Abstract

INTRODUCTION:

The behavior of methicillin-resistant Staphylococcus aureus (MRSA) isolated from central venous catheter-related infection was evaluated to determine its biofilm potential, antimicrobial resistance, and adhesion genes.

METHODS:

A total of 1,156 central venous catheters (CVC) were evaluated to screen for pathogens. Antimicrobial sensitivity, biofilm formation potential, and molecular analysis of MRSA were examined following standard guidelines.

RESULTS:

Of the 1,156 samples, 882 (76%) were colonized by bacteria or candida. Among the infected patients, 69% were male and 36% were female with median age of 32 years. Staphylococcus aureus infected 39% (344/882) of CVCs in patients. Of the 59% (208/344) of patients with MRSA, 57% had community acquired MRSA and 43% had hospital acquired MRSA. Linezolid and vancomycin killed 100% of MRSA; resistance levels to fusidic acid, doxycycline, clindamycin, azithromycin, amikacin, trimethoprim-sulfamethoxazole, gentamycin, tobramycin, and ofloxacin were 21%, 42%, 66%, 68%, 72%, 85%, 95%, 97%, and 98% respectively. Strong biofilm was produced by 23% of samples, moderate by 27%, and weak by 50% of MRSA. The presence of adhesion genes, sdrC and sdrD (90%), eno (87%), fnbA (80%), clfA and sdrE (67%), fnbB, sdrD (61%), and cna (51%), in most MRSA samples suggested that the adhesion genes are associated with biofilm synthesis.

CONCLUSIONS:

The superbug MRSA is a major cause of CVC-related infection. Antibiotic resistance to major classes of antibiotics and biofilm formation potential enhanced superbug MRSA virulence, leading to complicated infection. MRSA causes infection in hospitals, communities, and livestock.

Keywords:
Community acquired MRSA; Hospital acquired MRSA; Central venous cateter; Antimicrobial resistance; Biofilm and adhesion genes

INTRODUCTION

Drug resistance bacteria kill 700,000 people per year and this value is expected to reach 1 million in 2050¹1. Meera Senthilingam, StC. Protecting the world from deadly superbugs. 2018; Available from: http://www.cnn.com/2016/05/23/health/stopping-superbugs/index.html.
http://www.cnn.com/2016/05/23/health/sto... . Central venous catheters (CVCs) are indispensable in modern medicine practices, particularly in intensive care unit (ICU) patients. CVCs facilitate health management of critical patients who requires intermittent medication, fluids, and food²2. Tejedor SC, Tong D, Stein J, Payne C, Dressler D, Xue W, et al. Temporary central venous catheter utilization patterns in a large tertiary care center tracking the “idle central venous catheter”. Infect Control Hosp Epidemiol. 2012;33(1)50-7.. CVC indwelling patients are at a high risk of mortality and morbidity along with other complications such as bloodstream infection and cardiac arrhythmia. Approximately 78% of critically ill patients require some type of CVC and 90% of catheter-related blood stream infections are -CVC related³3. Mermel LA. Prevention of intravascular catheter-related infections. Ann intern med. 2000;132(5)391-402.. Two-thirds of these infections are caused by Gram-positive bacteria, predominantly Gram-positive cocci which are equally responsible for infections in ICU and non-ICU patients⁴4. Eggimann P, Pittet D. Overview of catheter‐related infections with special emphasis on prevention based on educational programs. Clin Microbiol Infect. 2002;8(5)295-309.. CVCs are colonized by microorganisms including Staphylococcus aureus, which is the most common cause of CVC infections⁵5. Raad I. Intravascular-catheter-related infections. The Lancet. 1998;351(9106)893-8.

