LMO3 promotes hepatocellular carcinoma invasion, metastasis and anoikis inhibition by directly interacting with LATS1 and suppressing Hippo signaling

Human HCC cell lines, including HCCLM3, HepG2, Huh-7, MHCC-97H, MHCC-97 L, SK-Hep1, SMMC-7721, SNU-423 and SNU-449 were purchased from Cell Bank of the Chinese Academy of Sciences. Dulbecco’s modified Eagle’s medium (DMEM) contained 10% (v/v) fetal calf serum (FCS) and 1% antibiotics was used. Cells were incubated at 37 °C in a humidified incubator under 5% CO₂ condition.

Clinical human HCC (16 cases) and corresponding non-cancerous liver (CNL) tissues (12 cases), in which 12 cases were paired, were obtained from Shanghai University of Traditional Chinese Medicine Affiliated Shuguang Hospital. Additionally, Human tissue microarray contained 180 cases of HCC samples was bought from Alenabio.

All human samples were obtained with informed consent. The protocols were approved by the ethical review committee of the World Health Organization Collaborating Center for Research in Human Production (authorized by the Shanghai Municipal Government).

Total RNA was extracted by Trizol (Takara), and reversely transcribed by PrimeScript RT-PCR kit (Perfect Real Time). Quantitative real-time PCR analyses were performed by SYBR Premix Ex Taq (Takara) on a 7500 real-time PCR system (Applied Biosystems), with recommended thermal cycling settings: one initial cycle at 95 °C for 30 s followed by 40 cycles of 5 s at 95 °C and 31 s at 60 °C. Primer sequences used for human LMO3, CTGF, ANKRD1 and CYR61 detection were shown in Additional file 1: Table S1.

All tissue samples were fixed in phosphate-buffered neutral formalin, embedded in paraffin, and cut into 5 μm thick sections. The sections were deparaffinized and rehydrated, incubated with 0.3% hydrogen peroxide/phosphate-buffered saline for 30 min, and blocked with 10% BSA (Sangon). The antibody for LMO3 (Abcam) was used to incubate the slides at 4 °C overnight with optimal dilution. HRP (rabbit) second antibody (Huabio) was used to incubate above slides at room temperature for 1 h. The slides were labeled with DAB substrate liquid (Thermo Scientific) and counterstained by hematoxylin. All the sections were photographed with a microscope (Carl Zeiss). Scoring was designated according to the ratio and intensity of positive-staining cells: 0–5% scored 0; 6–40% scored 1; 41–70% scored 2; more than 70% scored 3. The final score was defined as low or high expression group as follows: score 0–1, low expression, score 2–3, high expression. All scores were determined independently by more than two senior pathologists in a blinded manner.

Cells were lysed in lysis buffer. Then the proteins were separated by SDS-PAGE under reducing condition. The membranes were blocked in phosphate-buffered saline/Tween-20 containing 5% BSA, then incubated by the antibodies for LMO3 (Abcam), phospho-YAP (Cell Signaling), total-YAP (Cell Signaling), phospho-LATS1 (Cell Signaling), total-LATS1 (Cell Signaling), GAPDH (Huabio) and species-specific secondary antibodies separately. The membranes were detected by Odyssey imaging system (LI-COR). GTPase pull-down assays were performed according to standard procedures as described [18].

Small interfering RNAs duplexes for LMO3 used in this study was produced by Genepharma. Transfection steps were performed according to the manufacture’s protocols. The sequences of siRNA were designed as: si-LMO3–1: F: GGACUACGAGGAAGGUUUAdTdT, R: UAAACCUUCCUCGUAGUCCdTdT; si-LMO3–2: F: GCUGCAACCGAAAGAUCAAdTdT, R: UUGAUCUUUCGGUUGCAGCdTdT. Further, shRNA sequence was designed as: sh-LMO3: F: GATCCGTACACTAAAGCTAATCTT ATCTTCCTGTCAGAATAAGATTAGCTTTAGTGTACTTTTTG, R: AATTCAAAAAGTACACTAAAGCTAATCTTATTCTGACAGGAAGATAAGATTAGCTTTAGTGTACG. The structure of pGreenPuro used for shRNA and vector construction was shown in Additional file 2: Figure S2.

Recombinant LMO3 (rLMO3) protein was purchased from Abnova. The inhibitor of Hippo (Verteporfin and Peptide 17) were purchased from Selleck.

MHCC-97H or SMMC-7721 cells were detached by 0.25% trypsin/0.01% EDTA in 1 × PBS and resuspended in serum-free DMEM medium. 2 × 10⁴ cells in 100 μl were added into matrigel (BD)-coated inserts (Millipore) seated on the 24-well plate. Then DMEM medium contained 5% FBS was added into the bottom chamber. After the cells were incubated at 37 °C for 48 h, filters were fixed and stained with 0.1% (w/v) Crystal Violet. Non-invading cells were removed firstly, and invading cells were counted under a microscope at a magnification of 400×. About 3 grids per field were counted. All of the experiments were repeated twice.

