Vincristine sulfate (VCR), 5-fluorouracil (5-FU), mitomycin C (MMC), cisplatin (CDDP), 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), and Wnt3a were purchased from Sigma-Aldrich (Indianapolis, IN, United States). β-escin was purchased from Aladdin Chemistry Co (Shanghai, China). RPMI-1640 medium and fetal calf serum were purchased from Gibco (Grand Island, NY, United States). Monoclonal antibodies against β-catenin, p-β-catenin, P-gp, and β-actin were purchased from Santa Cruz Biotechnology (San Jose, CA, United States). Polyclonal GSK3β, pS9-GSK3β, and pT216- GSK3β antibodies were from Abcam Ltd (Cambridge, United Kingdom). Goat anti-rabbit and anti-mouse secondary antibodies conjugated to horseradish peroxidase were purchased from Thermo Scientific Pierce Co. Ltd (Rockford, IL, United States). Polyvinylidene difluoride (PVDF) membranes were from Millipore (Billerica, MA, United States). EliVision Plus Kit was from Maixin Bio (Fuzhou, China). Dual-Luciferase Reporter Assay Kit was from Promega (Madison, WI, United States).

The human CCA cell line QBC939 was kindly provided by Professor Shu-Guang Wang from Southwest Hospital, Third Military Medical University, Chongqing, China. The human cholangiocarcinoma MDR cell line QBC939/5-FU was established in our lab. The cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 100 U/mL of ampicillin, and 100 U/mL of streptomycin sulfate at 37 °C in a humidified atmosphere under 5% CO₂. The cells were treated with culture medium containing various concentrations of drugs after 24 h seeding.

Cell proliferation was analyzed by MTT method. The cells were seeded at 5 × 10³ per well into 96-well plates overnight. After treatment of the cells with a series of concentrations of 5-FU, CDDP, VCR, MMC, and β-escin, alone or in combination for 24 h, 20 μL MTT (5 mg/mL) was added to each well, and the cells were cultured for another 4 h at 37 °C. Formazan crystals were then were dissolved in DMSO. The absorbance was measured at 490 nm using an ELISA microplate reader. The experiment was performed in triplicate.

Combination effect was analyzed using the combination index (CI) method. The CI was defined by the following equation: CI= (OD490)_AB/[(OD490)_A + (OD490)_B], where (OD490)_AB was the absorbance of the drug A and B combined treated group, whereas (OD490)_A and (OD490)_B were that of the drug A or B alone treated group. Parameter CI values > 1 indicated antagonism, CI values = 1 indicated additivity, CI values < 1 indicated synergy, and CI values < 0.7 indicated significant synergy. Each represented CI ratio was the mean value derived from at least three independent experiments.

Total RNA was extracted and reverse transcribed. The PCR primers are as follows:

MRP1, forward primer ATCTCTCCCGACATGACCGA, reverse primer CACACACTAGGGCTACCAGC; MRP2, forward primer CTGCCACTTTGTTTTGAGCA, reverse primer TACAAGGGCCAGCTCTATGG; MRP3, forward primer CTCCAAGTTCTGGGACTCCA, reverse primer CAGGTGGGAGAGGATGATGT; P-gp, forward primer GACATCCCAGTGCTTCAGG, reverse primer GCCACTGAACATTCAGTCG; GAPDH, forward primer CACATGGCCTCCAAGGAGTAAG, reverse primer TGAGGGTCTCTCTCTTCCTCTTGT. Real-time PCR was performed using a fluorescent temperature cycler (LC480 Real Time PCR System, Roche Co., Ltd). GAPDH was used as an internal standard.

Cell lysates containing equal amounts of proteins were separated on 10% SDS-polyacrylamide gels and electrotransferred onto PVDF membranes, which were blocked in 5% milk in PBST (NaCl 137 mmol/L, KCl 2.7 mmol/L, Na₂HPO₄ 10 mmol/L, KH₂PO₄ 2 mmol/L, and 0.05% Tween-20) for 1 h, with the primary indicated antibody then being incubated overnight at 4 °C. After three washes in PBST, blots were incubated with horseradish peroxidase-conjugated secondary antibody and visualized by chemiluminescence. β-Actin was used as an internal control.