6. Elliott TS, Moss HA, Tebbs SE, Wilson IC, Bonser RS, Graham TR, et al. Novel approach to investigate a source of microbial contamination of central venous catheters. Eur J Clin Microbiol Infect Dis. 1997;16(3)210-3.^-77. Raad II, Sabbagh MF, Rand KH, Sherertz RJ. Quantitative tip culture methods and the diagnosis of central venous catheter-related infections. Diagn microbiol infect dis. 1992;15(1)13-20.. Staphylococcus aureus is responsible for septic shock in 30% of CVC-associated septicemia cases⁸8. Bock SN, Lee RE, Fisher B, Rubin JT, Schwartzentruber DJ, Wei JP, et al. A prospective randomized trial evaluating prophylactic antibiotics to prevent triple-lumen catheter-related sepsis in patients treated with immunotherapy. J Clin Oncol. 1990;8(1)161-9.. Both types of MRSA, community acquired (CA-MRSA) and hospital acquired (HA-MRSA), infect hospitalized and non-hospitalized individuals⁹9. Centers for Disease Control and Prevention. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus -Minnesota and North Dakota, 1997-1999. MMWR. Morb Mortal Wkly Rep. 1999;48(32)707-10.^,1010. Chambers HF. The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis. 2001;7(2)178-82.. Resistance to a large range of antibiotics complicates MRSA infection and increase the potential for biofilm formation on biotic and abiotic surfaces. Biofilms are complex heterogeneous structures with fluid-filled tunnels¹¹11. Arciola CR, Campoccia D, Baldassarri L, Donati ME, Pirini V, Gamberini S, et al. Detection of biofilm formation in Staphylococcus epidermidis from implant infections. Comparison of a PCR‐method that recognizes the presence of ica genes with two classic phenotypic methods. J Biomed Mat Res. 2006;76(2)425-30.. Interestingly, 60% of catheter-related infections are caused by biofilm-producing bacteria¹²12. Cooper IR. Microbial biofilms: case reviews of bacterial and fungal pathogens persisting on biomaterials and environmental substrata. In: Mendez-Vilas A, editor. Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology. Badajoz, Spain: Formatex Research Centre; 2011. p. 807-17.. Microbial surface components recognizing adhesive matrix molecules of MRSA mediate attachment to host molecules and are potentially involved in biofilm formation¹³13. Atshan SS, Nor Shamsudin MN, Sekawi Z, Lung Than LT, Hamat RA, Karunanidhi A, et al. Prevalence of adhesion and regulation of biofilm-related genes in different clones of Staphylococcus aureus. BioMed Res Int. 2012;2012:1-10. Article ID 976972.^,1414. O'Neill E, Pozzi C, Houston P, Humphreys H, Robinson DA, Loughman A, et al. A novel Staphylococcus aureus biofilm phenotype mediated by the fibronectin-binding proteins, FnBPA and FnBPB. J Bacteriol. 2008;190(11)3835-50.. Microbial surface components recognizing adhesive matrix molecules include fibronectin-binding proteins (fnbA and fnbB), clumping factors (clfA and clfB), collagen-binding protein (cna), fibrinogen-binding protein (fib), laminin-binding protein (eno), and three Sdr proteins (sdrC, sdrD, and sdrE)¹³13. Atshan SS, Nor Shamsudin MN, Sekawi Z, Lung Than LT, Hamat RA, Karunanidhi A, et al. Prevalence of adhesion and regulation of biofilm-related genes in different clones of Staphylococcus aureus. BioMed Res Int. 2012;2012:1-10. Article ID 976972.^,1515. Sitkiewicz I, Babiak I, Hryniewicz W. Characterization of transcription within sdr region of Staphylococcus aureus. Antonie Van Leeuwenhoek. 2011;99(2)409-16.. Staphylococcus aureus is found in 30% of healthy people, who are healthy carriers of infection¹⁶16. Ma Y, Xu Y, Yestrepsky BD, Sorenson RJ, Chen M, Larsen SD, et al. Novel inhibitors of Staphylococcus aureus virulence gene expression and biofilm formation. PLoS One. 2012;7(10)e47255.. Staphylococcus aureus harbors a variety of pathogenic tools, enzymes, and toxins that cause minor to life-threatening infections¹⁷17. Gordon RJ, Lowy FD. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis. 2008;46(Suppl_5):S350-S9.. This bacterium is a causative agent of infections on biomedical device- and surgical tube-related infections, which greatly increase mortality, mortality, costs of treatment, and hospital stays. Conventional antibiotics are not effective against biofilm, worsening the situation¹⁸18. Davies D. Understanding biofilm resistance to antibacterial agents. Nat revi Drug discov. 2003;2(2)114-22.. Pathogenic tools, rapidly acquired resistance, and rapid mutation development are leading causes of methicillin-resistant Staphylococcus aureus (MRSA) as epidemic infectious agents¹⁹19. Chambers HF, Deleo. Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol. 2009;7(9)629-41.^,2020. Grundmann H, Aires-de-Sousa M, Boyce J, Tiemersma E. Emergence and resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat. The Lancet . 2006;368(9538)874-85..

