehyde for 20 min. Coverslips were then blocked with 1% BSA for 1 h before incubating with primary antibodies overnight. After washing twice, coverslips were incubated with secondary antibodies conjugated with Alexa Fluor dye (Invitrogen), mounted in anti-fade solution containing DAPI and stored at 4°C. All samples were analyzed within 24 h with a laser confocal scanning microscope (TCS-SP5, Leica Microsystems, Exton, PA). Cells with >5 foci were counted as positive. Photomicrographs of distinct cell populations were taken at equal magnifications and equal fluorescence intensities. For NBS1 and BRCA1 foci, the cells were fixed in 100% methanol and incubated with 1% BSA in 0.1% PBS-Tween for 1 h before incubating with primary antibodies overnight. RAD51 antibody was obtained from Santa Cruz Biotechnology (Dallas, TX). BRCA1 and RPA32 antibodies were obtained from Bethyl Laboratories (Montgomery, TX); gamma-H2AX (S139) antibody from Millipore (Billerica, MA), phosphorylated NBS1 (S343) and BrdU antibodies from Cell Signaling (Danvers, MA), and 53BP1 antibody from Abcam (Cambridge, MA). To assess nuclear structural abnormalities (micronuclei and post-mitotic bridging), control or HU-treated cells, with or without EEPD1 depletion, were grown on coverslips and fixed as above, and stained with 300 nM DAPI (Beckman) in PBS for 5 min. After washing thrice with PBS, coverslips were mounted in anti-fade solution and analyzed within 24 h. Of note, EEPD1 was located in the nucleus, but did not form discrete foci before or after damage. Each immunofluorescence assay was performed at least 3 times in triplicate.

Isolation of Proteins on Nascent DNA (iPOND)

iPOND was performed as described by Sirbu and colleagues[65,66], with minor modifications to improve protein capture. In brief, HEK-293T cells over-expressing V5-tagged EEPD1 were seeded in three 150 mm plates/condition 24 h before the experiment. After 24 h incubation, 10 uM EdU (Invitrogen) was added to the medium for 10 min. EdU treatment was followed with 3 mM HU (Sigma, St. Louis, MO) at indicated times. The cells were then fixed with 1% formaldehyde (Sigma) for 10 min at RT, quenched by 0.125 mM Glycine (Sigma), and collected by scraping. The cells were permeabilized with 0.25% Triton X-100 for 30 min, and then subjected to click–iT reaction using Biotin azide (Invitrogen) for 90 min at room temperature. Lysis conditions were modified to reduce background: lysis was performed in 0.25% SDS lysis buffer for 10 min at RT, followed by sonication at 4°C using Bioruptor (Diagenode) for 10 min with 30 s on/off cycles at high intensity. This treatment consistently yielded fragments between 80–100 bp. Finally, EdU-labeled DNA was pulled down by incubation with Streptavidin-agarose beads (Millipore) overnight at 4°C. The beads were washed once with lysis buffer, once with 1 M NaCl, and twice with lysis buffer. Bound proteins were eluted in 2 x NuPAGE LDS sample buffer (Invitrogen) containing 1 x sample reducing agent (Invitrogen) at 95°C for 35 min before loading for western analysis. Protease and phosphatase inhibitors (Thermo Scientific) were added to all buffers. Each iPOND assay was performed 3 times.

End Resection Assays

End resection was analyzed using two methods. First, end resection following gamma-irradiation was assessed using a single strand BrdU assay as described [51]. To detect single strand DNA formation, A549 cells were transfected with control and EEPD1 siRNAs, and plated on coverslips at 24 h, then incubated with 30 μM BrdU for 42 h before treatment with 20 Gy IR. At various times after irradiation, cells with native (non-denatured) DNA were analyzed by immunofluorescent confocal microscopy to detect BrdU in SS DNA created by end resection.

Second, end resection was also measured adjacent to a specific I-SceI-induced DSB by quantitative PCR (qPCR) [50,53]. Genomic DNA (gDNA) was extracted from HT1904 cells [52] harvested 4 h after infection with adenovirus vectors that express I-SceI (Adv-I-SceI) or GFP (Adv-GFP) as control. Half of the gDNA was digested with XmaI (NEB), and the remaining half was mock-digested. PCR reactions included XmaI-digested or undigested gDNA as template, 0.5 uM of each primer, 0.2 uM TaqMan probe, and 1X TaqMan universal master mix (ABI). qPCR was performed on a 7900HT Fast Real-Time PCR System (ABI) under standard thermal cycling conditions. Results were analyzed with SDS2.3 (ABI) and Graph Pad 6. For each sample, a ΔCT was calculated by subtracting the CT value of the undigested sample from the CT value of the XmaI-digested sample. The percentage of SS DNA was calculated with the following equation: SS DNA% = 1/(2^(ΔCt-1)+0.5)*100 [50]. Primers and probes were: forward (CGACCTTCCATGACCGAGTACAA), reverse (TCCGGGTCGACGGTGTG), and probe (6FAMACCGCGACGACGTCCCCCGGGCC-TAMRA). All Ct values were corrected for different DNA concentrations, as determined by qPCR of a ‘No Cut’ amplicon on chromosome 22 that lacks XmaI sites: forward (ACATTGTCTCTGTCATGGGC), reverse (TGTGTCAGGGATTTGCTCAC), and probe (6FAM AGAGCATGGGTGGATCCTGGATATTCA-TAMRA). DSB induction by Adenoviral-I-SceI was measured by qPCR and calculated as described [52] using a primer set that flanked the I-SceI site, and primers to the chromosome 22 ‘No Cut’ amplicon as a negative control. The ‘No Cut’ amplicon was used to normalize the amount of genomic DNA in the qPCR reaction, and the percentage of DSBs in Adv-GFP treated cells was set to zero. Both end resection assays were performed three times in triplicate.

