Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Structural Diversity of Class 1 Integrons and Their Associated Gene Cassettes in Klebsiella pneumoniae Isolates from a Hospital in China

  • Bin Li ,

    Contributed equally to this work with: Bin Li, Yongfei Hu, Qi Wang

    Affiliation CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

    ⨯
  • Yongfei Hu ,

    Contributed equally to this work with: Bin Li, Yongfei Hu, Qi Wang

    Affiliation CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

    ⨯
  • Qi Wang ,

    Contributed equally to this work with: Bin Li, Yongfei Hu, Qi Wang

    Affiliation CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

    ⨯
  • Yong Yi,

    Affiliation The 306 Hospital, Beijing, China

    ⨯
  • Patrick C. Y. Woo,

    Affiliation State Key Laboratory of Emerging Infectious Diseases, Department of Microbiology, The University of Hong Kong, Hong Kong, Special Administrative Region, China

    ⨯
  • Hua Jing,

    Affiliation The 306 Hospital, Beijing, China

    ⨯
  • Baoli Zhu,

    Affiliation CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

    ⨯
  • Cui Hua Liu

    liucuihua@im.ac.cn

    Affiliation CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

    ⨯

Abstract

Background

Klebsiella pneumoniae strains carrying class 1 integrons are becoming more common worldwide, and their role in the dissemination of drug resistance is significant. The aim of this study was to characterize the structural diversity of class 1 integrons and their associated gene cassettes in K. pneumoniae isolates from hospital settings.

Methodology/Principal Findings

We analyzed a total of 176 K. pneumoniae isolates in a tertiary-care hospital in Beijing, China for the period of November 1, 2010-October 31, 2011. The presence of class 1 integrons and gene cassettes was analyzed by PCR and sequencing. The prevalence of class 1 integrons was 51.1% (90/176). Fourteen different gene cassettes and 10 different gene cassette arrays were detected. dfrA and aadA cassettes were predominant and cassette combination dfrA1-orfC was most frequently found (13.6%, 24/176). Strong association between resistance to a variety of drugs (both phenotypes and the associated genes) and the presence of class 1 integrons was observed. In addition, we also identified an association between some previously identified prevalent sequence types (such as ST11, ST15, ST147, ST562, and ST716) and the presence of class 1 integrons.

Conclusions/Significance

Data from this study demonstrated that class 1 integrons are highly diverse and are associated with a variety of drug resistance phenotypes, drug resistance genes, as well as genotypes among K. pneumoniae isolates. Continuous monitoring of gene cassettes in class 1 integrons is warranted to improve the understanding and control of drug resistance among hospital settings.

Citation: Li B, Hu Y, Wang Q, Yi Y, Woo PCY, Jing H, et al. (2013) Structural Diversity of Class 1 Integrons and Their Associated Gene Cassettes in Klebsiella pneumoniae Isolates from a Hospital in China. PLoS ONE 8(9): e75805. https://doi.org/10.1371/journal.pone.0075805

Editor: Ulrich Nübel, Robert Koch Institut, Germany

Received: April 14, 2013; Accepted: August 20, 2013; Published: September 30, 2013

Copyright: © 2013 Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by the National Basic Research Program of China (973 Program, 2012CB518700), the key project of the Ministry of Health and the Ministry of Science and Technology, China (2013ZX10003006), the Key Program of the Chinese Academy of Sciences (KSZD-EW-Z-006 and KSCX2-EW-J-6), and the Merieux Research Grant program. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The widespread use of antibiotics coupled with the intra- and inter-species transfer of resistance determinants mediated by plasmids, transposons and gene cassettes in integrons have contributed to the rapid transmission of drug resistance in bacterial pathogens, especially among members of the Enterobacteriaceae family [1-4]. The genetic organization of integrons can be quite diverse with different combinations of gene cassettes. There are 5 different classes of integrons, each encoding a distinct integrase gene. Class 1 integrons are the most common integron type present in clinical isolates of the Enterobacteriaceae. The most frequently identified gene cassettes within class 1 integrons in Enterobacteriaceae are those encode resistance to streptomycin (aadA) and trimethoprim (dfrA) [5]. More than 130 different gene cassettes containing various resistance genes have been identified, conferring resistance to different families of antibiotics such as aminoglycosides, β-lactams, chloramphenicol, trimethoprim, erythromycin, and rifampicin [6]. Moreover, detailed information of more than 8,550 gene cassettes (up to 16 May, 2013) have been collected in a web-based database INTEGRALL, which was created to congregate information on the phylogeny of the bacterial hosts and their ecology, the molecular diversity of inserted gene cassettes and the types of integrase (http://integrall.bio.ua.pt/) [7].

K. pneumoniae is an important opportunistic pathogen that causes urinary tract and intra-abdominal infections, neonatal meningitis and pneumonia in immunocompromised patients. K. pneumoniae strains carrying complex class 1 integrons are becoming more common. The recent emergence of multidrug-resistant (MDR), extensively drug-resistant (XDR), and pandrug-resistant (PDR) K. pneumoniae isolates has become a serious problem in healthcare settings worldwide including China. A strong relationship between MDR Enterobacteriaceae strains and the presence of integrons has been proven [8]. Since class 1 integron has been identified as a primary source of antimicrobial resistance genes and suspected to serve as reservoirs and exchanging platforms of resistance genes in a variety of Gram-negative bacteria, knowledge of the epidemiology and molecular characteristics of class 1 integrons in K. pneumoniae is essential for implementing intervention strategies. Though there have been a number of reports on class 1 integrons among different Enterobacteriaceae [9-11], little is known about the structural diversity of class 1 integrons and their associated gene cassettes in K. pneumoniae isolates from hospital settings in China. In our previous study, we detected a high percentage of class 1 integrons from clinical K. pneumoniae isolates and our MLST genotyping analysis data indicated that certain drug-resistant K. pneumoniae clones are highly prevalent [12,13]. We thus conducted this study to perform more in-depth analysis of the genetic structural characteristics of class 1 integrons and their associated gene cassettes among 176 K. pneumoniae isolates from the 306 Hospital, a tertiary care hospital in Beijing, China for the period of November 1, 2010 to October 31, 2011, to better understand the evolution and dissemination of drug resistance genes in K. pneumoniae.