The goal of this study was to isolate and identify the pathogens causing CVC-related infections and determine the antibiogram, biofilm potential, and adhesion genes in superbug MRSA.

METHODS

This study was conducted using 1,156 CVC samples collected from April 2012 to April 2016. The specimens studied were CVC tips, femoral, Jugular, and subclavian catheters. CVC specimens were processed as described by Maki et. al.²¹21. Maki DG, Weise CE, Sarafin HW. A semiquantitative culture method for identifying intravenous-catheter-related infection. New Engl J Med. 1977;296(23)1305-9. with slight modifications²¹21. Maki DG, Weise CE, Sarafin HW. A semiquantitative culture method for identifying intravenous-catheter-related infection. New Engl J Med. 1977;296(23)1305-9.. Briefly, catheter tips were cut into two pieces 5cm in length; one piece was directly rolled on culture plates and the other was incubated for 1h in a tube containing 1mL brain heart infusion [(BHI); Oxoid, Cheshire, UK]. Next, the samples were centrifuged and the pellet containing pathogens was inoculated on Sheep Blood Agar [(SBA); Oxoid], Chocolate [(CHO); Oxoid] agar, Sabouraud dextrose agar [(SDA); Oxoid], and MacConkey [(MAC; Oxoid] agar. All plates were examined after 24-h incubation at 37°C and further incubated for 48 and 72h if no growth was evident. The acceptable cut-off to declare CVC-related infection was 15 colony-forming units per milliliter (cfu/mL) after overnight incubation²²22. Bouza E, Alvarado N, Alcalá L, Sánchez-Conde M, Pérez MJ, Muñoz P, et al. A prospective, randomized, and comparative study of 3 different methods for the diagnosis of intravascular catheter colonization. Clin Infect Dis . 2005;40(8)1096-100.. After preliminary identification of pathogens, Staphylococcus aureus was confirmed based on a high salt concentration, deoxyribonuclease (DNase) production, and mannitol fermentation. The same bacteria isolated from both techniques (direct and enrichment) were considered as pathogenic and further analyzed.

Antimicrobial sensitivity test

The Kirby-Bauer disk diffusion method was used for the antibiogram of S. aureus against eight classes of antibiotics following the performance guidelines and breakpoints recommended by Clinical and Laboratory Standards Institute (CLSI)²³23. Clinical and Laboratory Standards Institute (CLSI), M100-S26. Performance Standards for Antimicrobial Susceptibility Testing: 26th Informational Supplement. Wayne, PA: CLSI; 2015. 256p.. Staphylococcus aureus (ATCC 29213) was used as a control strain for antibiogram. Based on cefoxitin (30µg) resistance (zone of inhibition ≤21nm), S. aureus was declared as MRSA and confirmed by amplification of mec²³23. Clinical and Laboratory Standards Institute (CLSI), M100-S26. Performance Standards for Antimicrobial Susceptibility Testing: 26th Informational Supplement. Wayne, PA: CLSI; 2015. 256p.. The minimum inhibitory concentration of vancomycin was measured by the E-test (bioMérieux, Marcy-l’Étoile, France) following CLSI guidelines.

Slime production

Congo red agar was used to evaluate the slime production capability of MRSA isolated form CVC-related infections²⁴24. Mariana N, Salman S, Neela V, Zamberi S. Evaluation of modified Congo red agar for detection of biofilm produced by clinical isolates of methicillinresistance Staphylococcus aureus. Afr J Microbiol Res. 2009;3(6)330-38.. Red colonies were categorized as non-slime producers and black colonies as slime producers. The intensity of the black color was directly related to the slime production capability.

Quantitative biofilm formation on polystyrene

Biofilm formation was measured quantitatively by the crystal violet assay as described by O’Toole with some modifications²⁵25. O'Toole GA. Microtiter dish biofilm formation assay. J Vis Exp. 2011(47):pii. 2437.. Briefly, a fresh bacterial culture was diluted by 200-fold in BHI containing 1% glucose and then inoculated into a 96-well polystyrene plate. The plate was incubated aerobically at 37°C for 48h without agitation with a positive (S. aureus ATCC 35556) and negative (Staphylococcus epidermidis ATCC 12228) control strain. Plates were washed three times with phosphate-buffered saline, dried at room temperature, and stained with 0.1% (w/v) crystal violet (CV) for 10 min. After washing three times with phosphate-buffered saline, CV was solubilized by 95% ethanol for 10 min and the optical density (OD) was measured at 595nm. The biofilm formation index (BFI) was measured using the following equation²⁶26. Teh KH, Flint S, French N. Biofilm formation by Campylobacter jejuni in controlled mixed-microbial populations. Int J Food Microbiol. 2010;143(3)118-24.: BFI = (AB-CW)/G.