QBC939 cells and QBC939/5-FU cells (1.0 × 10⁵ cells/well) were seeded in 24-well plates and incubated overnight before transfection. The cells were co-transfected with reporter plasmid 200 ng pTOP-Flash or pFOP-Flash and 200 ng β-galactosidase (β-gal) using Lipofectamine 2000. TCF-responsive TOP-Flash reporter contains three TCF binding sites and the corresponding FOP-Flash contains three mutated TCF sites[21]. The indicated cells treated with β-escin (20 μmol/L) and Wnt3a (50 ng/mL) alone or together for 4 h were analyzed for luciferase activity using a Dual-Luciferase Reporter Assay System according to the manufacturer’s instructions. Luciferase activity was normalized for transfection efficiency using the corresponding β-gal activity. The experiment was performed in triplicate.

After overnight culture, QBC939 and QBC939/5-FU cells were treated with 20 μmol/L β-escin for 0.5 h, fixed in 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton X-100 for 20 min, and then incubated with primary P-gp antibody overnight at 4 °C, followed by incubation with horseradish peroxidase-conjugated secondary antibody for 30 min at room temperature. Images were collected and analyzed using an inverted fluorescence microscope (Leica, Barcelona, Spain). The experiment was performed in triplicate.

SPSS 16.0 statistical software (SPSS Inc., Chicago, IL, United States) was used for statistical analysis. The data were expressed as the mean ± SEM for samples and evaluated by one-way analysis of variance or Kruskal-Wallis tests to compare mean values. Each assay was repeated in triplicate. The level of significance was set at P < 0.05.

To explore the mechanisms of MDR in CCA, we established a human MDR CCA cell line QBC939/5-FU[22]. The MTT assay was performed after exposure of QBC939/5-FU cells to a series of concentrations of 5-FU, CDDP, VCR, and MMC. MDR tumor cells QBC939/5-FU presented resistant to all chemotherapeutics (Figure 1A). To identify effective treatment for human CCA, our findings showed that β-escin at a concentration of 20 μmol/L showed a significant synergistic effect in combination with 5-FU, VCR, and MMC on CCA cells (P < 0.05) (Figures 1B and C). The effects of β-escin in combination with 5-FU and VCR on QBC939 and QBC939/5-FU cells are further detailed in Tables 1 and 2. The 50% inhibition concentrations (IC50) of QBC939 cells to 5-FU in combination with β-escin (0, 5, 10, and 20 μmol/L) were 114 ± 2.17, 101 ± 1.14, 96 ± 1.54, and 31 ± 1.89 μmol/L, respectively (Table 1). Similarly, the IC50 of QBC939/5-FU cells to 5-FU were 135 ± 2.59, 130 ± 2.75, 99 ± 2.96, and 37 ± 1.32 μmol/L, respectively (Table 1). Significantly, the IC50 of 5-FU in QBC939 and QBC939/5-FU cells was decreased, especially when combined with β-escin (20 μmol/L). Similar results for VCR were showed in Table 2. The IC50 of QBC939 and QBC939/5-FU cells to VCR were 102 ± 1.83, 88 ± 2.47, 72 ± 1.53, 18 ± 1.25 μmol/L, 125 ± 2.37, 104 ± 1.59, 82 ± 2.57, and 35 ± 1.36 μmol/L, respectively. These results indicate that drug sensitivity of QBC939 and QBC939/5-FU cells to 5-FU and VCR was enhanced by β-escin.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 β-escin enhanced the sensitivity of cholangiocarcinoma cells to chemotherapeutic drugs. A: MDR cell line QBC939/5-FU cells were treated with different concentrations of 5-FU, CDDP, VCR, and MMC for 24 h. Cell viability measured by MTT assays; B-C: Effects of β-escin (20 μmol/L) in combination with chemotherapeutics (40 μmol/L) on QBC939 cells and QBC939/5-FU cells. Cell viability measured by MTT assays after treatment for 24 h. ^aP < 0.05 vs control. MDR: Multidrug resistance; MTT: 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; 5-FU: 5-fluorouracil; VCR: Vincristine sulfate; MMC: Mitomycin C; CDDP: Cisplatin.

