HepG2.117 (a gift from Dr. Dian-Xing Sun, University Hospital Freiburg, Germany) is an inducible HBV-replicating cell line[17]. It contains a slight over-length HBV genome under the control of a tetracycline responsive CMV promoter. Transcription of HBV pgRNA is induced upon doxycycline removal from the culture medium, leading to capsid assembly and DNA synthesis. A small portion of the de novo synthesized RC-DNA is transported into the nucleus and converted to cccDNA which serves as a transcriptional template for the production of viral RNAs.

The HBeAg start codon and precore mRNA transcription initiation point are inexistent in chromosome integrated HBV genome in HepG2.117 cells[17]. Therefore, HBeAg and precore mRNA can not be generated from the integrated genome. However, once HBV starts to replicate, a functional precore mRNA would be produced from cccDNA in this cell line, since the promoter and transcription initiation point would be restored in the process of cccDNA formation[17]. Subsequently, HBeAg would be produced from this precore mRNA where HBeAg start codon is also restored.

HepG2.117 cells were cultured in DMEM medium (Invitrogen) supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin and 100 μg/mL streptomycin (Sigma). When needed, doxycycline (Sigma) was routinely added at 1.5 μg/mL to suppress HBV pgRNA transcription.

To generate pHBVCP-Luc reporter plasmid, a 442 bp fragment corresponding to the HBV core promoter region containing enhancer II was amplified from pCH9-3091 (an ayw subtype HBV over-length genomic plasmid, kindly provided by Professor Michael Nassal, University Hospital, Freiburg)[18] by polymerase chain reaction (PCR) (forward primer: GGGGTACCCGCGGGACGTCCTTTG; reverse primer: CCAAGCTTACAAGAGATGATTAGGCAG). This fragment was then inserted into the pGL3-basic vector (Promega, Madison, WI, USA), producing pHBVCP-Luc reporter construct.

Three days after the removal of doxycycline, HepG2.117 cells were seeded into 24-well plates. Twenty-four hours later, cells were treated with fresh DMEM medium containing various concentrations of EGCG (Hubei Institute of Chemistry, Wuhan), or lamivudine (NIH AIDS Research and Reference Reagent Program, Rockville, MD, USA), respectively. The drug-containing media were replaced each day for 3 d. The medium was then collected for antigen detection and attached cells were used for DNA and RNA analysis (see below) or EGCG toxicity analysis using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cells cultured with DMEM medium without EGCG were used as a negative control.

Collected media were subjected to 10 000 ×g centrifugation to remove cellular debris. Secreted HBsAg and HBeAg were quantified by enzyme-linked immunosorbent assay (ELISA) kits (Kehua, Shanghai) following the manufacturer’s instructions. All the data on HBsAg or HBeAg are presented as percentage of antigen level detected in the negative control samples.

Total cellular RNA was extracted with Trizol reagents (Invitrogen) and treated with RQ1 RNase-free DNase I (Promega) to digest residual DNA molecules. For the semi-quantification of precore mRNA and pgRNA, 1 μg total cellular RNA was subjected to cDNA synthesis using MMLV reverse transcriptase (Promega) and random hexamer as a primer based on the manufacturer’s instructions. The cDNAs were then measured by semi-quantitative PCR using Ex Taq (Takara, Dalian) and subsequently analyzed by agarose gel electrophoresis. The specific primers for semi-quantitative detection of precore mRNA were as follows: forward, 5'-TCTGCGCACCAGCACCATG; reverse, 5'-TGCCTCGTCGTCTAACAA. The forward primer for pgRNA amplification was 5'-TCGGGAAGCCTTAGAGTC, while the reverse primer was 5'-TGCCTCGTCGTCTAACAA. Primers used for Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA amplification were as previously reported[19].

Three days after the removal of doxycycline, HepG2.117 cells were seeded into 24-well plates. Twenty-four hours later, the cells were transiently co-transfected with pHBVCP-Luc reporter plasmid and normalizing plasmid pRL-TK with FuGENE-HD reagent according to the manufacturer’s instructions (Roche Applied Science, Manheim, Germany). Twelve hours after transfection, cells were subjected to a 3-d period of treatment with EGCG. HBV core promoter activity was determined by measuring luciferase activity using the Dual Luciferase Reporter Assay System (Promega).