The OD of CV-stained attached bacteria was denoted as AB. CW represents the OD of the CV-stained negative control containing only broth medium. G denotes the OD of planktonic bacteria. Based on the ODs values, microorganisms were classified as weak (0.1> BFI ≤ 0.5), moderate (0.5> BFI ≤ 1), and strong (BFI > 1) biofilm producers. MRSA with an OD of less than 0.1 were classified as non-biofilm producers²⁷27. Martinez-Medina M, Naves P, Blanco J, Aldeguer X, Blanco JE, Blanco, et al. Biofilm formation as a novel phenotypic feature of adherent-invasive Escherichia coli (AIEC). BMC Microbiol. 2009;9(1)202..

Extraction of genomic DNA

Genomic deoxyribonucleic acid (DNA) was extracted using a conventional method²⁸28. Wilson K. Preparation of genomic DNA from bacteria. Curr Protoc Mol Biol. 2001;Chapter 2:Unit 2.4. doi: 10.1002/0471142727.mb0204s56.
https://doi.org/10.1002/0471142727.mb020... . Bacteria were grown overnight in BHI at 37°C in a shaking incubator and harvested by centrifugation. The pellet was incubated at 37°C for 1h in 10mM Tris-HCL and 34.5mg/mL lysozyme (Sigma, St. Louis, MO, USA). Lysis was conducted by incubation in lysis buffer containing 50mM Tris, 100mM ethylenediaminetetraacetic acid (EDTA), 1% SDS, 20µL proteinase k (Sigma), and lysostaphin (Sigma) at 55°C for 1h. DNA was eluted in DNase-free water after extraction and ethanol precipitation. The concentration was measured with a NanoDrop™ (Thermo Scientific, Waltham, MA, USA) and stored at 4°C until further investigation.

Prevalence of adhesion genes of MRSA

A total of 203 MRSA isolates were screened for 10 different adhesion genes (clfA, clfB, eno, cna, fnbA, fnbB, fib, sdrC, sdrD, sdrE), mec, and Panton-Valentine leucocidin. The following primers were used in this study: MecA-R (ATGCGCTATAGATTGAAAGGAT) and MecA-F (GTGAAGATATACCAAGTGATT) 310 base pairs (bp)²⁹29. McClure J-A, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococci. J clin microbiol. 2006;44(3)1141-44.; Luk-PV2 (GCATCAAGTGTATTGGATAGCAAAAGC) and Luk-PV1 (ATCATTAGGTAAAATGTCTGGACATGATCCA) 433bp²⁹29. McClure J-A, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococci. J clin microbiol. 2006;44(3)1141-44.; FnbA-R (TGTGCTTGACCATGCTCTTC) and FnbA-F (GATACAAACCCAGGTGGTGG) 191bp³⁰30. Arciola CR, Campoccia D, Gamberini S, Baldassarri L, Montanaro L. Prevalence of cna, fnbA and fnbB adhesin genes among Staphylococcus aureus isolates from orthopedic infections associated to different types of implant. FEMS Microbiol. Lett. 2005;246(1)81-6.; FnbB-R (CAAGTTCGATAGGAGTACTATGTTC) and FnbB-F (GTAACAGCTAATGGTCGAATTGATAC) 524bp; Cna-R (AATCAGTAATTGCACTTTGTCCACTG) and Cna-F (GTCAAGCAGTTATTAACACCAGAC) 423bp³¹31. Tristan A, Ying L, Bes M, Etienne J, Vandenesch F, Lina G. Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections. J Clin Microbiol. 2003;41(9)4465-7.; clfA-R (AGGCACTGAAAAACCATAATTCA) and clfA-F (TTACGAATCAGTTGACGAATGTG) 104bp³²32. Le Maréchal C, Seyffert N, Jardin J, Hernandez D, Jan G, Rault L, et al. Molecular basis of virulence in Staphylococcus aureus mastitis. PLoS One . 2011;6(11)e27354.; clfB-R (CCGTCGGTTGAGGTGTTTCATTTG) and clfB-F (TGCAAGTGCAGATTCCGAAAAAAAC) 194bp³³33. Klein RC, Fabres-Klein MH, Brito MAVP, Fietto LG, Ribon AOB. Staphylococcus aureus of bovine origin: genetic diversity, prevalence and the expression of adhesin-encoding genes. Vet Microbiol. 2012;160(1-2)183-8.; eno-R (CAACAGCATCTTCAGTACCTTC) and eno-F (ACGTGCAGCAGCTGACT) 302bp³⁴34. Vancraeynest D, Hermans K, Haesebrouck F. Genotypic and phenotypic screening of high and low virulence Staphylococcus aureus isolates from rabbits for biofilm formation and MSCRAMMs. Vet.Microbiol. 2004;103(3)241-7.; fib-R (GCTCTTGTAAGACCATTTTCTTCAC) and fib-F (CTACAACTACAATTGCGTCAACAG) 404bp³⁴34. Vancraeynest D, Hermans K, Haesebrouck F. Genotypic and phenotypic screening of high and low virulence Staphylococcus aureus isolates from rabbits for biofilm formation and MSCRAMMs. Vet.Microbiol. 2004;103(3)241-7.; SdrC-R (ACGACTATTAAACCAAGAAC) and SdrC-F (TTCGCACTGTTTGTGTTTGCAC) 560bp³⁵35. Peacock SJ, Moore CE, Justice A, Kantzanou M, Story L, Mackie K, et al. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun. 2002;70(9)4987-96.; SdrD-R (GGAAATAAAGTTGAAGTTTC) and SdrD-F (GTACTTGAAATAAGCGGTTG) 500bp³⁵35. Peacock SJ, Moore CE, Justice A, Kantzanou M, Story L, Mackie K, et al. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun. 2002;70(9)4987-96.; SdrE-R (CAGTAAATGTGTCAAAAGA) and SdrE-F (ACTTTGTCATCAACTGTAAT) 767bp³⁵35. Peacock SJ, Moore CE, Justice A, Kantzanou M, Story L, Mackie K, et al. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun. 2002;70(9)4987-96..