Open in New Tab   Full Size Figure   Download Figure

Figure 2 Expression of P-gp down-regulated by β-escin. A: Expression of MRP mRNA analyzed using real-time PCR after treatment with β-escin for 24 h; B: Expression of MDR mRNA analyzed using real-time PCR (upper panel) and agarose gel electrophoresis analysis (lower panel) after treatment with β-escin for 24 h. Data were normalized to GAPDH; C: Expression of P-gp protein detected by ICC. Zoom: × 400; D: Expression of P-gp protein detected by western blot. β-Actin used as loading control. E: β-escin. ^aP < 0.05, ^bP < 0.01 vs control. PCR: Polymerase chain reaction; MDR: Multidrug resistance; MRP: MDR-related protein; P-gp: P-glycoprotein; ICC: Immunocytochemistry.

CI analysis was performed to determine the effect of β-escin in combination with 5-FU or VCR. The results of β-escin in combination with 5-FU or VCR on QBC939 and QBC939/5-FU cells are showed in Tables 1 and 2. The CIs of β-escin (20 μmol/L) in combination with 5-FU (20, 40, 80 μmol/L) on QBC939 and QBC939/5-FU cells were 0.992, 0.907, 0.768, 0.793, 0.693, and 0.507, respectively, indicating synergistic interactions (0.7 < CI < 1) and significantly synergistic interactions (CI < 0.7). However, the CIs of β-escin (5, 10 μmol/L) were mostly greater than 1, which showed an antagonistic interaction (Table 1). Likewise, the effects of β-escin (20 μmol/L) in combination with VCR were also synergistic interactions and significantly synergistic interactions, which were better than that of β-escin (5, 10 μmol/L) (Table 2). Together, these results demonstrated that a combination of β-escin with chemotherapeutics might be an effective therapy for CCA.

To investigate the mechanisms that cause β-escin to enhance the drug sensitivity of CCA cells to common chemotherapeutics, real-time PCR, immunocytochemistry (ICC), and western blot were performed to assess the expression of MDR-associated genes in QBC939 and QBC939/5-FU cells after treatment with various concentrations of β-escin (0, 5, 10, and 20 μmol/L) for 24 h. As shown in Figure 2A, there was no significant change in MRP1, MRP2, or MRP3 mRNA expression after β-escin treatment, but a significant decrease was found in P-gp mRNA expression (Figure 2B). In addition, results of ICC show that β-escin reduced the expression of P-gp in a dose-dependent manner (Figure 2C) consistent with the suppressed protein expression detected by western blot (Figure 2D). These results indicated that β-escin could down-regulate the expression of P-gp in QBC939 and QBC939/5-FU cells.

We recently reported that P-gp might be a downstream target gene of the Wnt/β-catenin pathway in CCA cells[23], so we evaluated whether down-regulation of P-gp induced by β-escin was associated with the inhibition of said pathway. Luciferase reporter assays showed that activation of the Wnt/β-catenin pathway was remarkably enhanced by Wnt3a treatment and significantly reduced by β-escin on both QBC939 and QBC939/5-FU cells. Moreover, Wnt3a-induced activation of the Wnt/β-catenin pathway was almost completely prevented by β-escin (Figure 3A). In an effort to study the precise regulation of β-escin on Wnt/β-catenin signaling, we examined the expression levels of related proteins in this pathway. As shown in Figure 3B, the levels of β-catenin phosphorylation and degradation were increased after β-escin treatment. In addition, the level of phosphorylation at Ser-9 was decreased and dephosphorylation at Tyr-216 was increased, indicating that β-escin inhibited the activation of the GSK3β/β-catenin pathway in both QBC939 and QBC939/5-FU cells.