Reversed Replication Fork Nuclease Assays

Pure recombinant human FLAG-tagged EEPD1 protein was generated in 293 cells and purified as we described [84]. Nuclease assays were performed as we described [32,84]. 3’ overhang reversed fork (“chicken foot”) structures were obtained by annealing SHL101, SHL108, SHL109, and SHL110, and then gel-purifying the annealed structure. 5’ overhang reversed fork structures were obtained by annealing SHL101, SHL108, SHL111, and SHL112 and then gel-purifying the intact annealed structure [32,84]:

SHL101 (60mer): 5’-CGATACTGAGCGTCACGGACTCTGCCTCAAGACGGTAGTCAACGTGTTACAGACTTGATG-3’

SHL108 (60mer): 5’-CTAGACTCGAGATGTCAAGCAGTCCTAACTTTGAGGCAGAGTCCGTGACGCTCAGTATCG-3’

SHL109 (60mer): 5’-CATCAAGTCTGTAACACGTTGACTACCGTCGATCCACTAG AGGTCTAAGCGACCTCATTC-3’

SHL110 (40mer): 5’-CTAGTGGATCAGTTAGGACTGCTTGACATCTCGAGTCTAG-3’

SHL111 (40mer): 5’-CATCAAGTCTGTAACACGTTGACTACCGTCGATCCACTAG-3’

SHL112 (60mer): 5’-AGGTCTAAGCGACCTCATTCCTAGTGGATCAGTTAGGACTGCTTGACATCTCGAGTCTAG

Homologous Recombination (HR), Non-homologous End-Joining (NHEJ), and Micro-homology End Joining (MMEJ) Assays

The HT256 reporter system was used to determine I-SceI-induced HR efficiency and gene conversion tract spectra as we described [39,85]. The EJ5-GFP U2OS system was used to assess NHEJ [37,38]. Both of these reporter systems have single, integrated copies of reporters with I-SceI target sites cleaved upon transfection of an I-SceI expression vector. Cells were transfected with either control or EEPD1 siRNAs or shRNAs, and then transfected 24 or 48 h later with pCBA-SceI or empty vector, using PEI. After 48 h incubation, EJ5 cells were trypsinized and washed with PBS and GFP-positive cells reflecting NHEJ frequencies were measured by FACSort (Becton-Dickinson, San Jose, CA) and analyzed with CellQuest (Becton-Dickinson) software. Productive HR in HT256 cells reconstitutes a functional neomycin phosphotransferase gene, generating G418 resistant colonies. Two thousand cells were plated in three 10-cm dishes per each condition, in non-selective media, 24 h after I-SceI vector transfection to establish plating efficiency. To assess HR, 500,000 cells were plated in media with G418 (325 ug/ml, 100% active) added 24 h after transfection. DSB-induced HR frequencies were calculated as the number of G418-resistant colonies per viable cell plated in G418 medium after 21 days, normalized for plating efficiency. HR assays were performed 15 times in triplicate and the NHEJ assays 12 times in triplicate.

Gene conversion tracts were analyzed as we described [39,40,85] on the above HR repaired neo-positive colonies. HT256 G418 resistant colonies were stained and counted, or expanded under continuous G418 selection for gDNA isolation and molecular analysis. Genomic DNA was extracted using the DNeasy Tissue Kit (Qiagen, Valencia, CA). Primers A (CCTTCACTTTCCAGAGGGTC) and B (GCGAAGAACTCCAGCATGAG) were used to amplify a 1.5 kb fragment comprising the recipient neo allele (MMTVneo) by using standard PCR conditions. The donor neo allele carries 12 silent single-base mutations at approximately 100 bp intervals that create restriction fragment length polymorphisms (RFLPs). These RFLP markers allow high-resolution analysis of gene conversion tract length, directionality, and continuity. The 12 silent RFLP markers and the natural BanII site were mapped in PCR fragments amplified from HR products.

