Transgenic Mice

C57BL/6 and Gli1^+/LacZ (Gli1^+/−) mice were obtained from Jackson Labs (Bar Harbor, ME) and bred to generate Gli1^LacZ/LacZ (Gli1^−/−) mice. These mice contain a knock-in of the cDNA for nuclear β-galactosidase (nLacZ) inserted into exon 2 of the Gli1 gene abolishing endogenous gene expression. Transgenic founders were generated by micro-injecting CMV-Shh^WT-HA, CMV-Shh^F200H-HA, H⁺/K⁺-ATPase-β-Shh^WT-HA and H⁺/K⁺-ATPase-β-Shh^F200H-HA constructs into fertilized eggs obtained by mating (C57BL/6/J X SJL/J)F1 males and females of the same background (UM Transgenic Core, Ann Arbor, MI). The N-terminal Hemagglutinin (HA)-tagged mouse Shh constructs were generated by inserting four copies of the HA epitope (TACCCTTACGACGTTCCTGATTACGCT) downstream of nucleotide 96 (amino acid 32) in the Shh cDNA sequence. The F200H mutant Shh transgene was generated by substituting “TT” nucleotides for “CA” at position 597 of the mouse Shh cDNA using the QuickChange site-directed mutagenesis kit (Stratagene, Santa Clara, CA). These sequences were subcloned into the topoisomerase site of pcDNA3.1/V5-His-TOPO and into the BamHI restriction site of the mouse H⁺/K⁺-ATPase-β subunit expression plasmid (–1,035 to +24). Mice were housed under specific pathogen-free conditions and fasted overnight prior to use, with free access to water. All mouse studies were approved by the University of Michigan Institutional Animal Care and Use Committee.

Helicobacter felis culture and infection

H. felis (CS1 strain) stocks were stored in 50% glycerol solution at −80°C. Bacteria were cultured in sterile-filtered Brucella broth (BD, Franklin Lakes, NJ) plus 10% FBS (Atlanta Biologicals, Lawrenceville, GA) using the GasPak™ EZ Campy Container System (BD) at 37°C with 150 rpm shaking. The cultures were spun down at 2700 rpm at room temperature, and the pellets resuspended in Brucella broth plus 10% FBS (Thermo Fisher Scientific, Houston, TX). Cells were counted using a hemocytometer by diluting the cells 1∶100 in 9∶1 HBSS/Formalin solution. Mice were gavaged 3 times over 3 days with 10⁸ H. felis cells in 100 μL of Brucella broth. Control mice were gavaged with Brucella broth alone.

H. felis DNA quantification

Gastric tissue from the corpus and fundus was snap frozen and stored at −80°C. Total DNA was extracted using the DNEasy Blood and Tissue Kit (Qiagen). Quantitative PCR was performed using the H. felis Fla-B primers-F: 5′TTCGATTGGTCCTACAGGCTCAGA, R: 5′TTCTTGTTGATGACATTGACCAACGCA 3′ on a CFX96 real-time PCR detection system (Bio-RAD).

Tissue Preparation

Mice were starved overnight then euthanized. The stomachs were removed, opened along the greater curvature, and cut into longitudinal strips for histology from the lesser and greater curvatures. Half of the strips were fixed in 4% formaldehyde (Fisher Scientific) and the other half directly embedded in OCT compound (Fisher Scientific) and snap-frozen. The remainder of the stomach, containing only fundus and corpus, was minced and processed for RNA extraction or digested for flow cytometric analysis.

Immunofluorescence

For frozen sections, 8 µm sections were fixed in 4% paraformaldehyde for 10 min, washed in PBS twice, and then blocked with 20% donkey serum (#017-000-121, Jackson ImmunoResearch, West Grove, PA) in PBS. Frozen sections were immunostained with the following antibodies: β-gal (gift from James Douglas Engel, Department of Cell and Developmental Biology, University of Michigan), TFF-2 (gift from Nicholas Wright, Barts and The London School of Medicine, London, UK), F4/80 (#MCA497GA, AbD Serotec, Raleigh, NC), CD11b (#ab6332-100, clone M1/70.15, Abcam, Cambridge, MA), CD11c-FITC (#553801, BD Pharmingen, BD Bioscience, Bedford, MA), α-SMA-Cy3 (#C6198, Sigma, St Louis, MO), CD19 (#MCA1439, AbD Serotec), MPO-FITC (#90812, Abcam), Slfn-4 (#sc-8903, Santa Cruz Biotechnology, Santa Cruz, CA), pSTAT-3 (#9131, Cell Signaling, Boston, MA), IL-1β (#AF-401-NA, R&D Systems, Minneapolis, MN), Ki-67 (#RM-9106-S1, Thermo Scientific, Fisher), Shh (#sc-1194, Santa Cruz, CA), E-cadherin (#3195, Cell Signaling), and GSII-FITC (#FL-1211, Vector Labs, Burlingame, CA). For unlabeled primary antibodies, the staining was developed using Alexa Fluor-conjugated secondary antibodies (Molecular Probes, Invitrogen, Carlsbad, CA).

