Caspase-12^-/- mice were purchased from the Mutant Mouse Regional Resource Center (Chapel Hill, NC, United States), which were developed on a C57BL/6J background as described[8]. The litter resuscitated from cryo-archive was genotyped, and the breeding was carried out by monogamous mating. A pair of male and female homozygous caspase-12^-/- mice was kept in the same cage for mating. Pups were weaned at an age of 3 wk and separated according to gender. Animals were maintained under 12 h light/dark cycles with unlimited access to food and water. Male mice at 8 wk of age, weighing 25-30 g, were used for the experiments. All experimental procedures were conducted in accordance with our institutional guidelines and approved by the Institutional Animal Care and Use Committee at the University of Mississippi Medical Center (Permit Number: 1107B).

Our previous study indicated that a large dose of CCl₄ [1000 μL/kg body weight (BW), equivalent to 1.59 g/kg BW; ip] induced severe liver damage and massive necrosis. Therefore, a pilot study was performed to determine the appropriate dose and time points for significant induction of hepatocyte apoptosis in littermate capsase-12^+/+ mice. CCl₄ (Sigma-Aldrich, St. Louis, MO, United States) was administered as a single ip dose of different volumes (100, 300 and 500 μL/kg BW, equivalent to 159, 477 and 795 μg/kg BW; dissolved in corn oil) or vehicle (corn oil). The animals were sacrificed at 6, 12, 24 and 48 h after CCl₄ injection. Blood and liver samples were collected for the measurements of liver injury and apoptosis.

Alanine aminotransferase (ALT) activity was measured on a Roche-cobas c501 analyzer (Roche Diagnostics, Basel, Switzerland) using Roche-cobas ALTL reagents. The assay is linear from 5-700 U/L and exhibits a slope of 1.003 (r = 0.996).

Detection of apoptotic cells by terminal transferase-mediated dUTP nick-end labeling (TUNEL) is extensively used for the quantification of apoptotic cells in tissue or cell culture. However, there have been concerns about its sensitivity and specificity. In the current study, apoptotic cells were quantified by a modified TUNEL protocol, and were controlled by morphologic study. TUNEL stain on mouse liver sections was performed by use of ApoAlert DNA Fragmentation Assay Kit (Clontech of Takara Bio Inc., Shiga, Japan) following the manufacturer’s protocol and with modifications as described by Tamura et al[24] and Labat-Moleur et al[25]. Apoptosis was quantified as TUNEL-positive cells/mm². In morphologic examination, the following findings were considered to represent apoptosis: condensation of chromatin and cytoplasm, margination of nuclei, cell blebbing, and apoptotic bodies[26].

Malondialdehyde (MDA), an intermediate of lipid peroxidation, was determined as a measure of lipid peroxidation following the protocol described by Wenger et al[27]. Briefly, liver tissue was rapidly frozen at the time of harvest and stored in liquid nitrogen. The tissue was homogenized in an ice-cold buffer (20 mmol/L PBS pH 7.4, 140 mmol/L NaCl, 0.01% butylated hydroxyanisole, 0.25 mol/L DMSO), and then centrifuged at 900 ×g for 10 min; 20 μL of liver homogenate was incubated at 90  °C for 60 min in 0.8 mL reaction mixture of 1.35 mol/L acetic acid, 0.15 mol/L sodium dodecyl sulphate, 20 mol/L 1-thiobarbituric acid (pH 3.5). After cooling the reaction tubes in ice water, 0.2 mL distilled water and 1 mL n-butanol/pyridine mixture (15:1) were added. This mixture was mixed by vortexing and then centrifuged. The organic layer was taken for fluorometric measurements of the thiobarbituric acid reactive substances fluorescence (excitation, 515 nm; emission, 553 nm), the concentration of which was calculated using 1.1.3.3-tetraethoxypropane dissolved in acetic acid as a standard.

Cell fractions were prepared as described previously[8]. Liver tissue was homogenized in an extraction buffer and cell fractions were obtained by differential centrifugations.

Western blot was performed by the chemiluminescence method as described elsewhere[28]. The antibodies used were as follows: rabbit anti-caspase-12 (AB3612, Lot 22101182; Chemicon of EMD Millipore, Billerica, MA, United States) and mouse anti-actin (MAB1501; Chemicon); rabbit anti-caspase-3 (sc-7148), caspase-8 (sc-7890), caspase-9 (sc-8355), and rabbit anti-cytochrome C (sc-7159) from Santa Cruz Biotechnology (Dallas, TX, United States); anti-glucose-regulated protein 78 (GRP78) (NBP1-06274; Novus Biologicals, Littleton, CO, United States); anti-CCAAT/-enhancer-binding protein homologous protein (CHOP) (#2895; Cell Signaling Technology, Danvers, MA); anti-serine/threonine-protein kinase/endoribonuclease (IRE-1) (ab37073; Abcam, Cambridge, United Kingdom).