The analysis of MMEJ versus HR competitive repair from a single DSB was performed in modified U2OS cells as we described [19]. To directly compare MMEJ with HR, an EGFP-based MMEJ and HR competition reporter system, termed EGFP-MMEJ/HR-MluI, was generated. This reporter had the EGFP (R-EGFP) cassette of EGFP-HR replaced with the EGFP-MMEJ cassette. A unique MluI site in the parent EGFP (D-EGFP) cassette was created via a silent mutation at the BssHII site. Upon I-SceI cleavage, restoration of a functional EGFP cassette results in loss of the I-SceI site after cells undergo repair by either MMEJ or HR. PCR analysis of the sorted green cells using primers specific for R-EGFP was performed. The primers were: EGFP MMEJ/HR Forward:5’-ACGGGGTCATTAGTTCATAGCCCA, EGFP MMEJ/HR Reverse: 5’-GGGATTTTGCCGATTTCGGCC. Repair of the I-SceI DSB by MMEJ would retain one copy of the 9-bp duplication with an intact BssHII site. The percentage of the BssHII-digestible bands within the total PCR amplified product reflects the MMEJ frequency. Repair of that I-SceI-induced DSB by HR transfers the MluI site from D-EGFP to R-EGFP, and thus the percentage of MluI-digestible bands of the total PCR product reflects the HR frequency.

Nuclear Structure Analysis

To assess nuclear structural abnormalities, micronuclei and post-mitotic bridging from aberrant chromosomal segregation, control or HU-treated cells, with or without EEPD1 depletion, were grown on coverslips and fixed as above, and stained with 300 nM DAPI (Beckman) in PBS for 5 min [27]. After washing with PBS, coverslips were mounted in anti-fade solution and analyzed within 24 h. Of note, EEPD1 was located in the nucleus, but did not form discrete foci with or without DNA damage. At least ten distinct determinations (142–190 nuclei per determination) were performed for each treatment group.

Cytogenetic Analysis

Structural aberrations in metaphase chromosomes were scored by Solid Giemsa staining as described [86,87]. EEPD1 and/or 53BP1 were repressed using siRNA in log phase A549 cells, with or without 18 h treatment with 10 mM HU. Cells were washed with PBS and fresh media with colcemid (final concentration 0.25 ug/mL) was added, and cells were incubated for 24 h before harvest. Chromosome preparations were made according to the standard air drying procedure as we described [87]. Cells were harvested, washed with pre-warmed PBS twice, hypotonically treated (0.56% KCl, 20 min at 37°C) and subsequently fixed in freshly prepared acetic acid-methanol (1:3). At least three changes of fixative were performed before the cell suspension was dropped on to a pre-cleaned chilled glass slide and dried at RT at least for 1 day before staining. Structural translocations such as dicentric and ring chromosomes, and Robertsonian translocations, were scored under 63x magnification [87]. Statistics were calculated using Fisher exact tests. Cytogenetic spreads were performed three distinct times with a total of 102–374 metaphase spreads were analyzed per condition.

Single Cell Electrophoresis (Comet) Assays

Alkaline single cell electrophoresis assays for SS nicking was performed as described [88] using the CometAssay kit (Trevigen, Gaithersburg, MD). Briefly, A549 cells were transfected with siRNAs and treated with 10 mM HU for 1 h or mock treated. Cells were harvested, washed with cold PBS and mixed with molten 1:10 (v/v) LMAgarose and immediately spread over the sample area of comet slides. Cells were immobilized at 4°C in the dark for 30 min and immersed in lysis solution overnight. For the alkaline comet assay, slides were treated with alkaline unwinding solution for 1 h at 4°C in the dark before electrophoresis in alkaline electrophoresis buffer. Samples were rinsed with water and immersed in 70% ethanol before drying at 37°C for 15 min. SYBR Gold was used to stain dried agarose for 30 min at RT before rinsing and drying again. Slides were viewed with a Leica inverted epifluorescence microscope and analyzed by software Image J with OpenComet plugin [89]. Alkaline comet assays were performed five times in triplicate, counting >100 slides per experiment.

Gene Expression Analysis

Colorectal carcinoma biopsies were re-analyzed specifically for EEPD1 expression, compared to adjacent normal mucosa. Gene expression measurements were performed in 217 patients with colorectal carcinomas from pre-therapeutic biopsies as we described [80]. From 217 patients, tumor samples were extracted, and from 181 of these matched normal tissue (mucosa) samples were also obtained. Gene expression was measured on Agilent Human Microarrays. Microarray data was extracted as log₂ intensities and quartile normalized. Gene expression of EEPD1 (Agilent Probe: A_23_P333498, Refseq: NM_030636, Chr. Coord: chr7:36340858–36340917, Probe: CAGCCTGTTCTTACTCCAGCTCAACCCATTGGGTGTTGGCTGTTTTTGGTTTTAGTTGTT) was obtained. Significance was computed from matched tumor vs. mucosa samples using a paired Wilcoxon test.