RESULTS

Among the 1,156 CVC samples, 882 (76%) were colonized with pathogens, while 274 (24%) CVC tips were negative for pathogens. The results of both inoculation techniques were compared for pathogen confirmation. Same microorganisms isolated from both techniques were considered as pathogens.

Prevalence of MRSA among CVC-related infections

Of the 882 CVCs colonized with pathogens, 64% (564/882) were due to Gram-positive bacteria, 26% (230/882) by Gram-negative bacteria, and 10% (88/882) by Candida. Among Gram-positive bacteria, S. aureus (39%) and coagulase-negative S. aureus (16%) were dominant. Among Gram-negative bacteria, Klebsiella pneumoniae (10%) and Pseudomonas aeruginosa (7%) were the most common. Of S. aureus, 59% (203/344) were MRSA. Among the 203 patients infected by MRSA, 129 (64%) were male and 74 (36%) were female with a combined mean age of 32 ± 3 years. Of MRSA isolated from CVC, 57% (116/203) were CA-MRSA and 43% (87/203) were HA-MRSA (Figure 1), which were categorized based on CDC criteria (CA-MRSA harbors pcv and SCCmec IV/V)³⁶36. David MZ, Daum RS. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev. 2010;23(3)616-87.. The prevalence of MRSA over 4 years is shown in Table 1 with respect to age and gender. The age group 20-29 years was most commonly infected with MRSA, followed by the age groups of 40-49 and 30-39 years with infection rates of 63%, 30%, and 28%, respectively.

Antimicrobial sensitivity testing and biofilm production by MRSA

Antimicrobial sensitivity testing results are shown in Figure 2 for CA-MRSA and HA-MRSA. Briefly, 72% (146/203) of MRSA samples were resistant to amikacin, 94% (192/203) to gentamicin, 97% (197/203) to tobramycin, 68% (138/203) to azithromycin, 42% (85/203) to doxycycline, 98% (199/203) to ciprofloxacin and ofloxacin, 85% (172/203) to trimethoprim-sulfamethoxazole (SXT), 66% (134/203) to clindamycin, and 21% (43/203) to fusidic acid. No isolates showed resistance to linezolid and vancomycin.