Methods

Ethics statement

The investigation protocols used in this study were approved by the institutional ethics committee of the 306 Hospital, Beijing, China. Written informed consent for K. pneumoniae isolates to be collected as well as for their information to be stored in the hospital database for research purposes was provided by participants. Written informed consent was obtained from the next of kin, caretakers, or guardians on the behalf of the minors/children participants involved in this study. Permission for using the information in the medical records of the patients for research purposes was obtained from the 306 Hospital. The Institute ethics committee of the 306 Hospital reviewed that relevant ethical issues in this study were considered.

Bacterial isolates

Since this is a further in-depth analyses of the genetic structural characteristics of class 1 integrons among K. pneumoniae isolates based on previous studies on the analysis of drug resistance determinants and MLST genotyping for K. pneumoniae, the isolates used in this study largely overlapped with those two previous studies [12,13]. This study included a total of 176 K. pneumoniae isolates collected from non-repetitive patients being treated in the 306 Hospital in Beijing, China for the period of November 1, 2010-October 31, 2011. Drug susceptibility testing (DST) for the K. pneumoniae strains was performed using the bioMérieux VITEK2 system following manufacturer’s instructions as described previously [12]. The ESBL production was tested by the bioMérieux VITEK-2 AST-GN13 test and the carbapenemase production was further confirmed for those carbapenemase gene positive strains by the double disk diffusion method [14]. Clinical records of patients were reviewed retrospectively. Drug resistance genes and class 1 integrons were detected by PCR and sequencing using 37 pairs of primers as described previously [12,15-37]. The detected resistance genes include: beta-lactamase genes (blaTEM-like, blaSHV-like, blaCTX-M-1-2-8-9-25-group, blaCTX-M-9, blaKPC-like, blaNDM-like, blaOXA-48-like, blaVIM-like, blaIMP-like, blaCMY-like, blaFOX-like, blaDHA-like), PMQR genes (qnrA/B/C/D/S-like, aac(6')1b-cr, qepA), aminoglycoside resistance genes (armA, rmtB, aacC1, aacC2, aacA4, aadB, aphA6), and trimethoprim resistance gene (dhfr).

Sequencing and bioinformatic analysis of class 1 integrons and gene cassettes

The gene cassettes of the class 1 integrons were amplified using specific primers for the 5´ and 3´ conserved segments (5´ CS and 3´ CS) as described previously [38]. The PCR products were sequenced and the complete sequence for each integron was obtained by using a primer walking method as described above. Resulting sequences were assembled by using SeqMan program within the Lasergene suite version 7 (DNAstar Inc, Madison, WI, USA). Potential open reading frames (ORFs) were predicted by using the NCBI (National Center for Biotechnology Information) ORF Finder tool (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) against GenBank database and The Integron Database INTEGRALL (http://integrall.bio.ua.pt/) were performed repeatedly for sequence comparison and annotation [39]. The nucleotide sequences of the integrons were deposited in the GenBank nucleotide sequence database and the accession numbers were obtained for each integron cassette array. In order to confirm whether some genes such as aac(6')-Ib-cr and aacA4 were located within class 1 integrons lacking the 3´ CS, we used the 5’ CS primer coupled to a primer specific for the aac(6')-Ib-cr gene (CCATATGGGGTGGTTACGGT) or aacA4 gene (CCATGTACACGGCTGGACC) for PCR and sequencing.

Definitions

MDR was defined as acquired non-susceptibility to at least one agent in three or more antimicrobial categories, XDR was defined as non-susceptibility to at least one agent in all but two or fewer antimicrobial categories (i.e. bacterial isolates remain susceptible to only one or two categories) and PDR was defined as non-susceptibility to all agents in all antimicrobial categories [40]. The antimicrobial groups tested in this study include: cephalosporins, aminoglycosides, aminocyclitol antibiotic, carbapenems, fluoroquinolones, folate pathway inhibitors, cephamycins, nitrofuran antibiotics, penicillins, antipseudomonal penicillins+beta-lactamase inhibitors, penicillins+beta-lactamase inhibitors, ansamycins, monobactams. The antibiotics tested include: cefazolin, ceftriaxone, ceftazidime, cefepime, gentamicin, tobramycin, amikacin, streptomycin, spectinomycin, imipenem, ertapenem, ciprofloxacin, levofloxacin, trimethoprim cefotetan, nitrofurantoin, ampicillin, piperacillin/tazobactam, ampicillin/sulbactam, rifampicin, aztreonam.

Results

Class 1 integron structures and resistance genes

Ninety of the tested 176 isolates (51.1%) yielded a PCR product of the class 1 integron gene with variable lengths. Except for 20 isolates which yielded a 126-bp PCR product containing only the 5’-CS and the 3’-CS sequences of the class 1 integron, the remaining 70 isolates contained class 1 integrons with different gene cassette arrays. One isolate contained two class 1 integrons and all the other isolates contained only one class 1 integron each. Ten different class 1 integron gene cassette arrays, for which we classified as type I–X, were identified in the class1 integron positive isolates. They include: dfrA1-orfC, dfrA1-aadA5, dfrA12-orfF-aadA2, dfrA27-aac(6’)-Ib-cr, aadA2, dfrA1-aadA1, aac(6’)-Ib-cr-aar-3, dfrA25, aadA1, ORF for hypothetical protein-mfs-1. No gene cassettes encoding ESBLs or proteins associated with resistance to carbapenems were identified. Table 1 shows an overview of various gene cassette arrays detected in the K. pneumoniae isolates. Table 1 and Figure 1 show an overview and schematic representation of various gene cassette arrays detected in the K. pneumoniae isolates.