For paraffin sections, 8 µm sections were deparaffinized in xylene and 100% ethanol. Sections were re-hydrated with distilled water and antigen retrieval was performed using 10 mM citric acid buffer (pH 6). Slides were washed in 0.01% Triton X-100 (Fisher) in PBS twice, incubated with 20% donkey serum (#017-000-121, Jackson ImmunoResearch) and immunostained with the following antibodies: H⁺/K⁺-ATPase-β (#D032-3, Medical and Biological Laboratories, Woburn, MA), HA-probe (#sc-7392, Santa Cruz), Shh (#sc-1194, Santa Cruz), intrinsic factor (gift from David Alpers, Washington University, St. Louis, MO), and GSII-FITC (#FL-1211, Vector Labs). For unlabeled primary antibodies, staining was developed using Alexa Fluor-conjugated secondary antibodies (Molecular Probes, Invitrogen). Concentration and species matched immunoglobulins were used as controls for each antibody. Staining was visualized using an Olympus Fluoview scanning confocal microscope (Olympus, Center Valley, PA).

Morphometric Analysis

Well-oriented gastric glands from the fundus and corpus were observed under a 20× objective lens (200× total magnification) and scored for neutrophilic infiltration (polymorphonuclear leukocytes [PMN]), gastritis, follicle formation, and metaplasia. Each microscopic field was scored only for the presence or absence of the lesion according to the following criteria: 1) neutrophilic inflammation was defined by the presence of several clusters of neutrophils within the mucosa; 2) “displacement of epithelial glands” is defined as the displacement of gastric glands by inflammatory cell infiltrates of any cell type; 3) metaplasia was defined by the presence of an expansion of the mucous cell lineage compartment. For each slide, the number of positive fields was divided by the total number of fields examined and was expressed as a percentage of the affected fields.

Real-time quantitative PCR

The forestomach was removed and tissue from the glandular stomach was minced and homogenized in TRIzol (Invitrogen). RNA clean-up was performed using the RNeasy Minikit (Qiagen, Valencia, CA), and cDNA synthesized from 1 µg of RNA using iScript reverse transcriptase (Bio-Rad, Hercules, CA). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using Platinum Taq DNA polymerase (Invitrogen) on a CFX96 real-time PCR detection system (Bio-RAD), using the following primer sequences (Tm  = 65°C for all primers):

CD11b-F: 5′CTCCGGTAGCATCAACAACAT, R: 5^′TGATCTTGGGCTAGGGTTTCT;

CD11c-F: 5′CTGGATAGCCTTTCTTCTGCTG, R: 5′GCACACTGTGTCCGAACTC;

F4/80-F: 5′CCCAGCTTCTGCCACCTGCA, R: 5′GGAGCCATTCAAGACAAAGCC;

Gli1-F: 5′TTGGGATGAAGAAGCAGTTG, R: 5′GGAGACAGCATGGCTCACTA;

HPRT-F: 5′AGGACCTCTCGAAGTGTTGGATAC, R: 5′AACTTGCGCTCATCTTAGGCTTTG;

IFN-γ-F: 5′TCAAGTGGCATAGATGTGGAAGAA, R: 5′TGGCTCTGCAGGATTTTCATG;

IL-12p35-F: 5′AAATGAAGCTCTGCATCCTGC, R: 5′TCACCCTGTTGATGGTCACG;

IL-12p40-F: 5′AAACCAGACCCGCCCAAGAAC, R 5′AAAAAGCCAACCAAGCAGAAGACAG;

IL-4 F: 5′ACAGGAGAAGGGACGCCAT, R: 5′GAAGCCCTACAGACGAGCTCA;

IL-5-F: 5′AGCACAGTGGTGAAAGAGACCTT, R: 5′TCCAATGCATAGCTGGTGATTT,

IL-6-F: 5′GAGGATACCACTCCCAACAGACC, R: 5′AAGTGCATCATCGTTGTTCATACA;

IL1-β-F: 5′CAACCAACAAGTGATATTCTCCATG, R: 5′GATCCACACTCTCCAGCTGCA;

IL17A-F: 5′GCTCCAGAAGGCCCTCAGA, R: 5′AGCTTTCCCTCCGCATTGA;

KC-F: 5′CTGCACCCAAACCGAAGTCAT, R: 5′TTGTCAGAAGCCAGCGTTCAC;

MPO-F: 5′CCAGCAGCCATGAAGTA, R: 5′CATAACGGAAAGCATTGGTG;

Ptch1-F: 5′CTGCTGTGGTGGTGGTATTC, R: 5′GGCTTGTGAAACAGCAGAAA;

SAA3-F: 5′TGCCATCATTCTTTGCATCTTGA, R: 5′CCGTGAACTTCTGAACAGCCT;

Shh-F: 5′ATGTTTTCTGGTGATCCTTGCT, R: 5′ATCGTTCGGAGTTTCTTGTGAT;

Slfn-4-F: 5′GCCCTCTGTTCAAGTCAAGTGTCC, R: 5′CCCAGATGAAATCCTTTCCACGA;

TNF-α-F: 5′CATCTTCTCAAAATTCGAGTGACAA, R: 5′TGGGAGTAGACAAGGTACAACCC;

CCL-19-F: 5′TGTGGCCTGCCTCAG ATTAT, R: 5′AGTCTTCCGCATCATTAGCAC;

CD3-F: 5′TGCTCTTGGTGTATATCTC ATTGC, R: 5′CAGAGTCTGCTTGTCTGAAGCTC.