Extraction of cccDNA was carried out using a modified Hirt extraction procedure[16,20]. Briefly, cells from one well in the 24-well plate were lysed in 300 μL of 10 mmol/L Tris-HCl, 10 mmol/L EDTA and 0.7% SDS. After 30 min incubation at room temperature, the lysate was mixed with 80 μL 5 mol/L NaCl and incubated at 4°C overnight. The lysate was clarified by centrifugation at 12 000 ×g for 30 min at 4°C, and then extracted twice with phenol and once with phenol:chloroform. DNAs were precipitated with ethanol overnight at -20°C and dissolved in TE buffer, followed by further treatment of plasmid-safe DNase (Epicenter) to digest residual linear and open circular DNA molecules. When the reaction was finished, the plasmid-safe DNase was removed by phenol:chloroform extraction and the DNA was precipitated with ethanol at -20°C overnight and dissolved in TE buffer. Total cellular HBV DNA was extracted from the cell monolayer with the total DNA extraction kit (Takara, Dalian) according to the manufacturer’s instructions.

A pair of primers (corresponding to HBV S ORF) introduced by Liu et al[21] was applied to quantify HBV DNA copies. In order to quantify cccDNA, extracted cccDNA samples were subjected to real-time PCR and the quantification was normalized by cell numbers. The total HBV DNA samples, which contained several types of HBV DNA forms (99% of them were HBV DNA replicative intermediates), were analyzed by real-time PCR and the quantification was normalized to the GAPDH DNA copies.

In order to choose an appropriate initial concentration of EGCG in the HBV inhibition assay, the MTT assay was used to determine the cytotoxicity of EGCG to HepG2.117 cells. As shown in Figure 1, the cytotoxic effects of EGCG were undetectable when the EGCG concentration was below 100 μmol/L, while slight cytotoxicity (18% inhibition of cell viability) and significant cytotoxicity (60% inhibition of cell viability) were observed when 200 and 400 μmol/L of EGCG were used, respectively. Therefore, the maximum non-toxic concentration was 100 μmol/L, and this was used as the highest concentration of EGCG in the HBV inhibition assay.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 The cytotoxic effect of Epigallocatechin gallate on HepG2. 117 cells. Twenty four hours after seeding, cells were incubated with medium containing different concentrations of Epigallocatechin gallate (EGCG) for 3 d, and cell viability was determined by the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Cell viability of the control well not treated with EGCG was determined and arbitrarily designated as 1. Error bars indicate standard deviation of 3 independent experiments.

EGCG was reported to inhibit the expression of both HBeAg and HBsAg in HepG2-N10 cells[15]. To investigate the antiviral mechanisms of EGCG against HBV in HepG2.117 cells, a cell-based assay was used. The levels of HBeAg and HBsAg in the supernatant of EGCG-treated HepG2.117 cells were measured by ELISA. As shown in Figure 2A, HBeAg expression was dose-dependently inhibited by EGCG with an IC₅₀ of 39.4 μmol/L. However, the expression level of HBsAg was largely unaffected (Figure 2B). These results indicated that EGCG could down-regulate HBeAg level but not HBsAg level in HepG2.117 cells.

Open in New Tab   Full Size Figure   Download Figure

Figure 2 Epigallocatechin gallate inhibited hepatitis B virus e antigen expression level but not hepatitis B virus surface antigen expression level in the HepG2. 117 cell line. Twenty four hours after seeding, cells were incubated with medium containing different concentrations of Epigallocatechin gallate (EGCG) for 3 d. The hepatitis B virus e antigen (HBeAg) and hepatitis B virus surface antigen (HBsAg) expression levels in the supernatants were measured using enzyme-linked immunosorbent assay kits for measuring HBeAg and HBsAg, respectively. The level of HBeAg (A) and HBsAg (B) from cells not treated with EGCG (the control) were arbitrarily designated as 1. The levels of HBeAg (A) and HBsAg (B) in EGCG-treated cells were normalized with the control and expressed as relative levels. Error bars indicate standard deviation of 3 independent experiments.

Unlike several HBV DNA stably transfected cell lines (e.g. HepG2.2.15) whose HBeAg is mainly translated from the long early RNA that is transcribed from the inserted exogenous promoter (e.g. CMV promoter), in the HepG2.117 cell line, HBeAg is exclusively translated from precore mRNA that is transcribed from cccDNA, akin to the actual HBV life cycle in HBV-infected hepatocytes. Since EGCG down-regulates HBeAg level but not HBsAg level in HepG2.117 cells, we determined whether the down-regulation of HBeAg by EGCG was due to inhibition of the transcription of precore mRNA.

