Liraglutide attenuates atherosclerosis via inhibiting ER-induced macrophage derived microvesicles production in T2DM rats

Male Sprague Dawley (SD) rats (Experimental Animal Center of Peking University Health Science Center, Beijing, China), weighting 180–200 g, were studied. The rats were housed in plastic cages on 12 h light–dark cycle at 20–22 °C and humidity 55% ± 5% and fed with a standard chow and tap water ad libitum. The study protocol was approved by the Animal Care and Use Committee of Tianjin Medical University and in accordance with the Guide for the Care and Management of Laboratory Animals. The rats were randomly separated into diabetic model rats (n = 22) and control group rats (n = 8). The former were fed with HFD for 8 weeks and then given tail intravenous injection of STZ (2% STZ at 30 mg/kg, Sigma-Aldrich, USA, dissolved in citrate buffer, pH 4.5, at 4 °C) [14], and the latter were fed with regular chow and injected with the same dose of citrate buffer. After 72 h of the STZ injections, blood samples were harvested from the rat tail vein to check the random blood glucose (RBG). The levels of RBG were measured by glucose oxidase electrode method. The rats with RBG ≥ 16.7 mmol/L were considered to be diabetic rats. The RBG of control group rats are also measured at the same time. HFD/STZ induced diabetic rats were randomly studied in the following two different treated groups, liraglutide group (n = 11) and diabetes group (n = 11). The former were given percutaneous injections of liraglutide (200 μg/kg/d, continuous 12 weeks) [15] and fed with HFD. The latter were given percutaneous injections of the same dose of phosphate buffered saline (PBS) and fed with HFD. The control group rats were given regular chow and PBS at the same time. The levels of fasting blood glucose (FBG) and body weight were measured weekly. At 12 weeks after liraglutide treatment, rats were sacrificed by cervical dislocation under anesthesia with pentobarbital sodium (60 mg/kg intraperitoneal injection). Serums were obtained from the peripheral blood collected by extracting from the inner canthus by centrifugation at 3000 rpm for 10 min for biochemical assays. Aorta specimens were removed carefully after the rats were sacrificed and fixed in formalin for hematoxylin-eosin (HE) and immunohistochemical staining. The other aorta tissues were stored at − 80 °C for performing RT-PCR, western blot and ELISA assays.

The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), creatinine (Cr), blood glucose, high density lipoprotein-cholesterol (HDL-C), total cholesterol (TC), total triglycerides (TG) and fasting insulin (FINS) were measured using automatic biochemical analyzer (the Hospital of Metabolic Disease of Tianjin Medical University, Tianjin, China). The homeostasis model assessment insulin resistance (HOMA-IR) was calculated by the following formula: HOMA-IR = FBG (mmol/L) × FINS (mIU/L)/22.5.

The fixed aorta tissues were embedded in paraffin blocks. 4 μm sections were prepared from paraffin blocks and stained with HE routinely. For cluster of differentiation 68 (CD68) staining, aorta sections were deparaffinized and rehydrated, and then were microwaved at 97 °C for 15 min for antigen retrieval. Tissue sections were placed in 3% hydrogen peroxide for 10 min to quench endogenous peroxidase. Sections were stained for CD68 with a rat anti-CD68 monoclonal antibody (at 1:200 dilution, sc-101447, Santa Cruz, America) and the avidin–biotin–peroxidase complex technique. Diaminobenzidine was applied for final colour development. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed with the In-Site-Cell-Death-Detection-Kit (Roche, Mannheim) according to the manufacture’s protocol.

Total RNA was isolated using Tri Reagent (Sigma-Aldrich). cDNA was synthesized from total RNA with oligo-dT-primers by using a cDNA Kit (Roche) according to the manufacture’s manual. Specific mRNA expressions were quantified using LightCycler Fast Start DNA Master SYBR Green I (Roche). Roche LightCycler software (LightCycler 480 Software Release 1.5.0) was used to perform advanced analysis of relative quantification using the 2^(−ΔΔCt) method. Relative gene expressions were given as ×-fold expression of the used housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences for SREBP-1c: forward: 5′TGCTGGACCGCTCCCGCCTG3′, reverse: 5′CTGCTCTCTGCCTCCAGCAT3′, FAS: forward: 5′ATCTGGGCTGTCCTGCCT3′, reverse: 5′GATATAATCCTTCTGAGCAG3′, GAPDH: forward: 5′GGCATTGCTCTCAATGACAA3′, reverse: 5′TGTGAGGGAGATGCTCAGTG3′.

To quantify the MVs in aorta tissues, the Mircovesicle Assay Kit (#521096, HYPHEN BioMed Company, France) was used according to the manufacturer’s instruction. Aorta tissues were homogenized in a homogenizer using cold normal saline at 4 °C. Then, the homogenates were centrifuged. Aliquots of the supernatants were used for the quantification of MVs. Optical density was measured using the scanning full wavelength spectrophotometer (Thermo, Mk-3, USA).

The data were presented as the mean ± SD. Statistical analyses were performed by using Students t test for comparison of two groups and analysis of variance for comparison of multiple groups. A value of P < 0.05 was considered to be significant. SPSS 18.0 statistical soft was used for the data analyses.

During the phase of the experiment, the rats given HFD/STZ displayed increased chow intake, water intake, urination and decreased activity. Moreover, the rats of diabetes group displayed a remarkable mounting of blood glucose level compared with the control group during the latter 12 weeks. However, the rats of liraglutide group exhibited the lower blood glucose level than that in the diabetes group rats. The diabetes group rats also displayed an increasing and then decreasing trend of body weight. Nevertheless, no significant intergroup difference in body weight was observed between diabetes group and liraglutide group. The diabetes group rats displayed significant increases of FINS, HOMA-IR, AST, ALT, BUN, TC and TG levels at the end point compared with the control rats, whereas the rats of liraglutide group displayed significantly lower levels of these parameters compared with the diabetes group. There were no significantly differences in Cr and HDL-C among three groups (Fig. 1).

HE staining displayed the apparent atherosclerotic plaques in the aorta tissues of diabetes group rats whereas the normal structure in the tissues of control rats. Moreover, there was the serious destroyed structure of aorta in the diabetes group, including exfoliation of endothelial cells, fracture of elastic fibers, hyperplasia of tunica intima and atrophy of tunica media, however, the slight destroyed changes of aorta histological structure in the rats of liraglutide group (Fig. 2a). There was a higher thickness ratio between tunica intima and tunica media in the diabetes group compared with the liraglutide group (Fig. 2b). Taken together, these data showed that liraglutide played a role in preventing the progression of atherosclerotic plaques.

Compared with the diabetes group, immunohistochemistry staining showed there was a remarkable decreasing of CD68 positive cells and TUNEL positive cells in the atherosclerotic plaques in the liraglutide group (Fig. 3a). The expression level of caspase-3 tested by western blot in the liraglutide group was obviously lower than that in the diabetes group (Fig. 3b). Moreover, there were significantly fewer MVs in the aorta tissues of liraglutide group than that in the diabetes group (Fig. 3c).

The rats of liraglutide group displayed relatively lower expressions of CHOP and GRP78 which were the marker proteins of ER stress (Fig. 4a, b). Moreover, SREBP-1c and FAS were important relative factors of lipid metabolism. There were dramatic downregulations of FAS mRNA and SREBP-1c in the liraglutide group compared with the diabetes group (Fig. 4c, d).