Microarray analysis

Microarray analysis was performed by the Microarray Core Facility at the University of Michigan. Briefly, RNA was labeled by preparing biotinylated antisense RNA (aRNA) from 250 ng of total RNA according to the Affymetrix GeneChip 3′ IVT Express kit protocol (Affymetrix, Santa Clara, CA). Following fragmentation, 7.5 µg of aRNA were hybridized for 16 hr at 45°C to the Mouse Genome 430 2.0 Perfect Match Peg Arrays (Affymetrix) and scanned using the Affymetrix Gene Atlas system (software version 1.0.4.267, Affymetrix).

Laser Capture Microdissection

Frozen sections (10 µm) were mounted on Leica Pen-Membrane (2 µm) slides (Leica Microsystems Inc., Buffalo Grove, IL) and stored at −20°C until further use. Frozen sections were air-dried, fixed in RNase-free 70% ethanol (pre-chilled, −30°C) for 5 min at room temperature, air-dried, stained in 0.25% RNase-free toluidine blue for 10 sec, then washed in 70% ethanol (pre-chilled, −30°C). Sections were air-dried and the microdissectates collected using a Leica LMD 7000 microdissection microscope (Leica Microsystems Inc.).

Flow cytometry

Stomach tissue was minced, incubated in 10 ml HBSS supplemented with 1 mM DTT (Sigma) and 1 mM EDTA (#51201 Lonza, NJ, USA), and then shaken at 160 rpm for 1 hr at 37°C. The supernatant was collected by passing the 10 ml sample through a 40 µm cell strainer (#08-771-1 Fisher). The tissue collected in the cell strainer was further digested in 10 ml of RPMI (without L-glutamine) containing 5% BSA (#9048-46-8 Roche) and 1.5 mg/ml Dispase II (#04942078001 Roche) with 160 rpm shaking at 37°C for 90 min. The supernatant was collected by passing the digested tissue through a 40 µm cell strainer and both supernatants pooled. For bone marrow cells, the femur marrow was directly flushed with RPMI and treated with ACK lysis buffer (#10-548E Lonza) to lyse red blood cells. The cells were spun down at 1600 rpm, resuspended in 200 µl of PBS containing 5% BSA (Roche), blocked with purified rat anti-mouse DC16/CD32 mouse Fc block (#553141 BD Biosciences, San Diego, CA) at 4°C for 5 min, and incubated with F4/80-FITC (#MCA497FT AbD Serotec), CD11b-PE-Cy7 (#561098 BD Pharmingen, BD Biosciences), CD11c-APC (#561119 BD Biosciences), CD45-PE (#12-0451-81 eBioscience), pSTAT3 (pY705)-PerCP-Cy5.5 (#560114 BD Biosciences), EpCAM-APC (#17-5791-80 eBioscience), GSII-FITC (#FL-1211 Vector Labs), or IL-6-PE (#562050 BD Biosciences). The cells were fixed in 100 µl of Reagent A (#GAS001S5 Invitrogen), washed, and resuspended in 500 µl PBS containing 5% BSA in a BD Falcon tube (#352052 BD). For pSTAT3-PerCP-Cy5.5 an additional permeabilization step was added by incubating the cells in Reagent B (#GAS002S5 Invitrogen). The cells were analyzed using an Accuri C6 Flow Cytometer (Accuri Cytometers, Ann Arbor, MI).

To flow sort cells for subsequent RT-PCR analysis, gastric cells were prepared as described above and gated for CD45, F4/80 and CD11c-expressing cells using the CD45-PE (#12-0451-81 eBioscience), F4/80-FITC (#MCA497FT AbD Serotec) and CD11c-APC (#561119 BD Biosciences) antibodies. Cells were collected in buffer RLT containing β-mercaptoethanol and carrier RNA using a sy3200 (Synergy) sorter (iCyt, Champaign, IL) then extracted using the RNEasy Microkit (Qiagen, Valencia, CA) according to the manufacturer's instructions.

Cell Culture Experiments

NCI-N87 mucous cells (#CRL-5822 ATCC) were plated in 24 well plates, serum-starved overnight, and then treated with recombinant human IL-6 (100 ng/ml, 206-IL-010/CF, R&D Systems) or IL-1β (1 ng/ml, 201-LB-005, R&D Systems) overnight. IL-1RA (10 ng/ml) was added 2 hrs prior to IL-1β treatment. The cells were lysed in TRIzol for RNA extraction and RT-qPCR analysis.