Genomic DNA was isolated from a small section of mouse tail by using a GentraPure gene Mouse Tail Kit (Qiagen, Venlo, Limburg, Netherlands). PCR was performed by a GoTaq Flexi DNA Polymerase kit (Promega Corp., Madison, WI, United States) and using three primers: GS (E), GCCAGGAGGACACATGAAAGAGATC; GS (E, T), AGCTGTTCCTGGGAAT TGGCAATG; Neo, GGGTGGGATTAGATAAATGCCTGCTCT. For routine genotyping, a PCR protocol employing a mixture of the three primers was used to detect wild allele (246 bp) and mutant allele (414 bp). PCR products were visualized on a 2% agarose gel with ethidium bromide. Caspase-12 expression in mice was further confirmed by RT-PCR and Western blot.

RNA was isolated from the liver tissue using TRIzol reagent (Gibco of Thermo Fisher Scientfic, Waltham, MA, United States). Reverse transcription of 0.5 μg of total RNA and PCR were carried out by a one-step RT-PCR protocol using AccessQuick RT-PCR system (Promega Corp.). Caspase-12 primers are: 5’-GAAGGAATCTGTGGGGTGAA (F), 5’-AGGCCTGCATGATGAGAATC (R) (product size about 133 bp). GAPDH primers include: 5’-AAGATGGTGAAGGTCGGTGT (F), 5’-TTGATGGCAACAATGTCCACT (R) (product size about 98 bp). The PCR products were visualized on a 2% agarose gel using ethidium bromide and ultraviolet transillumination.

Values are expressed as the mean ± standard error. Statistical analysis was performed using an unpaired t test (for two groups only) and analysis of variance (for more than two groups). Statistical significance was considered at P < 0.05. Calculations were made with SigmaStat 3.5 (Systat Software Inc., San Jose, CA, United States).

We conducted a pilot study to determine the appropriate dose and time points for significant induction of apoptosis in the liver of wild-type mice. CCl₄-induced hepatic injury as measured by ALT was noted starting at 12 h and this damage became more severe at 24 and 48 h (Figure 1A). The increases of ALT in 300 and 500 μL/kg BW treated groups were similar, and they were significantly higher than that of 100 μL/kg group (P < 0.05). TUNEL staining demonstrated that there were virtually no positive apoptotic cells in the liver of control mice. Very few apoptotic cells (1-5 per mm²) were observed in the liver section of the mice 6 h after the CCl₄ injection. A significant amount of apoptotic cells occurred after 12 h and increased to about 50 TUNEL-positive cells per mm² at 24 and 48 h following the CCl₄ treatment (P < 0.05) (Figure 1B). The TUNEL stain result was controlled by morphologic examination, which showed that about 85% TUNEL-positive cells exhibited the morphologic features of apoptotic cells. It was determined that CCl₄ administered as a single dose of 300 μL/kg (equivalent to 477 μg/kg BW) ip induced hepatocyte apoptosis at about 50 TUNEL-positive cells/mm² at 24 h after the injection, and this was the dose used for the subsequent animal experiments.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 Dose- and time-dependent liver damage, apoptosis and reactive oxygen species generation. A: Carbon tetrachloride (CCl₄)-induced hepatic injury as measured by alanine aminotransferase (ALT) levels. Values are mean ± SE, n = 5, ^aP < 0.05 vs control, ^cP < 0.05 vs 12 h at the same dose; B: Hepatic apoptosis was examined by terminal transferase-mediated dUTP nick-end labeling (TUNEL) staining. For each sample, five randomly selected fields at 200× magnification were evaluated. Values are mean ± SE, n = 5; ^eP < 0.05 vs 100 μL/kg body weight group at the same time point; C: Generation of reactive oxygen species as measured by malondialdehyde (MDA) in both caspase-12^+/+ and -12^-/- mouse livers 12, 24 and 48 h following CCl₄ treatment (300 μL/kg body weight). Values are mean ± SE, n = 8; ^gP < 0.05 vs controls.

MDA was determined as a measure of lipid peroxidation. Lipid peroxidation started to increase 6 h after CCl₄ treatment in caspase-12^+/+ and -12^-/- mice. It was significantly increased at 12 h, continued to rise at 24 h, and maintained until 48 h following the admission of CCl₄ (P < 0.05) (Figure 1C). There was no significant difference in MDA generation between caspase-12^+/+ and 12^-/- mice.