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Down-regulation of P-glycoprotein induced by β-escin via inhibiting the activation of the GSK3β/β-catenin pathway. A: The activation of the Wnt/β-catenin pathway assessed by TCF/LEF responsive luciferase reporter activity in QBC939 and QBC939/5-FU cells after treatment with β-escin. Data were shown as the mean ± SD of three independent experiments; B: Western blot analysis of GSK3β and β-catenin expression in QBC939 and QBC939/5-FU cells treated with a series of concentrations of β-escin; C: Western blot analysis of GSK3β and P-gp in QBC939 and QBC939/5-FU cells after different treatments for 24 h. β-actin used as loading control. E: β-escin (20 μmol/L); W: Wnt3a (50 μg/L); C: Control (PBS). ^aP < 0.05, ^bP < 0.01 vs control. TCF: T-cell factor; LEF: Lymphoid enhancer factor.

We further studied whether β-escin-induced P-gp down-regulation was GSK3β dependent. Western blot analysis showed that β-escin led to phosphorylation in Tyr-216 of GSK3β and dephosphorylation in Ser-9 of GSK3β, as well as down-regulation of P-gp (Figure 3C). In contrast, Wnt3a led to phosphorylation in Ser-9, dephosphorylation in Tyr-216 of GSK3β, and up-regulation of P-gp. Interestingly, co-treatment of cells with β-escin almost completely suppressed the increase of P-gp induced by Wnt3a. Similar changes were seen in the protein expression of pS9-GSK3β with β-escin and Wnt3a treatment. These data suggested that β-escin-induced P-gp down-regulation was GSK3β dependent.

Cholangiocarcinoma (CCA), a chemoresistant bile duct carcinoma which results in a poor prognosis, is resistant to all currently available chemotherapeutics because of its multidrug resistance (MDR). A safe and effective agent for CCA chemotherapy is therefore urgently needed.

β-escin could enhance the drug sensitivity of cholangiocarcinoma cells to common chemotherapeutics. Furthermore, β-escin could down-regulate P-gp expression via inhibiting the activation of GSK3β/β-catenin pathways. The results may provide a reference for additional insight into the potential synergistic effects of β-escin in combination with chemotherapeutics on CCA cells.

Overcoming MDR is broadly known to be effective in cancer therapy. β-escin, isolated from the seed of the horse chestnut, plays an important role in circumventing drug resistance in drug combination on CCA cells. An important finding of the present study is that the Wnt/β-catenin pathway was involved in the β-escin-induced down-regulation of P-gp on CCA cells. This study has demonstrated that β-escin can sensitize CCA cells to common chemotherapeutics, and also clarified that β-escin could inhibit P-gp expression through the inhibition of the GSK3β/β-catenin pathways.

β-escin was a potent reverser of P-gp-dependent MDR, and this effect was likely through the inhibition of the GSK3β/β-catenin pathway, suggesting a promising strategy of developing combination drugs for CCA.

β-escin, the major active compound in extracts of the horse chestnut (Aesculus hippocastanum) seed, has shown clinically significant anti-inflammatory activity, as well as inhibitory effects on colon cancer. MDR belonging to a superfamily of ATP-dependent transporters, is the major obstacle to a successful cancer therapy.

This is a comprehensive manuscript with fine structure which adequately highlights the role of β-escin in cholangiocarcinoma. To date, there is no sufficiently adequate study concerning this subject. Usually this disease is already at the advanced stage by the time of diagnosis, and thus responds poorly to chemotherapy. Genetic study of the tumor and research into inhibitors of pathways make up the future of targeted therapy.