Western Blot Analysis

The cell lysates of NIH-3T3 cells were homogenized in T-per extraction reagent (78510, Pierce, Rockford, IL). The protein lysate (100 µg) was resolved on a Novex 4–20% Tris-Glycine gel (#EC6025 Invitrogen) and then transferred to nitrocellulose using the iBlot Dry Blotting System (Invitrogen) according to the manufacturer's instructions. The membranes were incubated in KPL Detector Block (#71-83-00 Gaithersburg, MD) for 1 hour at room temperature and then incubated with 1∶100 Shh (#sc-1194; Santa Cruz) or 1∶1000 HA-tag (#sc-7392, Santa Cruz) antibodies at 4°C overnight. Membranes were washed with TBS containing 0.1% Tween, incubated with IRDye 680-conjugated antibodies (Licor, Lincoln, NB), and visualized with an Odyssey infrared imager (Licor).

Chromatin Immunoprecipitation (ChIP) assay

Gli1 binding sites in the Slfn-4, Slfn-2 and SAA3 promoters were identified using Genomatix (Munich, Germany). Primers were designed to amplify the nucleotide sequence between −3323 and −3101 of the Slfn4 promoter, which contains a GGCCACCCA Gli1 binding site (consensus sequence GACCACCCA). The primers were designed as follows: F 5′ AAGGCAGAAACATG GCAGCATCC 3′; R 5′ ACTTTGGCTTGTGTCAGGTTGGC 3′. A nucleotide sequence between −589 and −385 that lacks a Gli1 binding site was used as a negative control and was amplified using the following primers: F 5′ TGTGTTCCTGAGTGTGAGTGTTC 3′; R 5′ CTTCCCAGAGCAG CCTTAGC 3′. Flag-tagged pcDNA3.1-Gli1 (gift from Andrzej Dlugosz, Department of Dermatology, University of Michigan) or empty vector were transfected into RAW264.7 cells. ChIP was performed using the Flag-tag antibody (#2368 Cell Signaling) and the Chromatin Immunoprecipitation (ChIP) Assay Kit (#17–295 Millipore, Kankakee, IL).

Statistical Analysis

For in vivo qPCR analysis and pathological scoring of mice, each bar graph represented the mean +/− standard error from 5–10 mice. For cell culture experiments, error bars represented the means +/− standard error of the mean from 3 independent experiments. Data were tested for normality using the Shapiro-Wilk W test (Prism, GraphPad Software, La Jolla, CA). Data were compared using one-way analysis of variance (ANOVA) with Dunnet's (parametric) or Dunn's (non-parametric) multiple comparison tests (Prism). P values less than 0.05 were considered significant.

Microarray Accession Number

The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus (El-Zaatari et al., 2013) and are accessible through GEO Series accession number GSE43693 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE43693).

Gli1 Deletion Prevents Gastric Metaplasia

To understand the role of Hedgehog signaling in gastric metaplasia, WT, Gli1^+/LacZ (Gli1^+/−) and Gli1^LacZ/LacZ (Gli1^−/−) mice (Figure 1A) were infected with H. felis. Gli1^+/− and Gli1^−/− mice expressed significantly reduced or absent Gli1 mRNA in the stomach respectively (Figure 1B). Although inflammation was observed 2 months after inoculating the WT mice, by 6 months there was an increase in stomach weight (Figure 1C), loss of parietal and chief cells, and development of spasmolytic polypeptide-expressing metaplasia (SPEM) characterized by the expansion of the mucous neck cell compartment (Figure 1D and E) and co-labeling of mucous cells with the chief cell lineage marker intrinsic factor (Figure S1) [3]. The amount of SPEM (Figure 1F and Figure S1), polymorphic neutrophil (PMN) infiltration (Figure 1G) and epithelial gland displacement (Figure 1H) was greatest in the infected WT mice. In contrast, Gli1^+/− and Gli1^−/− mice were also inflamed but lacked any SPEM (Figure 1D-F). These differences were not due to differences in H. felis colonization between WT, Gli1^+/− or Gli1^−/− mice (Figure 1I). Despite the absence of metaplasia, there were similar amounts of F4/80⁺ myeloid cells infiltrating the infected WT, Gli1^+/− and Gli1^−/− stomachs (Figure 1J), demonstrating that Gli1 deletion prevented the transition from gastritis to SPEM.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Gli1 deletion prevents gastric metaplasia.