To examine the ER stress response induced by CCl_4, we analyzed several key ER stress markers in CCl₄-treated mice by Western blot. As expected, GRP78, CHOP and IRE-1 were upregulated in the liver tissue from both caspase-12^+/+ and -12^-/- mice treated with CCl₄ (Figure 2). Caspase-12 gene knockout has no effect on the inductions of these proteins suggesting that activation of caspase-12 is a downstream event of ER stress.

Open in New Tab   Full Size Figure   Download Figure

Figure 2 Carbon tetrachloride induced endoplasmic reticulum stress in the liver. The representative Western blots show that there was an increase in endoplasmic reticulum stress response in CCl₄-treated mice. Glucose-regulated protein 78 (GRP78), CCAAT/-enhancer-binding protein homologous protein (CHOP) and serine/threonine-protein kinase/endoribonuclease (IRE-1) were upregulated in the livers of both caspase-12^+/+ and -12^-/- mice treated with CCl₄.

Procaspase-12 was identified and localized in microsomal fraction of wild-type mouse liver homogenate, but not in the nuclear, mitochondria or soluble cell factions (Figure 3A). As shown in Figure 3B, procaspase-12 (55 kDa) was cleaved to the active form (36 kDa). CCl₄ activated caspase-12 in the liver of caspase-12^+/+ mice 12 and 24 h after the treatment (Figure 3B).

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Localization of procaspase-12 in the subcellular components of liver cells and the activation of caspase-12 by carbon tetrachloride. A: Procaspase-12 was detected only in the microsome fraction but not in the nuclear, mitochondria and soluble fractions; B: Activation of caspase-12 was detected in the liver of caspase-12^+/+ mice at 12 and 24 h after CCl₄ treatment. Western blot was performed using an antibody recognizing both pro- and active forms of caspase-12. Procaspase-12 (55 kDa) was cleaved to the active form (36 kDa). The representative blot was from the results of three experiments.

Initially, we confirmed the caspase-12^-/- mice by genotyping, RT-PCR and Western blot using the tissue from a small section of the tail. Genotyping results indicated the absence of the wild-type allele and presence of the mutant allele in the caspase-12^-/- mice (Figure 4A). The absence of caspase-12 in the knockout mice was confirmed by RT-PCR for mRNA expression (Figure 4B), and by Western blot for its protein expression (Figure 4C).

Open in New Tab   Full Size Figure   Download Figure

Figure 4 Genotyping and confirmation of the lack of caspase-12 in the caspase-12^-/- mice. A: Genotyping result indicates the absence of wild-type allele and presence of mutant allele in the caspase-12^-/- mice; B: Reverse transcription polymerase chain reaction confirmed the absence of caspase-12 mRNA in caspase-12^-/-; C: Western blot showing the absence of caspase-12 protein in caspase-12^-/- mice.

To examine the role of caspase-12 in CCl₄-induced liver apoptosis, caspase-12^+/+ or caspase-12^-/- mice were injected with single dose of CCl₄ (300 μL/kg BW, ip), and the animals were sacrificed at 24 h following the injection. CCl₄ induced marked hepatic apoptosis in caspase-12^+/+ mice, and this was significantly attenuated in the caspase-12^-/- mice (P < 0.05) (Figure 5A, C). CCl₄ injection resulted in marked liver damage in caspase-12^+/+ mice as measured by serum ALT, and this injury was substantially reduced in caspase-12^-/- mice (Figure 5B).

Open in New Tab   Full Size Figure   Download Figure

Figure 5 Attenuated carbon tetrachloride-induced hepatic apoptosis and liver injury in caspase-12^-/- mice. A: Terminal transferase-mediated dUTP nick-end labeling (TUNEL) staining to evaluate carbon tetrachloride (CCl₄)-induced hepatocyte apoptosis in caspase-12^-/- mice. Five randomly selected fields at 200× magnification were evaluated for each tissue section. The numbers of apoptotic cells were counted as TUNEL-positive cells/mm². Values are mean ± SE, n = 8; ^aP < 0.05 vs controls, ^cP < 0.05 vs caspase-12^+/+; B: CCl₄-induced liver injury as measured by serum alanine aminotransferase (ALT) levels. Values are mean ± SE, n = 8; ^eP < 0.05 vs controls, ^gP < 0.05 vs caspase-12^+/+ mice; C: Representative sections of TUNEL staining under fluorescence microscope (200 ×). TUNEL-positive cells were identified by the nuclear fluorescence staining.