Integron type (No. of isolates)Gene cassette arraysAmplicon size (bp)Associated resistance phenotypeAccession No.
I (24)dfrA1-orfC1171TrimethoprimJQ823008
II (12)dfrA17-aadA51602Trimethoprim, streptomycin, spectinomycinJQ823009
III (10)dfrA12-orfF-aadA21851Trimethoprim, streptomycin, spectinomycinJQ823010
IV (10)dfrA27-aac(6’)-Ib-cr a1391Trimethoprim, FluoroquinoloneJQ823011
V (4)aadA21011Streptomycin, spectinomycinJQ823012
VI (4)dfrA1-aadA11519Trimethoprim, streptomycin, spectinomycinJQ823013
VII (3)aac(6’)-Ib-cr-aar-31466Fluoroquinolone, rifampicinJQ823014
VIII (2)dfrA25719TrimethoprimJQ823015
IX (1)aadA1966Streptomycin, spectinomycinJQ823016
X (1)ORF for hypothetical protein, mfs-1 a812UnknownJQ823017

Table 1. Characteristics of class 1 integrons and their associated gene cassette arrays from 70 K. pneumoniae isolates (one of the isolates has two intergrons).

apartial gene.
CSV
Download CSV
thumbnail
Download:
Figure 1. Schematic representation of the variable regions of class 1 integrons identified in K. pneumoniae isolates.

Integron type with different cassette arrays (type I to X) are arranged as identified in Table 1. Gene cassettes are shown as boxes, with arrows indicating the orientation of transcription and hollow circles indicating the 59-base elements. The 5’- and 3’-conserved segments (5’-CS and 3’-CS) are annotated.

https://doi.org/10.1371/journal.pone.0075805.g001

Table S1 shows the resistance genes that were not located within class 1 integrons including ESBL genes, PMQR genes, as well as those encoding resistance to carbapenems, aminoglycosides, and folate pathway inhibitors. The proportion of a variety of drug resistance genes were significantly higher among class 1 integron positive isolates as compared to class 1 integron negative isolates, and they include the following ones: blaCTX-M-1, blaCTX-M-3, blaCTX-M-8, blaCTX-M-10, blaCTX-M-15, blaOXA-48, dhfr, qnrB, qnrD, qnrS, aac(6’)-Ib-cr, aacA4, aacC2, aadA1.

To investigate the distribution of the detected class 1 integrons with prevalent arrays in the genomes among diverse bacterial species of phylogenetically distant bacteria including Gram-positive and Gram-negative bacteria, we conducted BLAST search against the available databases GenBank and INTEGRALL, using strict filter parameters of more than 99% nucleotide identity and at least 80% query coverage. The results indicate that, most types of the class 1 integrons are presented in diverse bacterial species. For example, the type V integron carrying gene aadA2 was detected in 29 different species, the type III carrying dfrA12-orfF-aadA2 in 24 species, and the type I carrying dfrA1-orfC in 16 species. More detailed information on distribution of the integrons among different species is shown in Table S2. The same type IV integron carrying dfrA27 and aac(6’)-Ib-cr gene encoding resistance to trimethoprim and ciprofloxacin, respectively, has not been previously described in other bacteria. Detailed analysis of type IV integron indicates that: 1) the 3’-end and the corresponding attC site sequences of aac(6’)-Ib-cr were missing; 2) the attI site was appeared in the 5’ flanking region of aac(6’)-Ib-cr and in the middle of this integron sequence; and 3) an arr-3 cassette was probably deleted and left its attC site still before the dfrA27 gene. Compared with class I integron in E. coli strain DJ33-7 (JF806489), the type IV integron here is probably formed by a recombination event (Figure 2).

thumbnail
Download:
Figure 2. Comparison of the type IV integron in this study with its E. coli homologue in database.

Sequence of E. coli strain DJ33-7 class I integron (JF806489) was retrieved from NCBI. The type IV integron (JQ823011) is arranged as indicated in Table 1. Gene cassettes are shown as boxes, with arrows indicating the orientation of transcription. The 5’- and 3’-conserved segments (5’-CS and 3’-CS), attC, attI sites are annotated. Dashed box indicates a 590-bp deletion in the type IV integron.

https://doi.org/10.1371/journal.pone.0075805.g002

Association between drug resistance, class 1 integron presence and MLST genotype in K. pneumoniae

The 176 K. pneumoniae isolates consisted of 61.4% (108/176) multidrug-resistant strains, 21.6% (38/176) extensively drug-resistant strains and 1.7% (3/176) pandrug-resistant strains. Eighty of the 176 isolates (45.5%) were ESBL positive, and 57 isolates among the 90 isolates containing class 1 integrons were ESBL positive. The detailed information on the rates of drug resistance among the tested 176 K. pneumoniae isolates with and without class 1 integrons is shown in Table 2. Isolates positive for class 1 integrons were resistant to an average of 10.7 antibiotics, compared with 5.9 antibiotics for class 1 integron negative isolates. ESBL production and resistance to the following drugs was significantly higher among class 1 integron positive isolates than class 1 integron negative isolates: cefazolin, ceftriaxone, ceftazidime, cefepime, gentamicin, tobramycin, amikacin, streptomycin, spectinomycin, ciprofloxacin, levofloxacin, trimethoprim, piperacillin/tazobactam, ampicillin/sulbactam, and aztreonam. In contrast, resistance to cefotetan was significantly higher among class 1 integron negative isolates. The proportion of XDR isolates was significantly higher among class 1 integron positive isolates while the proportion of other types of isolates (non-MDR, non-XDR, and non-PDR isolates) were significantly higher among class 1 integron negative isolates. Furthermore, we found that the ESBL producing isolates with class 1 integrons had higher proportion of MDR (35.6% vs. 14.0%) and XDR (26.7% vs. 10.5%) isolates than those class 1 integron negative isolates.

