The strains and plasmids used in this study are listed in Table 1. HeLa cell line was maintained in our laboratory. BALB/c mice were bought from the Laboratory Animal Center in the Academy of Military Medical Sciences, Beijing. All mice used in this study were female, specific pathogen free animals, with an age of 7-8 weeks and weight of 18-22 g. DNA endonucleases, DNA marker, T4 DNA ligase, T4 DNA polymerase, Ex Taq DNA polymerase, and CIAP were purchased from Takara Company. Newborn calf sera and RPMI1640 media were from HyClone, and deoxycholate sodium from Sigma. Primers (P1, P2, P3, and P4) were synthesized in our laboratory.

Culture and maintenance of strains and HeLa cells Luria-Bertani (LB) broth and agar plate were used for the growth of S. flexneri and Escherichia coli strains at 37 °C. SOC culture medium was applied to the restoration of bacteria after electroporation. When appropriate, antibiotics were added in media as follows: 100 μg ampicillin (Ap), 100 μg streptomycin (Sm), 50 μg kanamycin (Km), 25 μg chloramphenicol (Cm), and 25 μg naladixic acid (Nal) per ml. HeLa cells were maintained in the RPMI-1640 medium supplemented with 10% fetal bovine serum, 200 mM L-glutamine, 2 mg sodium hydrogen carbonate per ml and 100 μg penicillin-streptomycin per ml. The cells were cultured in 37.5 cm² or 10 cm² flasks at 37 °C in a humidified atmosphere of 5% CO₂. Confluent monolayers were split by treatment with sterile phosphate-buffered saline (PBS) and trypsin-EDTA.

Genetic techniques Plasmid DNA extraction was carried out using a Qiagen plasmid kit. Digestion, ligation, transformation, and other conventional methods of molecular biology were performed as previously described[18].

DNA amplifications For the amplification of S. flexneri 2a alkA gene, PCR was performed in a standard 100 μl reaction volume containing 2.5 mM Mg Cl₂, 0.25 mM of each dNTP, 100 pmol of P1 and P2 primers, 10 μl boiled S. flexneri 2a 2457T, and 5 U Taq DNA polymerase. Reactions were allowed to proceed in a Perkin-Elmer 2400 thermal cycler programmed for 10 min at 94 °C, 30 cycles (for 45 s at 94 °C, for 40 s at 55 °C, for 3 min at 72 °C) and an additional extension reaction for 10 min at 72 °C. For the amplification of fragment 028pKm, PCR was carried out in 100 μl reaction volume containing 2.5 mM MgCl₂, 0.25 mM of each dNTP, 100 pmol of P3 and P4 primers, 2 μl plasmid pMD028pKm (about 10 ng), and 5 U Taq DNA polymerase. The program of this PCR was at 94 °C for 10 min, 30 cycles (for 30 s at 94 °C, for 40 s at 58 °C, for 1.5 min at 72 °C) and for 10 min at 72 °C.

Bacterial mating The donor and recipient strains were grown in LB medium containing appropriate antibiotics overnight. The liquid cultures were then washed in PBS, mixed at 1:1 ratio, and spreaded on LB agar plates. The plates were incubated at 37 °C for 6-8 h. After incubation, the conjugation mixture was washed in PBS and spread onto LB agar plates containing chloramphenicol (25 μg·mL^-1) and naladixic acid (25 μg·mL^-1). The plates were incubated at 37 °C until transconjugants were visible.

Disruption of S. flexneri 2a alkA geneS. flexneri 2a 2457T05 was grown in 5 ml LB cultures with chloramphenicol, naladixic acid and L-arabinose to an OD₆₀₀ = 0.45 and then made electrocompetent by concentrating 100-fold and washing three times with ice-cold 10% glycerol. The gel-purified 028pKm PCR products were digested with DpnI, repurified, and suspended in elution buffer (10 mM Tris, pH 8.0). Electroporation was done using a gene pulser^® II with a pulse controller plus and 0.1 cm chambers according to the manufacturer’s instructions (Bio-RAD) using 40 μl of competent cells and 100 ng of 028pKm fragments. The parameters for electro- transformation were resistance 200 Ω, capacitance 25 μF, and voltage 2500 V. Shocked cells were added to 1 ml SOC culture, incubated for 1 h at 37 °C, and then one-half was spread onto agar to select Km^r and Nal^r transformants. If none grew within 24 h, the remainder was spread after standing overnight at room temperature.