Western blot analysis was performed to examine activation of key caspases and cytochrome C release in response to the CCl₄ treatment. As shown in Figure 6, caspase-12 was activated (presence of cleaved form of caspase-12) in the CCl₄-treated caspase-12^+/+ mice (Figure 6A). CCl₄ treatment also resulted in the activation of caspase-3 and-9 in the liver of caspase-12^+/+ mice; activations of these caspases were significantly inhibited in caspase-12^-/- mice (P < 0.05) (Figure 6B, D, G). The mitochondria-mediated apoptotic pathway involves release of mitochondrial protein cytochrome C, resulting in activation of caspase-9. In a Western blot analysis using soluble cell factions, CCl₄ treatment induced a small amount of cytochrome C release from mitochondria, with no significant difference in the amount of cytochrome C released between caspase-12^+/+ and caspase-12^-/- mice (Figure 6C, G).

Open in New Tab   Full Size Figure   Download Figure

Figure 6 Activation of caspases and cytochrome C release in mice treated with carbon tetrachloride. Western blot analysis of A: Caspase-12; B: Caspase-3; C: Cytochrome C release from mitochondria; D: Casapse-9; E: Caspase-8; F: Actin as control in CCl₄-treated and control caspase-12^+/+ and caspase-12^-/- mice; G: Densitometric analyses of cytosolic cytochrome C and cleaved caspase-3 and -9 were performed from four independent Western blot experiments. The values were normalized to actin for each individual sample. Values are mean ± SE; ^aP < 0.05 vs CCl₄-treated caspase-12^+/+.

There was no cleaved form of caspase-8 either in caspase-12^+/+ or caspase-12^-/- mice following CCl₄ treatment. To confirm this result, a positive control using liver tissue extract from a lipopolysaccharide/galactosamine-treated rat was included along with other samples. As shown in Figure 6E, active caspase-8 was generated following exposure to galactosamine/lipopolysaccharide, but not after administration of CCl₄. The absence of active form of caspase-8 indicates the membrane-mediated pathway does not play a significant role in CCl₄-induced hepatic apoptosis in the mice.

Carbon tetrachloride (CCl₄) is a toxic agent that causes damages to liver, kidneys, and the central nervous system in humans. Many studies have investigated CCl₄-induced acute liver failure and hepatic necrosis at lethal doses. Currently, the use of CCl₄ has been limited in many countries because of its toxicity. The United States Environmental Protection Agency has set a maximum allowable level of 0.005 mg/L for CCl₄. There are no known short-term or immediate illness symptoms reported in humans due to exposure at this level. However, animal studies have shown that CCl₄ induces hepatic apoptosis at sublethal doses. The mechanism involving CCl₄-induced hepatocyte apoptosis is not well understood.

Apoptosis is executed through the activation of caspase cascades via apoptotic pathways. The pathways start with activation of an initiator caspase by different stimuli, caspase-8 in membrane-mediated, caspase-9 in mitochondrial-mediated, and caspase-12 in endoplasmic reticulum (ER) stress-mediated pathways. The active initiator caspases then activate effector caspases-3, -6 or -7, which cleave key substrates required for normal cellular functions leading to apoptosis. The initial event in the liver of CCl_4-treated animals is generation of reactive oxygen species within the ER. The ER is highly sensitive to environmental insults such as oxidative stress, which lead to ER stress. Procaspase-12 is predominantly located on the cytoplasmic side of the ER, and it is activated by ER stress. The direct role of caspase-12 and its downstream targets in CCl₄-induced hepatocyte apoptosis have not been examined previously.

This is believed to be the first study to investigate the direct role of caspase-12 and its downstream targets in CCl₄-induced hepatocyte apoptosis using caspase-12 knockout animals. The authors have demonstrated that caspase-12 plays a pivotal role in CCl₄-induced hepatocyte apoptosis through the downstream activation of the effector caspase-3 directly and/or indirectly.

Understanding the mechanism of CCl₄-induced hepatocyte apoptosis is important for the development of potential therapeutic strategies, such as the use of antioxidant, chemical ER chaperones and/or caspase-12 inhibitor for preventing/lessening CCl₄-induced liver apoptosis and injury at the minimal exposure.

The ER is a major intracellular site for calcium storage and the production of secretory proteins through protein synthesis, folding and modification. Disturbance in any of the functions will disrupt proper protein folding and increase the load of unfolded or misfolded protein; the condition is called ER stress. The unfolded protein response (UPR) is a cellular response to ER stress. UPR has three aims: initially to restore normal cellular function by decreasing protein translation, degrading misfolded proteins, and activating the signaling pathways that lead to increasing the production of molecular chaperones involved in protein folding. If these objectives are not achieved or the disruption is prolonged, the UPR aims towards apoptosis.

The manuscript provides novel information. It is well written. The design, materials and methods are satisfactory. The results support the conclusions drawn.