A) Schematic representation of LacZ substitution for the Gli1 gene to generate Gli1^+/− and Gli1^−/− mice. B) Gli1 mRNA in stomachs of WT, Gli1^+/− and Gli1^−/− mice. C) Stomach weight normalized to total body weight in infected and uninfected mice. D) Triple immunofluorescent staining of Griffonia simplicifolia II (GSII) lectin (green; mucous neck cells), intrinsic factor (red; chief cells), and H⁺/K⁺-ATPase (orange; parietal cells) in 6-month H. felis-infected WT, Gli1^+/− and Gli1^−/− stomachs. E) Hematoxylin and eosin (H&E) staining of the gastric mucosa in 6-month H. felis-infected WT, Gli1^+/− and Gli1^−/−. F–H) Histologic scoring of metaplasia, PMN infiltration, and displacement of epithelial glands by infiltrating inflammatory cells in 2- and 6-month H. felis-infected WT, Gli1^+/− and Gli1^−/− stomachs. I) qPCR quantification of H. felis flagellar filament B (Fla-B) DNA in the infected mucosa. J) Flow cytometric analysis of F4/80⁺ cells versus side-scatter in WT Sham and 6-month infected WT, Gli1^+/− and Gli1^−/− stomachs (N = 3 mice per group). Open and closed bars denote uninfected and infected mice respectively. For RT-qPCR experiments, N = 5–10 mice per group. Error bars represent the mean +/− SEM. ***p<0.001; **p<0.01; *p<0.05. N.S.  =  not significant.

https://doi.org/10.1371/journal.pone.0058935.g001

Gli1 Deletion Prevents Th1, Th2, not Th17 inflammatory responses

H. felis normally induces a complex inflammatory response in the stomach including increased Th1, Th2 and Th17 T helper lymphocyte subsets [13], [14], [15]. By 6-months, H. felis infection of WT mice induced the gene expression of Th1 (Figure 2 A–E), Th2 (Figure 2 F and G), and Th17 cytokines (Figure 2H) in addition to the chemokine KC (Figure 2I), the mouse IL-8 ortholog. In contrast, H. felis failed to induce several of these cytokines in the Gli1^+/− and Gli1^−/− stomachs except for the p35 subunit of IL-12 (Figure 2E) and IL-17A (Figure 2H), suggesting that these cytokines were not affected by loss of Gli1 and did not significantly contribute to the development of SPEM.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Gli1 deletion blocks increase in Th1 and Th2 cytokines.

A–E) RT-qPCR determination of mRNA for Th1-associated cytokines. F–G) RT-qPCR of mRNA for Th2-associated cytokines. H) RT-qPCR of mRNA for the Th17-associated cytokine IL-17A. I) RT-qPCR analysis of the mRNA for the mouse IL-8 ortholog, chemokine KC. Open and closed bars denote uninfected and infected mice respectively. N = 5–10 mice per group. Error bars represent the mean +/− SEM. **p<0.01; *p<0.05.

https://doi.org/10.1371/journal.pone.0058935.g002

Gastric Myeloid Cells Express Gli1

Gumucio and coworkers previously showed that intestinal myeloid cells and myofibroblasts express Gli1 [11]. Myeloid cells are a major source of IL-1β [16], one of the major cytokines sufficient to induce gastric metaplasia [5], [17]. In addition, the expected induction of IL-1β gene expression was reduced in the infected Gli1 mutant mice (Figure 2A), suggesting that Gli1 expression contributes to myeloid cell production of 1L-1β. To characterize the immunological defect in the Gli1 mutant mice, we identified myeloid cell subsets in the stomachs of infected WT and mutant mice. Using the LacZ reporter to identify Gli1-expressing cells, we found that the LacZ reporter was expressed primarily in α-SMA⁺ myofibroblasts and smooth muscle cells in the uninfected stomach as previously reported [11] (Figure 3A). However LacZ expression was significantly reduced in these resident mesenchymal cells 6 months after H. felis infection (Figure 3 A and B, insets 1–3), but was detected in a population of infiltrating cells that were F4/80⁺ (Figure 3B inset 4 and Figure S2A), CD11b⁺ (Figure S2B), and CD11c⁺ (Figure S2C). LacZ expression was not detected in CD19⁺ (B lymphocytes, except for a few transitional cells at the follicle border, Figure S3A, inset), CD3⁺ (T lymphocytes, Figure S3B) or myeloperoxidase⁺ cells (MPO, PMNs, Figure S3C). No LacZ expression was detected with the isotype control IgGs (Figure S3D) or in WT mice lacking the LacZ gene insert (Figure S3E). The immunohistochemical analysis was consistent with reduced CD11b and CD11c surface marker gene expression in the Gli1 mutant mice (Figure 3 C–D). However the total frequency of CD45⁺MHCII⁺ myeloid cells between 6-month infected WT and Gli1^−/− mice was not affected (Figure 3E), indicating a shift in the composition of the myeloid population rather than a defect in total myeloid cell recruitment. Indeed, flow cytometry revealed no significant difference in CD11b⁺CD11c⁻ cells but instead a 70% reduction in CD11b⁺CD11c⁺ myeloid cells in the infected Gli1^−/− mice (Figure 3F). This corresponded to a shift in the frequency of CD11c⁺ cells within the CD11b⁺ population from 36.5% to 13.1% (Figure 3G). Consistent with this result, we detected by immunofluorescence a significant loss of CD11c⁺, but not CD11b⁺ cells in the infected Gli1^+/− and Gli1^−/− mouse stomachs (Figure S4). Analysis of the bone marrow revealed no detectable CD11b⁺CD11c⁺ cells (Figure 3H and I). Although we cannot exclude the presence of CD11b⁺CD11c⁺ cells in the bone marrow, which might be dwarfed by the abundance of single positive cells, we concluded that CD11b⁺CD11c⁻ cells differentiate into a CD11b⁺CD11c⁺ population in the stomach in a Gli1-dependent manner. The acquisition of CD11b⁺CD11c⁺ cells in the Helicobacter-infected stomachs at 6 months mirrors the CD11b⁺ subset of tumor infiltrating myelomonocytoid cells described by Umemura et al. that acquire the CD11c⁺Gr1⁺ surface markers along with their T cell suppressor function (myeloid-derived suppressor function or MDSCs) [18]. Therefore we concluded that Gli1 is necessary for the differentiation of myeloid cells into CD11b⁺CD11c⁺ cells within the preneoplastic gastric microenvironment that correlates with the SPEM.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Gli1 deletion prevents expansion of CD11b⁺CD11c⁺ myeloid cell subsets.