DrugsClass 1 integron positive isolates (n=90)Class 1 integron negative isolates (n=86)P value
Susceptible,n(%)Resistant,n(%)Susceptible,n(%)Resistant,n(%)
Antimicrobial categoriesWith resistance to single drugs
Cephalosporins Cefazolin28/90 (31.1)62/90 (68.9)60/86 (69.8)26/86 (30.2)<0.001
Ceftriaxone29/90 (32.2)61/90 (67.8)61/86 (70.9)25/86 (29.1)<0.001
Ceftazidime30/90 (33.3)60/90 (66.7)59/86 (68.6)27/86 (31.4)<0.001
Cefepime29/90 (32.2)61/90 (67.8)61/86 (70.9)25/86 (29.1)<0.001
Aminoglycosides Gentamicin34/90 (37.8)56/90 (62.2)66/86 (76.7)20/86 (23.3)<0.001
Tobramycin26/90 (28.9)64/90 (71.1)63/86 (73.3)23/86 (26.7)<0.001
Amikacin59/90 (65.6)31/90 (34.4)74/86 (86.0)12/86 (14.0)0.002
Streptomycin61/90 (67.8)29/90 (32.2)86/86 (100.0)0<0.001
Aminocyclitol antibioticSpectinomycin64/90 (71.1)26/90 (28.9)86/86 (100.0)0<0.001
Carbapenems Imipenem83/90 (92.2)7/90 (0.8)84/86 (97.7)2/86 (2.3)0.101
Ertapenem82/90 (91.1)8/90 (0.9)81/86 (94.2)5/86 (5.8)0.436
Fluoroquinolones Ciprofloxacin39/90 (43.3)51/90 (56.7)66/86 (76.7)20/86 (23.3)<0.001
Levofloxacin40/90 (44.4)50/90 (55.6)67/86 (77.9)19/86 (22.1)<0.001
Folate pathway inhibitorsTrimethoprim21/90 (23.3)69/90 (76.7)60/86 (69.8)26/86 (30.2)<0.001
CephamycinsCefotetan34/90 (37.8)56/90 (62.2)20/86 (23.3)66/86 (76.7)0.037
Nitrofuran antibiotcsNitrofurantoin9/90 (10.0)81/90 (90.0)15/86 (17.4)71/86 (82.6)0.150
Penicillins Ampicillin090/90 (100.0)086/86 (100.0)ND a
Antipseudomonal penicillins+beta-lactamase inhibitors Piperacillin/Tazobactam57/90 (63.3)33/90 (36.7)78/86 (90.7)8/86 (9.3)<0.001
Penicillins+beta-lactamase inhibitors Ampicillin/Sulbactam30/90 (33.3)60/90 (66.7)60/86 (69.8)26/86 (30.2)<0.001
AnsamycinsRifampicin87/90 (96.7)3/90 (3.3)86/86 (100.0)00.088
Monobactams Aztreonam28/90 (31.1)62/90 (68.9)62/86 (72.1)24/86 (27.9)<0.001
Drug resistance types
MDR36/90 (40.0)54/90 (60.0)32/86 (37.2)54/86 (62.8)0.704
XDR62/90 (68.9)28/90 (31.3)76/86 (88.4)10/86 (11.6)0.002
PDR89/90 (98.9)1/90 (1.1)84/86 (97.7)2/86 (2.3)0.534
Other types83/90 (92.2)7/90 (7.8)66/86 (76.7)20/86 (23.3)0.004
ESBL production33/90 (36.7)57/90 (63.3)63/86 (73.3)23/86 (26.7)<0.001

Table 2. Rates of drug resistance among 176 K. pneumoniae isolates with and without class 1 integrons.

aND: No data.
CSV
Download CSV

The detailed information for the distribution of sequence types and clonal complex among class 1 integron positive and negative isolates is shown in Table S3. The proportion of the isolates belonging to the following sequence types were higher among class 1 integron positive isolates than class 1 integron negative isolates: ST11 (7.8% vs. 3.5%), ST15 (14.4% vs. 7.0%), ST147 (11.1% vs. 0), ST562 (11.1% vs. 4.7%), and ST716 (11.1% vs. 2.3%). On the contrary, the proportion of the isolates belonging to ST23 was higher among class 1 integron negative isolates than class 1 integron positive isolates (12.8% vs. 3.3%).

Discussion

The variation of the gene cassettes in class 1 integrons may reflect the horizontal transfer of integrons among members of the Enterobacteriaceae family. In this study, 10 different types of class 1 integron gene cassette arrays containing 14 gene cassettes were identified. The phenotypic resistance to a specific drug was observed in all isolates carrying the corresponding gene cassette. An integron of about 1,171bp with the dfrA1 and orfC genes (the type I), which was present in 24 K. pneumoniae isolates, was the predominant integron gene cassette array detected. Except for type IV (dfrA27-aac(6’)-Ib-cr), all the other types of the class 1 integrons have been previously described in E. coli as well as in other members of the Enterobacteriaceae family [9,10,41-43]. To the best of our knowledge, this is the first report of detection of the gene cassette array dfrA27-aac(6’)-Ib-cr in class 1 integron from clinical Enterobacteriaceae isolates worldwide, and based on the sequence analysis results, we predict that this integron type might be formed by a complex recombinant event. Though the exact mechanism is unclear, we give our suggestions that part of sequence containing gene cassettes aac(6’)-Ib-cr, arr3, and dfrA27 was probably cut from integrons similar to E. coli strain DJ33-7 class I integron, and then circled and deleted a 590bp fragment containing 3' end of aac(6')-Ib-cr and 5' end of arr3 and integrated into downstream of a integrase. Remarkably, 2 integrons with amplicons of 1171 bp (dfrA1-orfC) and 1851 bp (dfrA12-orfF-aadA2) were detected in a single isolate. This isolate was isolated from an ICU patient with coronary heart disease. The isolate was an ESBL positive MDR strain with resistance to11 drugs (including cefazolin, ceftriaxone, ceftazidime, cefepime, ciprofloxacin, levofloxacin, nitrofurantoin, ampicillin, ampicillin/sulbactam, aztreonam, and trimethoprim), thus the spread of such strains is hazardous and should be controlled.