Intracellular survival assay HeLa cell infection assay was routinely used to detect the intracellular replication or survival ability of the mutant[19-21]. S. flexneri 2a 2457T, 2457T05, mutant strain and E. coli MC1061 (noninvasive control) were grown in an appropriate medium overnight. The liquid cultures were then washed in PBS and resuspended in antibiotic-free medium. Approximately 10⁶ HeLa cells were cultured in a 10 cm² flask. HeLa cells were washed three times in PBS prior to incubation with about 10⁸ CFU bacteria at 37 °C for 3 h. The medium was removed from infected cells after 2.5 h, and the cells were washed three times in PBS. Fresh medium containing gentamicin (20 μg·mL^-1) was added and the flasks were incubated for 5 h to eliminate extracellular bacteria. After that, the medium was replaced by RPMI1640 containing gentamicin (20 μg·mL^-1) and the infected cells were cultured for another 40 h. The supernatants of culture were tested for extracellular surviving bacteria by plating them on LB agar plates. The monolayers were then washed three times in PBS and lysed by addition of 0.1% deoxycholate sodium to liberate the intracellular bacteria. Dilutions of the lysates of HeLa cells infected with bacteria were plated on LB agar plates and cultured at 37 °C overnight. The CFU of the bacteria was then counted.

Competition assay To test the mutant strains for alterations in virulence relative to the wild type, a competition assay was carried out by using a murine intranasal infection model[22-24] with some modifications. The mutant or MC1061 (negative control) or 2457T (positive control) and 2457T05 grown overnight were mixed at 1:1 (v/v) ratio and washed in PBS. After concentration of the mixture was adjusted by dilutions, 20 μl mixtures containing about 10⁶ CFU in PBS was used to introduce droplets into the nares of BALB/c mice that was anesthetized. The number of bacteria in each inoculum was determined by plating serial dilutions of the inoculum. After 24 h, the recovered bacteria from the lungs of mice were counted, and then the number of mutant strains and 2457T was counted. According to the method of Camilli et al[25], the competitive index of each mutant was obtained.

Bioinformatics analysis The sequence of S. flexneri 2a alkA gene was analyzed by BLAST (http://www.ncbi.nlm.nih.gov/BLAST/). The identity and gene function were also analyzed by NCBI.

Data from the intracellular survival assay were analyzed by Dunnett t test, and P value less than 0.05 was considered as statistically significant. Data from the competition assay were analyzed by the sign test, and P value less than 0.0078 was considered as statistically significant. The Dunnet t test and the sign test were performed using the SAS (Statistical Analysis Systems Inc., USA) program.

In our previous work, we identified S. flexneri 2a alkA as an in vivo-induced gene, and obtained the partial sequence of S. flexneri 2a alkA gene which had an alignment with other bacteria. Based on the sequence of E. coli alkA, the primers, P1 (CGAGGAACGATTTTGGTGAT) and P2 (CTCGCT-GAAAGCGAATATGG) (Figure 1B) were designed. Using S. flexneri 2a 2457T chromosome DNA as a template, PCR was performed and the PCR products were purified by agarose gel electrophoresis, and ligated into plasmid pMD18-T to produce plasmid pMD028 after the confirmation of EcoRV and HindIII digestion analysis. The recombinant plasmid pMD028 was subjected to DNA sequencing to obtain the whole length DNA sequence of alkA. Its open read frame was 849 bp. In the upstream there was a promoter sequence (AGCAAAGCGTAACGTCTGAATAACGTTTATGCT) and the binding site (AAAGCAAA) of Ada protein which was a regulator of alkA gene expression in E. coli. Based on the sequence of S. flexneri 2a alkA, homologous analysis was carried out on the NCBI website. The results are listed in Table 2. Interestingly, the sequence alignment revealed a Helix- hairpin-Helix (HhH) motif common to DNA glycosylases. E. coli alkA was identified as the helix-hairpin-helix DNA glycosylase[26]. Very possibly, alkA protein from S. flexneri 2a belonged to an HhH-GPD super family. Its hallmark was Helix-hairpin-Helix and Gly/Pro rich loop followed by a conserved aspartate and its function was presumably involved in DNA replication and repair.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 Location of primers P1, P2, P3 and P4 in PCR prod-ucts of alkA and 028pKm. A: 028pKm (about 1.4 kb); B: alkA (about 1.7 kb).

To delete alkA gene of S. flexneri 2a, construction of S. flexneri 2a engineering strain expressing gam, bet, and exo genes, was required. The fragment (about 4 kb) containing gam, bet, and exo genes was obtained by digestion of pKD46 plasmid with Pvu I and Bstx I and ligated into the Sal I site of suicide plasmid pXL275. Then the ligation products were then transformed into S_17-1λpir. The recombinant plasmid was confirmed by BamHI digestion and known as pXLkd46. After bacterial mating of the donor (S_17-1λpir/pXLkd46) and recipient (2457T), pXLkd46 plasmid was integrated into chromosome of S. flexneri 2a by homologous recombination. The process of pXLkd46 plasmid construction and chromosomal integration is showed in Figure 2. The resulting strain was verified with antibiotic selection and serum agglutination and designated as 2457T05.

Open in New Tab   Full Size Figure   Download Figure

Figure 2 Construction and chromosomal integration of pXLkd46 plasmid.