A–B) Immunofluorescent detection of β-gal (green), α-SMA (red), and DAPI (blue) in sham- and H. felis-infected Gli1^+/LacZ mice. C–D) RT-qPCR analysis of CD11b and CD11c in 2- and 6-month infected mice. E) Bar graphs representing the percentages of CD45⁺MHCII⁺ myeloid cells per total gastric cell number in 6-month H. felis-infected WT versus Gli1^−/− mice. F) Flow cytometric analysis of CD11b and CD11c in 6-month infected WT and Gli1^−/− mice. Values on dot plot represent the percentages of cells (relative to total CD45⁺MHCII⁺ myeloid cell population) +/− SEM from N = 3 mice per group. G) Flow cytometry of CD11c+ cells within the CD11b⁺ stomach population (R1 gate from Figure 3F) of 6-month H. felis-infected WT versus Gli1^−/− mice. H) Flow cytometric analysis of CD11b⁺ bone marrow cells in 6-month H. felis-infected WT and Gli1^−/− mice. I) Flow cytometry of CD11c⁺ cells within the CD11b⁺ bone marrow population (P1 gate from Figure 3H) of 6-month H. felis-infected WT and Gli1^−/− mice. Open and closed bars denote uninfected and infected mice respectively. Error bars represent the mean +/− SEM. For RT-qPCR graphs, N = 5–10 mice per group. For flow sorting bar graph, N = 3 mice per group. Values on flow cytometric dot blots represent the mean +/− SEM from 3 mice per group. *p<0.05.

https://doi.org/10.1371/journal.pone.0058935.g003

Schlafen-4 is a Gli1-target gene that marks the CD11b⁺CD11c⁺ population associated with gastric metaplasia

To identify Gli1-dependent myeloid regulatory factors, we performed a microarray analysis of gastric tissue from Helicobacter-infected WT and Gli1^−/− mice. The genome-wide analysis revealed eight potential Gli1 targets associated with myeloid cell differentiation during H. felis infection (Figure 4A) in addition to several inflammatory pathways (Figure S5). Of particular interest were two Schlafen genes, Schlafen-4 (Slfn-4), Schlafen-2 (Slfn-2) and serum amyloid protein A3 (SAA3) (Figure 4A), whose gene products were previously implicated in macrophage differentiation [19], [20] and recruitment [21] respectively. RT-qPCR analysis confirmed that Slfn-4 and SAA3 were only induced in the H. felis-infected WT stomach (Figure 4B and Figure S6A). We performed in silico analysis to identify Gli binding sites and identified one site in the Slfn-4 (Figure 4C), one in Slfn-2 and several in the SAA-3 promoters (El-Zaatari and Merchant JL, unpublished data). Chromatin immunoprecipitation (ChIP) demonstrated that Gli1 is present at the Slfn-4 promoter near the Gli1 binding site GGCCACCCA (consensus site  =  GACCACCCA), but not at a different site that lacked a Gli1 binding sequence (Figure 4C). Since Slfn-4 is associated with aberrant myeloid cell differentiation [19], we further defined which myeloid subpopulations express Slfn-4⁺ in the stomach. Immunofluorescent staining (Figure 4D and Figure S6B) demonstrated that Slfn-4 was expressed in CD11b⁺CD11c⁺ myeloid cells. Flow-cytometric cell sorting coupled with RT-qPCR revealed that these CD11c⁺ myeloid cells produced significant amounts of IL-1β and TNF-α (Figure S6 C–E). Therefore, we concluded that Slfn-4 is a Gli1 gene target expressed in a specific IL-1β- and TNF-α-expressing subset of CD11b⁺CD11c⁺ myeloid population and could be used as an additional marker to identify these cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Schlafen-4 is a Gli1-target gene that marks the CD11b⁺CD11c⁺ gastric myeloid population.