In addition to previous reported gene cassettes (most of which are associated with drug resistance), we also identified 2 previously unreported potential gene cassettes (in class 1 integron type X, see Table 1 and Figure 1) including a gene encoding a hypothetical protein (with 41% identity with an uncharacterized amino acid transporter from an uncultured bacterium) and the mfs-1 among class 1 integron from a single isolate. mfs-1 encoding for a protein belong to the Major facilitator superfamily, which has been found to be associated with multidrug resistance among bacteria [44,45], but since the mfs-1 we detected in the class 1 integron was partial, thus it is probably non-functional in this context. This type X integron has only been found in K. pneumoniae strain NF811347 (HQ880282). We further search the clinical information for this isolate and found that it was obtained from a one-month-old newborn baby suffered from pneumonia, and this isolate was resistant only to ampicillin, further suggesting that those two gene cassettes in the class 1 integron from this isolate are not associated with drug resistance. In addition, as no known obvious attC sites of these two gene cassettes were found in this integron, the incorporation mechanism of these cassettes in unclear. The observation of identical integrons with prevalent arrays in the genomes among diverse bacteria species of phylogenetically distant bacteria strongly suggests the occurrence of intergeneric horizontal transfer of genetic cassettes. However, issues concerning horizontal transfer and dissemination of integrons between Gram-positive and Gram-negative organisms, as well as the origins of class 1 integron still remained unclear and required further investigation.

It is well established that class I integrons play a major role in the dissemination of drug resistance in clinical bacterial isolates and the use of broad-spectrum antimicrobial agents has had a profound effect on promoting this process. We observed that those class 1 integron positive isolates exhibited resistance to a much higher number of drugs as compared with those class 1 integron negative isolates. The proportion of XDR isolates was significantly higher among class 1 integron positive isolates. We also found that the proportion of a variety of drug resistance genes, including those located within and outside of class 1 integrons, was significantly higher among class 1 integron positive isolates as compared to class 1 integron negative isolates. Some genes such as aac(6')-Ib-cr and aacA4 are often described within integron gene cassettes [46,47], it is interesting to find those genes outside of class 1 integrons in our study. Since some class 1 integrons do not contain the 3'-CS, we used the 5’ CS primer coupled to a primer specific for the aac(6')-Ib-cr gene or aacA4 gene for PCR amplification in order to confirm whether aac(6')-Ib-cr and aacA4 were located within class 1 integrons lacking the 3´ CS. Indeed, we found that 7 of the 9 aac(6')-Ib-cr containing isolates and 4 of the 13 aacA4 containing isolates whose class 1 integrons were not successfully detected by 3'CS and 5'CS primers had their aac(6')-Ib-cr genes or aacA4 genes in the partial class 1 integrons lacking the 3’ CS. Nevertheless, there were still isolates having their aac(6')-Ib-cr genes (n=7) or aacA4 genes (n=4) outside of the class 1 integrons, and these results are consistent with a couple of other studies in which aac(6')-Ib-cr genes were also identified outside of the class 1 integrons [48,49]. Those findings provided further evidence of the strong association between the presence of class 1 integrons and the acquisition of drug resistance and the corresponding genes, both within and outside of the class 1 integrons, among clinical K. pneumoniae Isolates. Another explanation for this association could be co-selection processes due to spread of successful clones or clonal lineages (such as ST11 and ST258 K. pneumoniae) that were selected by antibiotic treatment in the hospital settings and that were able to accumulate various resistance genes [50,51]. In this study, we further showed that the proportion of some previously identified prevalent sequence types were higher among class 1 integron positive isolates than class 1 integron negative isolates, such as ST11, ST15, ST147, ST562, and ST716, as described previously [13]. Since the prevalent clones have a great potential of transmission among patients, the observation that those prevalent clones are significantly associated with the presence of class 1 integrons suggest that those isolates could be a dangerous reservoir for transmission of drug resistance genes, thus warrant a high degree of awareness. We also noticed that carbapenemase genes were not detected in 6 of the 13 ertapenem resistant isolates, which suggest the presence of other mechanisms responsible for resistance against carbapenems in those K. pneumoniae isolates. For example, the combination of ESBL production and porin loss in those isolates could cause the development of carbapenem resistance [52,53].

In conclusion, data from this study suggest that class I integrons are highly diverse and are associated with a variety of drug resistance phenotypes, drug resistance genes, as well as clones and clonal lineages among K. pneumoniae isolates in hospital settings in Beijing, China. Accordingly, continued surveillance of the epidemiology as well as more in-depth investigation of characteristics of those integrons and their gene cassettes are warranted to provide updated information on the current situation and molecular mechanisms of acquisition of multiple drug resistance genes among K. pneumoniae, an important reservoir for the transmission of drug resistance among Enterobacteriaceae.

Nucleotide sequence accession numbers

The nucleotide sequences of the ten types of integron gene cassette arrays reported in this study are deposited in the GenBank database under the accession numbers listed in Table 1 (JQ823008-JQ823017).

Supporting Information

Table S1.

Percentage of drug resistance genes not located within class 1 integron gene cassettes in 176 K. pneumoniae isolates.

https://doi.org/10.1371/journal.pone.0075805.s001

(DOC)

Table S2.

Distribution of the detected class 1 integrons with prevalent arrays among diverse bacterial species.

https://doi.org/10.1371/journal.pone.0075805.s002

(DOC)

Table S3.

Distribution of sequence types and clonal complex among Class 1 integron positive and negative isolates.

https://doi.org/10.1371/journal.pone.0075805.s003

(DOC)

Author Contributions

Conceived and designed the experiments: CHL. Performed the experiments: BL QW YY CHL. Analyzed the data: YFH PCYW CHL. Contributed reagents/materials/analysis tools: YY HJ BZ CHL. Wrote the manuscript: CHL.