After 2457T05 was successfully constructed, the linear targeting DNA, 028pKm, was required for disruption of S. flexneri 2a alkA gene with λ Red recombination system. To obtain the fragment 028pKm, recombinant plasmid pMD028pKm was firstly to be constructed. Km^r gene fragment was obtained from plasmid pMDKm05 digested by HincI I and Sma I and inserted into the alkA gene of plasmid pMD028 digested by EcoRV and StuI and dephosphorized by CIAP. The ligation products were then transformed into E. coli DH5α. The recombinant plasmids were isolated from the transformants, confirmed by EcoR I digestion, and designated as pMD028pKm (Figure 3). Using pMD028pKm as a PCR template, P3 (TGTGCCAGTGAGGAAAGACC) and P4 (GAGAGAGCGTTTGCCCATTG) (Figure 1A) as primers, PCR was carried out. In order to reduce the interference of plasmid pMD028pKm, the second PCR was carried out at the same experimental condition except that the template was the first PCR products diluted by 1000 times. The second PCR products (028pKm) did not contain the template plasmid pMD028pKm that would lead to false positive colonies in the latter electroporation experiment. The 028pKm fragment was a cassette, 5’alkA end-Km^r-3’alkA end (Figure 1A). The concentrated 028pKm was electroporated into S. flexneri 2a engineering strain 2457T05. The alkA gene was then replaced by kanamycin resistance gene through homologous recombination mediated by λ Red system. The positive transformants were selected on LB agar plates containing Km and Nal.

Open in New Tab   Full Size Figure   Download Figure

Figure 3 Construction of recombinant plasmid pMD028pkm.

To verify the replacement of S. flexneri 2a alkA gene, PCR and sequencing were used. PCR was performed in which 2457T05 (negative control), the transformant and pMD028pKm plasmid (positive control) were used as templates. The reaction conditions were the same as the amplification of S. flexneri alkA gene, and the primers were also P1 and P2. The PCR products from the transformant and pMD028pKm plasmid were about 1.4 kb and 1.7 kb from 2457T05 respectively (Figure 1, Figure 4). Then the PCR products were sequenced and analyzed by BLAST (data not shown). The result indicated that alkA gene of S. flexneri 2a was replaced by Km^r gene. Hereby, the deletion mutant of alkA gene was successfully constructed and designated as 2457T028D.

Open in New Tab   Full Size Figure   Download Figure

Figure 4 Verification of alkA gene deletion of 2457T028D mutant by PCR. 1: alkA PCR product (amplified from 2457T05), 2: 028pKm PCR product (amplified from 2457T028D), 3: 028Kkm PCR product (amplified from pMD028pKm), 4: DL2000 Marker.

In order to detect the role of alkA in the pathogenesis of S. flexneri, intracellular survival assay and virulence assay were respectively carried out in HeLa cells and BALB/c mice.

Mutant 2457T028D was tested for its survival ability in HeLa cells relative to the wild-type strain. Equal volume of each strain (2457T, 2457T05, 2457T028D and MC1061) was respectively used to infect the HeLa cell monolayer. Within 48 h, the integrity of the infected HeLa cell monolayer was good and the configuration of HeLa cells had no significant alterations relative to normal cells. But the growth rate of the infected cells became slow. After 48 h, CFU of bacteria recovered from HeLa cells was counted. The results of the infection assay are summarized in Figure 5. Noticeably, CFU levels of the mutant recovered from HeLa cells were five-fold lower than that of the wild type (P < 0.01), indicating that the mutant had a lower capability of survival or replication. The survival probability of 2457T and 2457T05 showed no significant difference (Figure 5). In order to further confirm the survival probability of the mutant, competition assay was carried out with the HeLa cell infection model. A 1:1 (v/v) mixture of S. flexneri 2a 2457T05 and the mutant or 2457T or MC1061 was used to infect HeLa cells. The number of bacteria in each inoculum was determined by plating serial dilutions of the inoculum. After 48 h, recovered bacteria from HeLa cells were counted, and the number of bacteria was counted respectively. The experiment was separately repeated 3 times. Therefore, the competitive index of each strain obtained is shown in Table 3. The mutant 2457T028D whose survival probability was significantly lower in the infection assay, exhibited significant survival defects in this experiment (P < 0.0078). The data strongly indicated that the mutant was much less able to survive in HeLa cells.

Open in New Tab   Full Size Figure   Download Figure

Figure 5 Comparison of HeLa cells infected by 2457T, 2457T05, 2457T028D and MC1061.

The mutant was also tested in a mice lung infection model for alterations in virulence relative to the wild-type parental strain. Mice that were challenged only with S. flexneri 2457T showed early acute bronchiolitis at 24 h, followed by severe pneumonia at 48 h. Five mice were used for each group in the murine lung infection model. After 24 h, recovered bacteria from the lungs of mice were counted, and the number of each strain was counted. Then the competitive index of each strain obtained is summarized in Table 3. The mutant also exhibited significant colonization defects (P < 0.0078). The data further indicated that alkA gene was potentially related to the virulence of S. flexneri 2a 2457T.