A) Microarray heat map of sham- and H. felis-infected WT and Gli1^−/− stomachs. Each column represents pooled stomach RNA samples from two mice. B) RT-qPCR analysis of Slfn-4 mRNA from sham- or 6 month H. felis-infected WT, Gli1^+/−, or Gli1^−/− stomachs. C) ChIP analysis of two Slfn-4 promoter sequences in mouse Gli1 promoter in RAW264.7 cells transfected with Gli1-FLAG-overexpressing or the empty vector plasmid. D) Immunofluorescence analysis of CD11b (green), CD11c (magenta), Slfn-4 (red) in 6-month H. felis infected WT mice. Error bars represent the mean +/− SEM. N = 5–10 mice per group. **p<0.01; *p<0.05.

https://doi.org/10.1371/journal.pone.0058935.g004

Sonic Hedgehog Remains Epithelial in the Normal and Metaplastic Stomach

Although Shh ligand is secreted acutely from parietal cells within days of Helicobacter infection [12], the cellular source of Shh ligand responsible for Hh signaling has not been examined in the chronically infected stomach once parietal cell atrophy has occurred. We previously showed using a Shh-LacZ mouse that both surface pit and mucous neck cells express Shh despite parietal cell atrophy in 2 month H. felis infected mice [8]. Therefore to identify the source of Shh ligand in the 6-month infected mice, we immunostained WT and Gli1 mutant mice with Shh antibody. Indeed, the Shh ligand was exclusively expressed by E-cadherin⁺ but not F4/80⁺ or α-SMA⁺ cells (Figure S7 A and B) and then was primarily produced by the expanded mucous neck cell population in inflamed stomachs of H. felis-infected WT mice (Figure S7 A–C). Therefore Shh ligand expression remained epithelial and was produced by the expanded mucous neck cell population in the chronically inflamed stomach despite parietal cell atrophy.

Epithelial Activation of IL-6/pSTAT3 pathway in Gastric Metaplasia

Given that IL-1β induces gastric metaplasia [5], [17] and stimulates expression of the proto-oncogene IL-6 in various cell types [22], [23], [24], [25], we hypothesized that IL-1β induces expansion of the SPEM phenotype by stimulating proliferation and IL-6 expression along with phosphorylation of STAT-3 (pSTAT-3). Surprisingly, we detected IL-6 protein expression primarily in epithelial cells, particularly in metaplastic mucous cells of the H. felis-infected WT mice (Figure S8A) and significantly lower levels of IL-6 in the mucosa of Gli1^+/− and Gli1^−/− mice (Figure S8A). Moreover, laser capture microdissection (LCM) confirmed that most of the IL-6 expression was produced by epithelial cells after 6 months of infection (Figure S8 B and C). RT-qPCR analysis confirmed the reduction of IL-6 in infected Gli1^+/− and Gli1^−/− stomach tissue compared to WT mice (Figure 5A). The expanded population of mucous cells from the infected WT stomachs also expressed higher levels of pSTAT3 than the gastric mucosa from the Gli1^+/− and Gli1^−/− (Figure 5B). Dissociated gastric cells were analyzed by flow cytometry using an epithelial (EpCAM) and mucous neck cell marker (GSII lectin) (Figure 5C). The GSII⁻ [P2] population, which excludes mucous neck cells, was IL-6 and pSTAT3 negative (Figure 5 D, Upper Panel). However, a proportion of the EpCAM⁺GSII⁺ population (epithelial mucous neck cells, [P1] ∩ [P3], Figure 5C) co-expressed IL-6 and pSTAT3 (Figure 5D, lower panel). The proportion of epithelial mucous neck cells co-expressing IL-6 and pSTAT3 was significantly lower in infected Gli1^−/− mice than WT mice (Figure 5D, lower panel). This corroborated the immunohistochemical observation that GSII⁺ mucous neck cells expressed higher levels of pSTAT-3 in 6-month infected WT than in Gli1-deficient mice (Figure 5B). Consistent with the induction of the proto-oncogene pSTAT3, mucous neck cells showed higher expression of the proliferation marker Ki67 in infected WT but not in Gli1-deficient mice (Figure S9A). To determine whether IL-1β induced IL-6 gene expression in mucous cells, we treated the NCI-N87 gastric mucous cell line with IL-1β. IL-1β induced IL-6 gene expression in these cells and the induction was inhibited by pre-incubating with the IL-1β receptor antagonist IL-1RA (Figure S9B). Therefore, we concluded that pro-inflammatory cytokines, such as IL-1β, stimulate epithelial IL-6 expression leading to increased pSTAT3 and proliferation of the mucous cell lineage.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Gli1 deletion prevents IL-6 and pSTAT3 expression in SPEM.