References

  1. 1. Schmitz FJ, Martinez-Freijo P, Theis S, Fluit AC, Verhoef J et al. (1999) Class I integrons: prevalence and impact on antibiotic susceptibility in 278 consecutive unrelated Gram-negative blood isolates. Clin Microbiol Infect 5: 496–498. doi:https://doi.org/10.1111/j.1469-0691.1999.tb00179.x. PubMed: 11856293.
  2. 2. Cergole-Novella MC, Pignatari AC, Castanheira M, Guth BE (2011) Molecular typing of antimicrobial-resistant Shiga-toxin-producing Escherichia coli strains (STEC) in Brazil. Res Microbiol 162: 117–123. doi:https://doi.org/10.1016/j.resmic.2010.09.022. PubMed: 21126577.
  3. 3. Betteridge T, Partridge SR, Iredell JR, Stokes HW (2011) Genetic Context and Structural Diversity of Class 1 Integrons from Human Commensal Bacteria in a Hospital Intensive Care Unit. Antimicrob Agents Chemother 55: 3939–3943. doi:https://doi.org/10.1128/AAC.01831-10. PubMed: 21628540.
  4. 4. Díaz-Mejía JJ, Amábile-Cuevas CF, Rosas I, Souza V (2008) An analysis of the evolutionary relationships of integron integrases, with emphasis on the prevalence of class 1 integrons in Escherichia coli isolates from clinical and environmental origins. Microbiology 154: 94–102. doi:https://doi.org/10.1099/mic.0.2007/008649-0. PubMed: 18174129.
  5. 5. DeLappe N, O’Halloran F, Fanning S, Corbett-Feeney G, Cheasty T et al. (2003) Antimicrobial Resistance and Genetic Diversity of Shigella sonnei. Isolates from Western Ireland, an Area of Low Incidence of Infection. J Clin Microbiol 41: 1919–1924. doi:https://doi.org/10.1128/JCM.41.5.1919-1924.2003. PubMed: 12734227.
  6. 6. Partridge SR, Tsafnat G, Coiera E, Iredell JR (2009) Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev 33: 757-784. doi:https://doi.org/10.1111/j.1574-6976.2009.00175.x. PubMed: 19416365.
  7. 7. Moura A, Soares M, Pereira C, Leitão N, Henriques I et al. (2009) INTEGRALL: a database and search engine for integrons, integrases and gene cassettes. Bioinformatics 25: 1096–1098. doi:https://doi.org/10.1093/bioinformatics/btp105. PubMed: 19228805.
  8. 8. Leverstein-van Hall MA, M Blok HE, T Donders AR, Paauw A, et al. (2003) Multidrug Resistance among Enterobacteriaceae Is Strongly Associated with the Presence of Integrons and Is Independent of Species or Isolate Origin. J Infect Dis 187: 251–259. doi:https://doi.org/10.1086/345880. PubMed: 12552449. . doi:https://doi.org/10.1086/345880. PubMed: 12552449.
  9. 9. Ashraf MA, Tadashi S (2004) A plasmid-encoded class 1 integron carrying sat, a putative phosphoserine phosphatase gene and aadA2 from enterotoxigenic Escherichia coli O159 isolated in Japan. FEMS Microbiol Lett 235: 243–248. doi:https://doi.org/10.1111/j.1574-6968.2004.tb09595.x. PubMed: 15183870.
  10. 10. Shi L, Fujihara K, Sato T, Ito H, Garg P et al. (2006) Distribution and characterization of integrons in various serogroups of Vibrio cholerae strains isolated from diarrhoeal patients between 1992 and 2000 in Kolkata, India. J Med Microbiol 55: 575–583. doi:https://doi.org/10.1099/jmm.0.46339-0. PubMed: 16585645.
  11. 11. Ke X, Gu B, Pan S, Tong M (2011) Epidemiology and molecular mechanism of integron-mediated antibiotic resistance in Shigella. Arch Microbiol 193: 767–774. doi:https://doi.org/10.1007/s00203-011-0744-3. PubMed: 21842348.
  12. 12. Li B, Yi Y, Wang Q, Woo PC, Tan L et al. (2012) Analysis of drug resistance determinants in Klebsiella pneumoniae isolates from a tertiary-care hospital in Beijing, China. PLOS ONE 7: e42280. doi:https://doi.org/10.1371/journal.pone.0042280. PubMed: 22860106.
  13. 13. Wang Q, Li B, Tsang AK, Yi Y, Woo PCY et al. (2013) Genotypic analysis of Klebsiella pneumoniae isolates in a Beijing hospital reveals high genetic diversity and clonal population structure of drug-resistant isolates. PLOS ONE 8: e57091. doi:https://doi.org/10.1371/journal.pone.0057091. PubMed: 23437318.
  14. 14. Clinical and Laboratory Standards Institute (CLSI) (2011) Performance Standards for antimicrobial Susceptibility Testing; Twenty-first Informational Supplement. CLSI Document M100. -S21.
    • 15. Jemima SA, Verghese S (2008) Molecular characterization of nosocomial CTX-M type β-lactamase producing Enterobacteriaceae from a tertiary care hospital in south India. Indian J Med Microbiol 4: 365-368.
    • 16. Bradford PA, Bratu S, Urban C, Visalli M, Mariano N et al. (2004) Emergence of Carbapenem-Resistant Klebsiella Species Possessing the Class A Carbapenem-Hydrolyzing KPC-2 and Inhibitor-Resistant TEM-30 β-Lactamases in New York City. Clin Infect Dis 39: 55-60. doi:https://doi.org/10.1086/421495. PubMed: 15206053.
    • 17. Chmelnitsky I, Carmeli Y, Leavitt A, Schwaber MJ, Navon-Venezia S (2005) CTX-M-2 and a new CTX-M-39 enzyme are the major extended-spectrum beta-lactamases in multiple Escherichia coli clones isolated in Tel Aviv, Israel. Antimicrob Agents Chemother 49: 4745-4750. doi:https://doi.org/10.1128/AAC.49.11.4745-4750.2005. PubMed: 16251320.