All MRSA isolated from CVC were biofilm producers. Half of MRSA (50%) were weak biofilm producers followed by moderate (27%) and strong biofilm (23%) producers.

Prevalence of adhesion genes of MRSA

Ten adhesion genes were amplified using specific terminal sequences. The amplification results showed that clfB was present in all isolates of MRSA, followed by sdrC and sdrD (90%), eno (87%), fnbA (80%), clfA and sdrE (67%), fnbB and sdrD (61%), and cna (51%). For moderate and weak biofilm producers, no significant (p > 0.05) differences were found among different types of MRSA (CA-MRSA, HA-MRSA) and the presence of adhesion genes (Table 2). However, for strong biofilm, there was a significant (p < 0.05) difference between the types of MRSA (CA-MRSA and HA-MRSA) because of the presence of adhesion genes.

Statistical analysis

All tests were performed in duplicate with a confidence level of 95% and significance level of <0.05. Statistical Package for the Social Sciences (SPSS) software (SPSS, Inc., Chicago, IL, USA) was used for data analysis with the Chi-square test.

DISCUSSION

Antimicrobial resistance is a major threat to people and worsens when lifesaving devices become contaminated. CVC is essential for critically ill patients but leads to life-threatening consequences when inserted in the central venous system³⁷37. Smuszkiewicz P, Trojanowska I, Tomczak H. Venous catheter microbiological monitoring. Necessity or a habit. Med Sci Monit. 2009;15(2)SC5-SC8. and become colonized by multidrug-resistant superbugs such as MRSA.

This study evaluated CVC-related infections on different types of catheters and hospital units and directly involving CVC rather than blood culture. This study revealed that age, gender, and sex were not significant predictors of CVC-related infections. Interestingly, Gram-negative bacteria outnumbered S. aureus in causing CVC infection.

This study revealed that 76% of CVCs were infected by bacteria (63% by Gram-positive) or candida; a similar study conducted in Italy showed that 73% of all CVCs from ICU patients were infected and 54% were due to Gram-positive bacteria³⁸38. Lombardi S, Scutell M, Felice V, Di Campli E, Di Giulio M, Cellini L. Central vascular catheter infections in a Hospital of Central Italy. New Microbiol. 2014;37(1):41-50..

Staphylococcus aureus is the major pathogen causing CVC infections (39%), followed by CONS (16%) and K. pneumoniae (10%). These results agree with those of previous studies³⁹39. Gupta S, Mallya SP, Bhat A, Baliga S. Microbiology of Non-Tunnelled Catheter-Related Infections. J Clin Diagn Res. 2016;10(7)DC24- DC28.^,4040. Al-Tawi ES, Almuhareb AM, Amin HM.. Catheter-related blood stream infection in patients receiving long-term home parenteral nutrition: Tertiary care hospital experience in Saudi Arabia. Saudi. journal of gastroenterology: J Saudi Gastroenterol. 2016;22(4)304-8.. Most studies demonstrated that Gram-negative bacteria are the major cause of catheter-related blood stream infection, but these studies used blood samples to detect infection. A surveillance study in Australia revealed that Enterococci species is a major pathogen (26%) of central line catheter-related infection⁴¹41. Worth LJ, Spelman T, Bull JA, Brett JA, Richards MJ. Central line-associated bloodstream infections in Australian intensive care units: Time-trends in infection rates, etiology, and antimicrobial resistance using a comprehensive Victorian surveillance program, 2009-2013. Am J Infect Control. 2015;43(8)848-52.. The prevalence of MRSA (59%; 203/344) among CVC-related infections agreed with the results of previous similar studies⁴²42. Truong J, Veillette JJ, Forland SC. Outcomes of vancomycin plus a β-lactam versus vancomycin only for the treatment of methicillin-resistant Staphylococcus aureus bacteremia. Antimicrob Agents Chemo. 2018;62(2):pii:e01554-17.^,4343. Esposito S, Purrello SM, Bonnet E, Novelli A, Tripodi F, Pascale R, et al. Central venous catheter-related biofilm infections: An up-to-date focus on meticillin-resistant Staphylococcus aureus. J Glob Antimicrob Resist. 2013;1(2)71-8.. In India, P. aeruginosa was found to be the most common cause (42%) of CVC infection, which contradicted our study because the previous study was conducted in only cancer patients⁴⁴44. Jain SA, Shukla SN, Talati SS, Parikh SK, Bhatt SJ, Maka V. A retrospective study of central venous catheters GCRI experience. Indian journal of medical and paediatric oncology. Indian J Med Paediatr Oncol. 2013;34(4)238-41..