5 × 10⁵ MHCC-97H or SMMC-7721 cells were cultured on poly-HEMA treated 12-well plates at 37 °C for 48 h. Then the adherent cells were detached and harvested in complete DMEM medium and centrifuged at 1000 rpm/5 min. The cells were washed with 1 × PBS and incubated with 100 μl binding buffer containing 3.5 μl Annexin V and 3.5 μl propidium iodide (PI) at room temperature for 15 min. All of the cells were analyzed by flow cytometry (BD).

1 × 10⁶ MHCC-97H or SMMC-7721 cells were seeded into 6-well plates. 50 μM of Edu from Edu Apollo^® 488 In Vitro Flow Cytometry Kit (RiBoBio) was added into the plates 2 h before harvesting the cells. Cells were collected and centrifuged at 1000 rpm/5 min, and supernatant was removed. For fixation, 4% paraformaldehyde was added into the cells and incubated for 15 min, and washed once by 1 × PBS. Then cells were resuspended in Tris buffer saline with 0.5% Triton X-100 and incubated for 10 min, and washed again with 1 × PBS. Amounts of 500 μl staining solution with Apollo^® 488 fluorescent azide was added into cells, incubated for 10 min, and then rinsed twice with Tris buffer saline with 0.5% Triton X-100. All of the cells were analyzed by flow cytometry (BD).

2 × 10⁶ SMMC-7721 cells infected with sh-LMO3 or control, were detached and suspended in 30 μl serum-free DMEM/matrigel (1:1) for each BALB/c-nu/nu mouse. Through a 1 cm transverse incision in the upper abdomen under anesthesia, each mouse (6 weeks, male, 10 in each group) was orthotopically inoculated in the left hepatic lobe with a microsyringe. Meanwhile, 1 × 10⁶ SMMC-7721 cells infected with sh-LMO3 or control were injected intravenously into nude mice (6 in each group). Mice were sacrificed after 6 weeks. The livers and lungs were dissected, fixed with phosphate-buffered neutral formalin and prepared for standard histological examination. All of mice were manipulated and housed according to protocols approved by the Shanghai University of Traditional Chinese Medicine Animal Care Commission. All animals received humane care according to the criteria outlined in the “Guide for the Care and Use of Laboratory Animals” prepared by the National Academy of Sciences and published by the National Institutes of Health.

For intracellular immunoprecipitation, Huh-7 cell lysates transfected with HA-tagged LMO3 or vector control were subjected to immunoprecipitation with anti-HA monoclonal antibody (Millipore) or control IgG. Then the immunoblotting with anti-LATS1 or YAP antibodies was performed.

To investigate the expression level of LMO3 in HCC tissues, we collected 16 cases HCC and 12 cases CNL tissues. Through Quantitative real-time PCR, we found that the expression of LMO3 was significantly upregulated in HCC tissues (Fig. 1a). In 12 paired HCC and CNL tissues, the mRNA expression of LMO3 was found to be significantly upregulated in HCC tissues (Fig. 1b). Furthermore, in 5 paired HCC and CNL tissues, the protein expression of LMO3 was also found to be significantly upregulated in HCC tissues (Fig. 1c).

Then we used an HCC tissue microarray (n = 180) to detect the correlation between LMO3 expression and clinicopathological findings and patient prognoses (Additional file 3: Table S2). We found that the expression of LMO3 was upregulated in 75.40% HCC tissues (Fig. 1e). The upregulated LMO3 expression in HCC tissues was further confirmed by immunohistochemical staining (Fig. 1d). Also, we found that the expression of LMO3 was closely related to patient tumor encapsulation, thrombus, vascular invasion and TNM stage (Table 1). To investigate the relevance of LMO3 with HCC metastasis, we collected HCC, tumor thrombus, CNL and normal liver tissues from the same patients and detected LMO3 expression in these tissues. Through immunohistochemical staining and western blotting, we found that LMO3 expression was higher in the HCC and tumor thrombus tissues, and lower in the CNL and normal liver tissues (Fig. 1f, g). Additionally, we found that the high expression of LMO3 was positively correlated with poor overall patient survival (OS) (P = 0.019), while it was not correlated with patient disease-free survival (DFS) (P = 0.179) (Fig. 1h, i).

To investigate the biological functions of LMO3 in HCC, we detected the expression level of LMO3 in 9 HCC cell lines. As shown in Fig. 2a, we found that LMO3 had high expression levels in MHCC-97H and SMMC-7721 cells. Then we selected MHCC-97H and SMMC-7721 cells and knocked down LMO3 by using siRNA (labeled as si-LMO3–1 and si-LMO3–2). Through western blotting analyses, we found that LMO3 was successfully silenced in MHCC-97H (Fig. 2b) and SMMC-7721 cells (Fig. 2c).