    • 18. Leavitt A, Chmelnitsky I, Ofek I, Carmeli Y, Navon-Venezia S (2009) Plasmid pKpQIL encoding KPC-3 and TEM-1 confers carbapenem resistance in an extremely drug-resistant epidemic Klebsiella pneumoniae strain. J Antimicrob Chemother 65: 243-248. PubMed: 19939824.
    • 19. Kaczmarek FM, Dib-Hajj F, Shang W, Gootz TD (2006) High-Level Carbapenem Resistance in a Klebsiella pneumoniae Clinical Isolate Is Due to the Combination of blaACT-1 β-Lactamase Production, Porin OmpK35/36 Insertional Inactivation, and Down-Regulation of the Phosphate Transport Porin PhoE. Antimicrob Agents Chemother 50: 3396-3406. doi:https://doi.org/10.1128/AAC.00285-06. PubMed: 17005822.
    • 20. Robicsek A, Sahm DF, Strahilevitz J, Jacoby GA, Hooper DC (2005) Broader distribution of plasmid-mediated quinolone resistance in the United States. Antimicrob Agents Chemother 49: 3001-3003. doi:https://doi.org/10.1128/AAC.49.7.3001-3003.2005. PubMed: 15980384.
    • 21. Bauernfeind A, Stemplinger I, Jungwirth R, Ernst S, Casellas JM (1996) Sequences of beta-lactamase genes encoding CTX-M-1 (MEN-1) and CTX-M-2 and relationship of their amino acid sequences with those of other beta-lactamases. Antimicrob Agents Chemother 40: 509-513. PubMed: 8834913.
    • 22. Oliver A, Pérez-Díaz JC, Coque TM, Baquero F, Cantón R (2001) Nucleotide Sequence and Characterization of a Novel Cefotaxime-Hydrolyzing beta-Lactamase (CTX-M-10) Isolated in Spain. Antimicrob Agents Chemother 45: 616-620. doi:https://doi.org/10.1128/AAC.45.2.616-620.2001. PubMed: 11158766.
    • 23. Sabaté M, Tarragó R, Navarro F, Miró E, Vergés C et al. (2000) Cloning and sequence of the gene rncoding a novel cefotaxime-hydrolyzing β-lactamase (CTX-M-9) from Escherichia coli in Spain. Antimicrob Agents Chemother 44: 1970-1973. doi:https://doi.org/10.1128/AAC.44.7.1970-1973.2000. PubMed: 10858363.
    • 24. Schlesinger J, Navon-Venezia S, Chmelnitsky I, Hammer-Münz O, Leavitt A et al. (2005) Extended-spectrum beta-lactamases among Enterobacter isolates obtained in Tel Aviv, Israel. Antimicrob Agents Chemother 49: 1150-1156. doi:https://doi.org/10.1128/AAC.49.3.1150-1156.2005. PubMed: 15728917.
    • 25. Cavaco LM, Hasman H, Xia S, Aarestrup FM (2009) qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob Agents Chemother 53: 603-608. doi:https://doi.org/10.1128/AAC.00997-08. PubMed: 19029321.
    • 26. Kim HB, Park CH, Kim CJ, Kim EC, Jacoby GA et al. (2009) Prevalence of Plasmid-Mediated Quinolone Resistance Determinants over a 9-Year Period. Antimicrob Agents Chemother 53: 639-645. doi:https://doi.org/10.1128/AAC.01051-08. PubMed: 19064896.
    • 27. Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC (2006) Prevalence in the United States of aac(6’)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother 50: 3953-3955. doi:https://doi.org/10.1128/AAC.00915-06. PubMed: 16954321.
    • 28. Zimhony O, Chmelnitsky I, Bardenstein R, Goland S, Hammer Muntz O et al. (2006) Endocarditis caused by extended-spectrum-β-lactamase-producing Klebsiella pneumoniae: emergence of resistance to ciprofloxacin and piperacillin-tazobactam during treatment despite initial susceptibility. Antimicrob Agents Chemother 50: 3179-3182. doi:https://doi.org/10.1128/AAC.00218-06. PubMed: 16940124.
    • 29. Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM et al. (2006) Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother 50: 4114-4123. doi:https://doi.org/10.1128/AAC.00778-06. PubMed: 17000742.
    • 30. Tato M, Morosini M, García L, Albertí S, Coque MT et al. (2010) Carbapenem heteroresistance in VIM-1-producing Klebsiella pneumoniae isolates belonging to the same clone: consequences for routine susceptibility testing. J Clin Microbiol 48: 4089-4093. doi:https://doi.org/10.1128/JCM.01130-10. PubMed: 20844213.
    • 31. Nordmann P, Poirel L, Carrër A, Toleman MA, Walsh TR (2010) How To Detect NDM-1 Producers. J Clin Microbiol 49: 718-721. PubMed: 21123531.
    • 32. Weigel LM, Steward CD, Tenover FC (1998) gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae. Antimicrob Agents Chemother 42: 2661-2667. PubMed: 9756773.
    • 33. Ma L, Lin CJ, Chen JH, Fung CP, Chang FY et al. (2009) Widespread dissemination of aminoglycoside resistance genes armA and rmtB in Klebsiella pneumoniae isolates in Taiwan producing CTX-M-type extended-spectrum beta-lactamases. Antimicrob Agents Chemother 53: 104-111. doi:https://doi.org/10.1128/AAC.00852-08. PubMed: 18936188.
    • 34. Chmelnitsky I, Hermesh O, Navon-Venezia S, Strahilevitz J, Carmeli Y (2009) Detection of aac(6’)-Ib-cr in KPC-producing Klebsiella pneumoniae isolates from Tel Aviv, Israel. J Antimicro Chemother 64: 718-722. doi:https://doi.org/10.1093/jac/dkp272.
    • 35. Robicsek A, Strahilevitz J, Jacoby GA, Macielag M, Abbanat D et al. (2006) Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat Med 12: 83-88. doi:https://doi.org/10.1038/nm1347. PubMed: 16369542.