Our study revealed that 57% of MRSA infections were due to HA-MRSA, which disagreed with the results of a single-center study conducted in France in 2012 which showed that 34% of CVC-related infections were caused by HA-MRSA⁴⁵45. Bonnal C, Birgand G, Lolom I, Diamantis S, Dumortier C, L’Heriteau F, et al. Staphylococcus aureus healthcare associated bacteraemia: An indicator of catheter related infections. Med Mal Infect. 2015;45(3)84-8.. CA-MRSA is also emerging as a notorious pathogen in CVC-related infections, particularly in children⁴⁵45. Bonnal C, Birgand G, Lolom I, Diamantis S, Dumortier C, L’Heriteau F, et al. Staphylococcus aureus healthcare associated bacteraemia: An indicator of catheter related infections. Med Mal Infect. 2015;45(3)84-8..

Biofilm producers are more resistant to antibiotics than their counterparts⁴⁶46. Costerton JW, Stewart EP, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science. 1999;284(5418)1318-22.. All isolates were sensitive to vancomycin and linezolid, which agrees with previous studies⁴⁷47. Kumari VH, Babu AR, Srinivas D, Siddaiah N, Somanna S. Methicillin-resistant Staphylococcus aureus central nervous system infections-analysis and outcome. Br J Neurosurg. 2015;29(3)413-8.. Among MRSA cases, 85% were resistant to SXT, which agrees with the literature⁴⁷47. Kumari VH, Babu AR, Srinivas D, Siddaiah N, Somanna S. Methicillin-resistant Staphylococcus aureus central nervous system infections-analysis and outcome. Br J Neurosurg. 2015;29(3)413-8.. Among macrolides, erythromycin resistance was observed in 96% of cases and ciprofloxacin resistance in 98% of MRSA isolates, which agrees with studies conducted in Japan⁴⁸48. Inomata S, Yano H, Tokuda K, Kanamori H, Endo S, Ishizawa C, et al. Microbiological and molecular epidemiological analyses of community-associated methicillin-resistant Staphylococcus aureus at a tertiary care hospital in Japan. J Infect Chemother. 2015;21(10)729-36.^,4949. de la Gandara MP, Curry M, Berger J, Burstein D, Della-Latta P, Kopetz V, et al. MRSA causing infections in hospitals in Greater Metropolitan New York: Major shift in the dominant clonal type between 1996 and 2014. PLoS One . 2016;11(6)e0156924.. The same studies showed different resistance to SXT (2%) and clindamycin (90%) because of the use of antibiotics in different settings⁵⁰50. Park SH, Kim JK, Park K. In vitro antimicrobial activities of fusidic acid and retapamulin against mupirocin-and methicillin-resistant Staphylococcus aureus. Ann Dermatol. 2015;27(5)551-56.^,5151. Souli M, Karaiskos I, Galani L, Maraki S, Perivolioti E, Argyropoulou A, et al. Nationwide surveillance of resistance rates of Staphylococcus aureus clinical isolates from Greek hospitals, 2012-2013. Infect Dis. 2016;48(4)287-92.. Variable resistance to fusidic acid was reported previously, and some reports showed the same resistance found in this study⁵²52. McLaws F, Larsen A, Skov R, Chopra I, O'Neill A. Distribution of fusidic acid resistance determinants in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemo ther. 2011;55(3)1173-6.. Similar fusidic acid resistance results were reported by Decousser⁵³53. Decousser JW, Desroches M, Bourgeois-Nicolaos N, Potier J, Jehl F, Lina G, et al. Susceptibility trends including emergence of linezolid resistance among coagulase-negative staphylococci and meticillin-resistant Staphylococcus aureus from invasive infections. Int J Antimicrob Agents. 2015;46(6)622-30.. Our study revealed a 42% resistance rate to doxycycline, while previous studies reported higher resistance⁵⁴54. Dagnra AY, Hounkpati A, Prince-David M. Fort pourcentage de souches de Staphylococcus aureus résistantes à la méticilline au CHU de Lomé (Togo). Med Mal Infect . 2001;31(1)14-18.^,5555. Ibrahim OMA, Bilal NE, Osman OF, Magzoub MA. Assessment of methicillin resistant Staphylococcus aureus detection methods: analytical comparative study. Pan Afr Med J. 2017;27:281. For weak biofilm producers, there was a significant (p < 0.05) relationship between the type of MRSA (CA-MRSA and HA-MRSA) and doxycycline resistance. For moderate biofilm producers, a significant relationship (p < 0.05) was found for gentamycin, fusidic acid, doxycycline, and trimethoprim-sulfamethoxazole. For strong biofilm producers, both were equally resistance to antibiotics (p > 0.05). MRSA is well-known to thrive under antibiotic treatment. The variable resistance pattern to MRSA explains why antibiotics usage differs according to local guidelines in different locations. First-line drugs are more resistant because their use is common than other antibiotics. An imbalance has been detected among antibiotic usage, the discovery of new antibiotics, and emergence of resistance, which leads to serious consequences of infectious diseases⁵⁶56. Boucher HW, Talbot GH, Bradley JS, Edwards JE, Gilbert D, Rice LB, et al. Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America. Clin Infect Dis . 2009;48(1)1-12.^,5757. Shlaes DM, Sahm D, Opiela C, Spellberg B. The FDA reboot of antibiotic development. Antimicrob Agents Chemother. 2013;57(10)4605-7..