Then we investigated the role of LMO3 in the invasion of HCC cells. By transwell matrigel invasion assay, it was found that knockdown of LMO3 suppressed the invasiveness of MHCC-97H and SMMC-7721 (Fig. 2d, e) cells after 48 h. Furthermore, through annexin V anoikis assay, we found that the knockdown of LMO3 promoted the anoikis of MHCC-97H and SMMC-7721 (Fig. 2f, g) cells after 48 h. Additionally, by Edu assay, we found that the proliferation of MHCC-97H and SMMC-7721 cells was not affected by LMO3 knockdown at 24-, 48- and 72-h time points respectively (Additional file 4: Figure S1a, b).

To further investigate the role of LMO3 in cancer progression in vivo, sh-LMO3 and control cells (SMMC-7721) were orthotopically injected into nude mice to assess intrahepatic metastases and intravenously transplanted to assess distant metastases. After 6 weeks, we found that the intrahepatic metastatic nodules in the sh-LMO3 group were obviously less than in the vehicle group (Fig. 3a, b). Mice survival in the LMO3-silenced group was significantly increased compared to the vehicle group (Fig. 3c). Histological staining of the liver tissues indicated that mice transplanted with sh-LMO3 cells had fewer intrahepatic metastatic nodules than those transplanted with control cells (Fig. 3d, e). Meanwhile, the pulmonary metastatic nodules in mice transplanted with sh-LMO3 cells were less than those transplanted with control cells (Fig. 3f, g).

We further investigated the underlying mechanism of LMO3 in HCC. Through western blotting analyses, we found that the Hippo signaling pathway played important roles in HCC invasion and metastasis. Interestingly, knockdown of LMO3 in MHCC-97H or SMMC-7721 cells significantly increased the phosphorylation of YAP. Furthermore, the phosphorylation of LATS1, a core component of the Hippo pathway, was also increased by silencing LMO3 (Fig. 4a, b). Then LMO3 knockdown and control MHCC-97H or SMMC-7721 cells were serum starved for 24 h. The activities of RhoA and Cdc42 were measured by pull-down assays. We found that RhoA and Cdc42 activities were suppressed by LMO3 knockdown. Rac1 activity had no obvious change in LMO3 knockdown and control MHCC-97H or SMMC-7721 cells (Fig. 4c, d).

We also detected the mRNA levels of canonical YAP target genes, including Connective Tissue Growth Factor (CTGF), Ankyrin Repeat Domain 1 (ANKRD1), and Cysteine Rich Angiogenic Inducer 61 (CYR61). It was found that CTGF, ANKRD1 and CYR61 mRNA or protein levels were significantly suppressed in LMO3-silenced MHCC-97H cells (Fig. 4e). These results suggested that the Hippo pathway was activated in LMO3-silenced HCC cells.

Co-immunoprecipitation experiments were performed to investigate whether LMO3 was directly associated with the components of the Hippo pathway. First, Huh-7 was transfected with HA-tagged LMO3 or vector control. We found that immunoprecipitates of LMO3 from Huh-7 cells contained LATS1, but no YAP (Fig. 5a). Furthermore, we added recombinant LMO3 (rLMO3) protein into Huh-7 cells, in which LMO3 had a low expression level. The results showed that the phosphorylation of YAP or LATS1 was significantly suppressed after treatment with rLMO3 protein (Fig. 5b, c). Additionally, RhoA and Cdc42 activities were increased by rLMO3 protein administration, while Rac1 activity had no obvious change (Fig. 5d, e).

Meanwhile, we also found that CTGF, ANKRD1 and CYR61 mRNA or protein levels were significantly increased in rLMO3 protein treated Huh-7 cells (Fig. 5f). Thus, we conclude that LMO3 interacts with LATS1, increases Rho GTPases activities and suppresses the Hippo signaling pathway.

By using Verteporfin (the inhibitor of YAP-TEAD) and Peptide 17 (YAP-TEAD inhibitor I, the inhibitor of YAP-TEAD), we further investigated the effects of LMO3 on HCC cell invasion and anoikis inhibition. rLMO3 protein was added into Huh-7 and SNU-423 cells, in which LMO3 had low expression levels. Then, Verteporfin and Peptide 17 were added after 2 h. We found that Verteporfin and Peptide 17 abrogated rLMO3 protein-induced Huh-7 or SNU-423 cell invasion (Fig. 6a, b). Meanwhile, the anoikis inhibition of Huh-7 or SNU-423 cells induced by rLMO3 protein was also abrogated by these inhibitors (Fig. 6c, d).

These results indicate that LMO3 promoted HCC cell invasion and anoikis inhibition by interacting with LATS1 and suppressing Hippo signaling (Fig. 6e).