Precore mRNA and pgRNA share the same sequence, except that precore mRNA is 35 nt longer at the 5’ terminal[16]. In order to distinguish precore mRNA from pgRNA, a specific forward primer complementary to the 5’ terminal of precore mRNA was designed for the precore mRNA specific reverse transcription PCR (RT-PCR) assay. Briefly, the 19 nt forward primer was designed to anneal to the 5’ terminal of precore RNA (nt 1800-1818) which is absent in pgRNA. The reverse primer was complementary to a sequence (nt 2345-2362) present in both precore mRNA and in pgRNA. Thus, a 563 bp fragment could be amplified from precore mRNA but not pgRNA.

After HepG2.117 cells were treated with EGCG for 3 d, total RNAs were extracted and subjected to semi-quantitative RT-PCR analysis using the precore mRNA specific primers. As shown in Figure 3, the amount of 563 bp specific RT-PCR products amplified from precore mRNA decreased in a dose-dependent manner with increasing concentrations of EGCG. The total RNA sample for RT-PCR was free of DNA contamination as this specific product did not appear in reactions without reverse transcription (Figure 3, NC lane). These results indicated that after EGCG treatment, precore mRNA level was down-regulated in HepG2.117 cells, and the lowered precore mRNA level accounted for the decreased production of HBeAg.

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Epigallocatechin gallate inhibited the production of hepatitis B virus precore mRNA. Twenty four hours after seeding, HepG2.117 cells were treated with medium containing different concentration of Epigallocatechin gallate (EGCG) for 3 d. Total RNAs were prepared and were quantitated by semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) with a pair of precore mRNA selective primers. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was semi-quantitatively RT-PCR amplified and used for normalization. NC: Total RNA sample was subjected to PCR without reverse transcriptase and used as the negative control.

Precore mRNA is transcribed from cccDNA and this process is controlled by HBV core promoter[22]. To investigate whether EGCG can inhibit HBV core promoter activity, a reporter plasmid, pHBVCP-Luc, was constructed by inserting HBV core promoter before the firefly luciferase gene in the pGL3-basic vector and thus the measured firefly luciferase activity represented core promoter activity. Twelve hours after HepG2.117 cells were transfected with pHBVCP-Luc, different concentrations of EGCG were added and maintained for 3 d, and the cells were then subjected to luciferase reporter assay. As shown in Figure 4, HBV core promoter activity was not inhibited even in the presence of 100 μmol/L of EGCG, in which the expression of HBeAg was down-regulated by 85.5%. Thus, the down-regulation of precore mRNA level was not attributed to the inhibition of core promoter activity by EGCG.

Open in New Tab   Full Size Figure   Download Figure

Figure 4 Epigallocatechin gallate does not affect hepatitis B virus core promoter activity. Twelve hours after cotransfection with pHBVCP-Luc and pRL-TK, HepG2.117 cells were treated with media containing different concentrations of Epigallocatechin gallate (EGCG) for 3 d, and were lysed for the dual luciferase reporter analysis. Core promoter activity was normalized with control TK promoter activity and presented as relative luciferase units. Error bars indicate standard deviation of 3 independent experiments.

Since the precore mRNA in the HepG2.117 cell line was exclusively transcribed from HBV cccDNA, and EGCG did not suppress HBV precore mRNA transcription efficiency, we speculated that the down-regulation of precore mRNA by EGCG may be due to decreased HBV cccDNA formation.

To quantitatively analyze the amount of HBV cccDNA, EGCG-treated HepG2.117 cells were collected to obtain cccDNA, and real-time PCR analysis was used to detect cccDNA production. The results showed that EGCG could decrease cccDNA formation in a dose-dependent manner (Figure 5A). The inhibitory rates of cccDNA formation were 36.3%, 63% and 72.4%, following treatment with 25, 50 and 100 μmol/L of EGCG, respectively. As a control, the HBV polymerase inhibitor, lamivudine, also showed dose-dependent inhibition of HBV cccDNA production (Figure 5B).

Open in New Tab   Full Size Figure   Download Figure

Figure 5 Epigallocatechin gallate down-regulates hepatitis B virus covalently closed circular DNA and replicative intermediates of DNA level. A: Epigallocatechin gallate (EGCG) treatment was the same as described in Figure 1. Hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and total cellular HBV DNA were extracted and subjected to real-time polymerase chain reaction analysis; B: Lamivudine, the potent HBV DNA synthesis inhibitor, was used as a control inhibitor in this analysis. DNA level in the no treatment control was arbitrarily designated as 1. Error bars indicate standard deviation of 3 independent experiments. RI-DNA: Replicative intermediates of DNA.

HBV cccDNA is repaired from RC-DNA. RC-DNA and other forms of HBV DNA (double-stranded linear DNA and single-stranded DNA), which are collectively known as HBV replicative intermediates of DNA (RI-DNA), represent HBV DNA synthesis efficiency. In HepG2.117 cells, RI-DNA molecules constitute 99% of HBV DNA molecules[17]. Therefore, total HBV DNA level can reflect HBV RI-DNA level as well as HBV DNA synthesis level.