No significant difference was evident between weak and moderate biofilm producing MRSA via adhesion genes (p > 0.05). Interestingly, a significant difference was observed between the strong biofilm producers CA-MRSA and HA-MRSA because of the adhesion genes evaluated in this study (p < 0.01). Twenty-five isolates contained all of the adhesion genes, suggesting that adhesion genes were exclusively involved in biofilm formation⁵⁸58. Serray B, Oufrid S, Hannaoui I, Bourjilate F, Soraa N, Mliji M, et al. Genes encoding adhesion factors and biofilm formation in methicillin-resistant Staphylococcus aureus in Morocco. J Infect Dev Ctries. 2016;10(8)863-9.. No gene or set of genes can function as a sole indicator of biofilm formation potential; this outcome supports previous findings⁵⁹59. Mirzaee M, Najar-Peerayeh S, Behmanesh M, Moghadam MF. Relationship between adhesin genes and biofilm formation in vancomycin-intermediate Staphylococcus aureus clinical isolates. Curr microbiol. 2015;70(5)665-70.. A study conducted in Morocco revealed adhesion genes prevalence rates of 96% fnbA, 60% eno, 43% clfA, 43% clfB, 11% cna, 6% fib, and 2% fnbB in MRSA isolated from clinical specimens. These results contradicted our findings because these studies used different specimens to isolate the pathogens⁵⁸58. Serray B, Oufrid S, Hannaoui I, Bourjilate F, Soraa N, Mliji M, et al. Genes encoding adhesion factors and biofilm formation in methicillin-resistant Staphylococcus aureus in Morocco. J Infect Dev Ctries. 2016;10(8)863-9.^,6060. Howden BP, Davies JK, Johnson PD, Stinear TP, Grayson ML. Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomycin-intermediate and heterogeneous vancomycin-intermediate strains: resistance mechanisms, laboratory detection, and clinical implications. Clin Microbiol Rev . 2010;23(1)99-139.. The results of the prevalence of adhesion genes among MRSA agrees with those of previous studies⁶¹61. Ghasemian A, Najar Peerayeh S, Bakhshi B, Mirzaee M. The Microbial Surface Components Recognizing Adhesive Matrix Molecules (MSCRAMMs) Genes among Clinical Isolates of Staphylococcus aureus from Hospitalized Children. Iran J Pathol. 2015;10(4)258-64.^,6262. Liu H, Lv J, Qi X, Ding Y, Li D, Hu L, et al. The carriage of the serine-aspartate repeat protein-encoding sdr genes among Staphylococcus aureus lineages. Braz J Infect Dis. 2015;19(5)498-502.. The presence of adhesion genes in most MRSA isolated from CVC-related infection was complementary to biofilm formation and posed resistance to antibiotics.

This study revealed a significant difference among the strength of biofilm potential, type of MRSA, and antibiotic resistance. The strong biofilm producers CA-MRSA and HA-MRSA are equally resistant to antibiotics. Adhesion genes are indispensable for biofilm formation. The presence of adhesion genes is independent of biofilm strength.

Acknowledgments

We thank Dr. Omer Chughtai for providing technical support in the development and implementation of this study.

REFERENCES

Publication Dates

History