    • 36. Lee H, Yong D, Yum JH, Roh KH, Lee K et al. (2006) Dissemination of 16S rRNA methylase-mediated highly amikacin-resistant isolates of Klebsiella pneumoniae and Acinetobacter baumannii in Korea. Diagn Microbiol Infect Dis 56: 305-312. doi:https://doi.org/10.1016/j.diagmicrobio.2006.05.002. PubMed: 16822637.
    • 37. Pérez-Pérez FJ, Hanson ND (2002) Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol 40: 2153-2162. doi:https://doi.org/10.1128/JCM.40.6.2153-2162.2002. PubMed: 12037080.
    • 38. Lévesque C, Piché L, Larose C, Roy PH (1995) PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 39:185-191.
    • 39. McGinnis S, Madden TL (2004) BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res 32: W20–W25. doi:https://doi.org/10.1093/nar/gnh003. PubMed: 15215342.
    • 40. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME et al. (2012) Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18: 268–281. doi:https://doi.org/10.1111/j.1469-0691.2011.03570.x. PubMed: 21793988.
    • 41. Athanassios T, Alexandros I, Nicholas S et al. (2007) Characterization of In3Mor, a new integron carrying VIM-1metallo-b-lactamase and sat1 331 gene, from Morganella morganii. J Antimicrob Chemother 59: 739–741.
    • 42. Sun J, Zhou M, Wu Q, Ni Y et al. (2010) Characterization of two novel gene cassettes, dfrA27 and aadA16, in a non-O1, non-O139 Vibrio cholerae isolate from China. Clin Microbiol Infect 16: 1125–1129. PubMed: 19906273.
    • 43. Yvonne A, Gisele P, Frank MA (2006) dfrA25, a novel trimethoprim resistance gene from Salmonella Agona isolated from a human urine sample in Brazil. J Antimicrob Chemother 58: 1044–1047. doi:https://doi.org/10.1093/jac/dkl366. PubMed: 16980698.
    • 44. Marcus M, Sarah S, Mohamed AM (2008) The Major Facilitator Superfamily-Type Transporter YmfE and the Multidrug-Efflux Activator Mta Mediate Bacillibactin Secretion in Bacillus subtilis. J Bacterial 190: 5143–5152. doi:https://doi.org/10.1128/JB.00464-08.
    • 45. James JV, Blair AJ, Jason KS (2009) Two Distinct Major Facilitator Superfamily Drug Efflux Pumps Mediate Chloramphenicol Resistance in Streptomyces coelicolor. Antimicrob Agents Chemother 53: 4673–4677. doi:https://doi.org/10.1128/AAC.00853-09. PubMed: 19687245.
    • 46. Chang CY, Fang YT, Tsai SM, Chang LL, Yu WL (2009) Characterization of class 1 integrons and gene cassettes in clinical isolates of Klebsiella pneumoniae from Taiwan. Diagn Microbiol Infect Dis 65: 214-216. doi:https://doi.org/10.1016/j.diagmicrobio.2009.06.005. PubMed: 19748438.
    • 47. Quiroga MP, Andres P, Petroni A, Soler Bistué AJ, Guerriero L et al. (2007) Complex class 1 integrons with diverse variable regions, including aac(6’)-Ib-cr, and a novel allele, qnrB10, associated with ISCR1 in clinical enterobacterial isolates from Argentina. J Infect 51: 4466-4470. PubMed: 17938184.
    • 48. Fihman V, Lartigue MF, Jacquier H, Meunier F, Schnepf N et al. (2008) Appearance of aac(6’)-Ib-cr gene among extended-spectrum beta-lactamase-producing Enterobacteriaceae in a French hospital. J Infect 56: 454-459. doi:https://doi.org/10.1016/j.jinf.2008.03.010. PubMed: 18440645.
    • 49. Ruiz E, Rojo-Bezares B, Sáenz Y, Olarte I, Esteban I et al. (2010) Outbreak caused by a multi-resistant Klebsiella pneumoniae strain of new sequence type ST341 carrying new genetic environments of aac(6’)-Ib-cr and qnrS1 genes in a neonatal intensive care unit in Spain. Int J Med Microbiol 300: 464-469. doi:https://doi.org/10.1016/j.ijmm.2010.04.014. PubMed: 20547103.
    • 50. Andrade LN, Curiao T, Ferreira JC, Longo JM, Clímaco EC et al. (2011) Dissemination of blaKPC-2 by the spread of Klebsiella pneumoniae clonal complex 258 clones (ST258, ST11, ST437) and plasmids (IncFII, IncN, IncL/M) among Enterobacteriaceae species in Brazil. Antimicrob Agents Chemother 55: 3579-3583. doi:https://doi.org/10.1128/AAC.01783-10. PubMed: 21576442.
    • 51. Yang J, Ye L, Guo L, Zhao Q, Chen R et al. (2013) A nosocomial outbreak of KPC-2-producing Klebsiella pneumoniae in a Chinese hospital: dissemination of ST11 and emergence of ST37, ST392 and ST395. Clin Microbiol Infect. doi:https://doi.org/10.1111/1469-0691.12275. [Epub ahead of print].
    • 52. Yang D, Guo Y, Zhang Z (2009) Combined porin loss and extended spectrum beta-lactamase production is associated with an increasing imipenem minimal inhibitory concentration in clinical Klebsiella pneumoniae strains. Curr Microbiol 58: 366-370. doi:https://doi.org/10.1007/s00284-009-9364-4. PubMed: 19219497.
    • 53. Tängdén T, Adler M, Cars O, Sandegren L, Löwdin E (2013) Frequent emergence of porin-deficient subpopulations with reduced carbapenem susceptibility in ESBL-producing Escherichia coli during exposure to ertapenem in an in vitro pharmacokinetic model. J Antimicrob Chemother 68: 1319-1326. doi:https://doi.org/10.1093/jac/dkt044. PubMed: 23478794.