A) RT-qPCR analysis of IL-6 mRNA. Error bars represent the mean +/− SEM. N = 5–10 mice per group. Open and closed bars denote uninfected and infected mice respectively. B) Immunofluorescent analysis of pSTAT3 (red), GSII (green) and DAPI (blue) in stomachs of 6-month infected mice. C) Flow cytometric gating for EpCAM⁺ (epithelial cells) and GSII⁺ (mucous neck cells, SPEM) in 6-month infected WT and Gli1^−/− mice. The inset shows the rat IgG-APC isotype control for the EpCAM-APC antibody. D) IL-6 and pSTAT3 expression in GSII⁻ (non-mucous, gate P2), and EpCAM⁺GSII⁺ (mucous neck epithelial cells, gate P1 ∩ P3) in 6-month infected WT and Gli1^−/− mice. Values on flow cytometric dot blots represent the mean +/− SEM from 3 mice per group. **p<0.01; *p<0.05.

https://doi.org/10.1371/journal.pone.0058935.g005

Sonic Hedgehog Ligand is Not Sufficient to Induce Gastric Metaplasia

Although Gli1 deletion demonstrated that a component of the Hh signaling pathway is necessary for inflammation and gastric metaplasia, we examined whether ectopic expression of the Shh ligand was sufficient to induce these lesions. We expressed N-terminally HA-tagged WT (Shh^WT) and mutant (Shh^F200H) Shh cDNA (F200H) from the CMV promoter. The Shh^F200H mutant cannot be cleaved to the functional 19 kDa ShhN form (Figure S10A). As previously reported [9], WT-Shh is efficiently cleaved when expressed in NIH-3T3 cells while the F200H mutant Shh only generated the uncleaved, full-length form (Figure S10B). WT-Shh induced Gli1 and Patched-1 (Ptch1) mRNA indicating active signaling, whereas the F200H form was non-functional and did not induce these two target genes (Figure S10C and S10D). Transgenic mice overexpressing CMV-Shh^WT and CMV-Shh^F200H plasmids exhibited variable transgene expression in different founder lines (Table 1). Interestingly, the CMV promoter expressed the Shh transgene exclusively in gastric chief cells (Figure S10 E and F). Overexpression of Shh^WT induced gastritis (3/3 medium expressing mice) at medium Shh levels and gastric metaplasia only in the highest-expressing founder (Figure 6 A and B and Table 1) characterized by the co-localization of TFF-2 and intrinsic factor (Figure S11A). By contrast, none of the CMV-Shh^F200H mice developed gastritis despite high expression of the transgene in some of these mice (Figure 6A and Table 1). Overexpression of WT or the F200H Shh from the parietal cell-specific H⁺/K⁺-β-ATPase promoter produced a similar phenotype to the CMV-Shh^WT mice marked by gastritis and infrequent metaplasia (Figure S10A, Figure S11 and Table 1). Therefore, overexpression of the Shh ligand was sufficient to induce gastric inflammation, but the presence of SPEM occurred infrequently in mice correlating with high expression of the transgene. Therefore, we concluded that Shh is sufficient to induce gastritis but not SPEM, although we cannot exclude the possibility that atrophy and metaplasia develop above a certain threshold level of Shh.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Shh overexpression exacerbates Helicobacter gastritis.

A) H&E staining of NTG, CMV-Shh^WT and CMV-Shh^F200H mouse stomachs. Arrows indicate regions of inflammatory cell infiltration and mucous neck cell expansion, SPEM. B) Polymorphonuclear (PMN) cell scoring in NTG and CMV-Shh^WT mice. C) H&E staining of 6-month infected CMV-Shh^WT stomach. D) High power H&E staining of herniated epithelial glands in the gastric submucosa in 6-month infected CMV-Shh^WT stomach. A dysplastic area is indicated. E) RT-qPCR analysis of IL-1β, TNF-α and IFN-γ in 6 month-infected CMV-Shh^WT versus NTG stomachs. F) Bar graphs representing flow cytometric analysis of CD11b⁺CD11c⁺ cells in 6-month infected NTG and CMV-Shh^WT stomachs. Positive cell numbers in infected CMV-Shh^WT mice are expressed as a percentage of cells present in infected NTG controls (set to a 100%). Error bars represent the mean +/− SEM. N = 3 mice per group. **p<0.01; *p<0.05.

https://doi.org/10.1371/journal.pone.0058935.g006

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Shh overexpression exacerbates Helicobacter gastritis.

https://doi.org/10.1371/journal.pone.0058935.t001

Since the primary phenotype of the CMV-Shh^WT mice was a mild gastritis, we tested whether infecting these mice with Helicobacter affected the severity of the inflammation and subsequent development of SPEM. CMV-Shh^WT mice from founder line 314 (medium transgene expression levels) and non-transgenic littermates were infected for 6 months with H. felis. All three CMV-Shh^WT mice displayed high-grade dysplasia (Figure 6 C and D), epithelial gland herniation into the submucosa (Figure 6 C and D), and elevated Th1 cytokines compared to infected non-transgenic mice (Figure 6E). Furthermore, these mice exhibited significantly higher CD11b⁺CD11c⁺ myeloid cells compared to infected non-transgenic controls (Figure 6F). Therefore, Shh overexpression exacerbated the histologic severity observed with H. felis infection and increased the amount of myeloid cells recruited to the inflamed stomach compared to non-transgenic mice.