We suspected that impairment of cccDNA production was a result of less RI-DNA molecules produced when the cells were treated with EGCG. To verify this, total HBV DNA was extracted from EGCG-treated HepG2.117 cells and then subjected to real-time quantitative PCR analysis. As shown in Figure 5A, EGCG inhibited the level of RI-DNA dose-dependently, and the inhibitory rates were 42.2%, 63.4% and 71.8% following treatment with 25, 50 and 100 μmol/L of EGCG, respectively. The inhibitory rates were almost the same as that for cccDNA production, suggesting that the inhibition of cccDNA formation was mainly due to the decrease in HBV RI-DNA template.

Interestingly, it was observed that when treated with the same concentration of lamivudine, the decline in RI-DNA level was slightly stronger than the decline in cccDNA level (Figure 5B), e.g. 1 μmol/L lamivudine decreased RI-DNA production by 86.8% and only decreased cccDNA production by 72.4%. The reason for this could be that part of the cccDNA can be repaired from a certain amount of pre-existing RC-DNA[23,24]. The observed minimal difference in the inhibition of cccDNA and RI-DNA production implies that EGCG may partly inhibit cccDNA formation.

HBV RI-DNA is synthesized from pgRNA and catalyzed by HBV polymerase. In the HepG2.117 cell line, pgRNA is transcribed from chromosome-integrated HBV DNA genome. Since RI-DNA level was down-regulated by EGCG in this cell line, we determined whether this down-regulation was actually caused by inhibition of RI-DNA synthesis rather than suppression of pgRNA transcription.

To analyze whether EGCG inhibited pgRNA transcription, doxycycline was removed from the culture medium, and EGCG was added at the same time. Three days later, total RNAs were extracted from HepG2.117 cells and pgRNAs were analyzed semi-quantitatively. As shown in Figure 6, EGCG treatment did not interfere with pgRNA production even when 100 μmol/L of EGCG was applied. Therefore, the transcription of pgRNA from integrated HBV DNA genome was not affected by EGCG. Taken together, we conclude that the decrease in RI-DNA resulted from the inhibition of RI-DNA synthesis, rather than the down-regulation of pgRNA production.

Open in New Tab   Full Size Figure   Download Figure

Figure 6 Epigallocatechin gallate did not inhibit hepatitis B virus pregenomic RNA transcription. When doxycycline was removed from the cell culture medium, different concentrations of Epigallocatechin gallate (EGCG) were added to the HepG2.117 cells. After 3 d of culture, total RNA were extracted from the treated cells and the pregenomic RNAs (pgRNAs) were analyzed by semi-quantitative reverse transcription polymerase chain reaction. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNAs were used for normalization. NC: Total RNA sample was subjected to polymerase chain reaction without reverse transcription.

Hepatitis B virus (HBV) infection remains a major world health problem despite the availability of an effective vaccine. Currently, there is no reliable treatment that completely eliminates HBV infection in all chronic carriers. Epigallocatechin gallate (EGCG) is one of the most abundant polyphenols present in green tea. Recently, it has been reported that EGCG could inhibit HBV replication in a HBV stably replicating cell line. However, the mechanism by which EGCG inhibits HBV replication is unclear.

Currently, there are very few cell lines which can be used to investigate HBV replication. HepG2.117 is a newly reported cell line in which HBV replication is controllable using doxycycline. Hepatitis B virus e antigen (HBeAg) can only be translated from precore mRNA solely produced from replicated HBV DNA. HBeAg level correlates well with HBV DNA synthesis, whereas hepatitis B virus surface antigen level does not. Hence, this cell line is more convenient when investigating the antiviral mechanisms of leading compounds against HBV.

Results from this report showed that HBV replicative intermediates of DNA synthesis was significantly inhibited by EGCG, which resulted in reduced covalently closed circular DNA (cccDNA) production. In contrast, the production of HBV pregenomic RNA and the translation of HBeAg were not affected by EGCG.

The finding that EGCG can inhibit HBV relaxed circular partially double-stranded DNA synthesis is important both when exploring the potential of new drugs against HBV and in understanding which targets might be valid in eliminating viral replication.

The authors investigated the anti-viral mechanism of epigallocatechin gallate against HBV replication. It was observed that epigallocatechin gallate impairs replicative intermediate DNA synthesis, resulting in reduced production of cccDNA of the virus. The study is well conducted and the methodology was sound.