LMW-PTP targeting potentiates the effects of drugs used in chronic lymphocytic leukemia therapy

CLL-derived B-cell line Mec-1 were cultured in Roswell Park Memorial Institute (RPMI) with 7.5% bovine calf serum (BCS). Peripheral blood samples were collected from 9 patients satisfying standard morphologic and immunophenotypic criteria for CLL. B cells from 10 buffy coats were used as healthy controls. At collection, patients had never received treatment. Primary B cells were purified by negative selection using RosetteSep B-cell enrichment Cocktail (StemCell Technologies, Vancouver, Canada) followed by density gradient centrifugation on Lympholite (Cedarlane Laboratories, The Netherlands).

Rabbit polyclonal anti-LMW-PTP antibodies were produced in Raugei laboratory, anti-actin antibodies were from Santa Cruz Biotechnology Inc. (Heidelberg Germany), anti-CXCR4 (C-X-C chemokine receptor type 4) polyclonal antibodies were from Sigma-Aldrich (St. Louis, MO, USA), anti-CXCR4 monoclonal antibodies were from Abnova (Aachen, Germany), anti-CD49d-PE antibodies used for VLA-4 detection were from BD. Secondary peroxidase-labeled antibodies were from Santa Cruz Biotechnology. Human CXCL12 (C-X-C motif chemokine 12), fibronectin (FN), fludarabine and morin were purchased from Sigma-Aldrich; ibrutinib from Selleckchem (Munich, Germany).

Cells were lysed on ice in 1× Laemli Buffer (0.5 mol/L Tris–HCl pH 6.8, 10% SDS, 20% glycerol, β-mercaptoethanol, 0.1% bromophenol blue), and samples were boiled for 10 min. Cell extracts were resolved by SDS-PAGE and transferred to PVDF membranes (Bio-Rad Laboratories Segrate Milan, Italy). Membranes were incubated overnight at 4 °C with the appropriate primary antibody. After washing in TPBS-Tween-20 (0.1%), membranes were incubated with the appropriate horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) for 1 h. Proteins were detected using Clarity Western ECL (Bio-Rad) by Amersham 6000 (GE Healthcare).

Mec-1 cells (1 × 105 cells/mL) were grown for 24 h and then transiently transfected with LMW-PTP siRNA (target sequence CCCATAGTGCACACTTGTATA), using the Hiperfect Transfection Reagent (Qiagen Italia, Milano, Italy) according to the manufacturer’s instructions. Briefly, the cells were transfected for 24 h with siRNA at a final concentration of 20 nmol/L. To test the specificity of LMW-PTP transfection, control cells were transfected with a scramble sequence (AllStars Negative Control siRNA; at a final concentration of 20 nmol/L; Qiagen) used as negative control. Immunoblotting assessed the efficiency of transfection.

Flow cytometry was carried out using a Guava Easy Cyte (Millipore) cytometer. Analysis of CXCR4 was carried out using fluorochrome-conjugated antibodies or isotype control used as negative control on cells fixed and permeabilized using the Cytofix/Cytoperm plus kit (BD). CXCR4 recycling following antibody-dependent downregulation was quantitated by flow cytometry as described [19]. Briefly, cells were incubated for 30 min on ice with CXCR4-specific antibodies, washed, shifted to 37 °C for 40 min, then subjected to acid stripping (time 0), and incubated for the indicated times at 37 °C. Receptor:antibodies complexes that had recycled to the cell surface were measured by labeling with fluorochrome-conjugated secondary antibodies.

Adhesion assays on FN-coated plates in the presence or absence of 100 ng/mL CXCL12 were performed as previously described [20]. Briefly, 48-well plates were coated o/n at 4 °C with 10 mg/mL FN, washed with PBS and incubated for 30 min at 37 °C with RPMI 1% bovine serum albumin (BSA). Then, 2 × 105 cells/well serum-starved Mec-1 cells were added. The plates were incubated at 37 °C for 10 min, then added with 100 ng/mL CXCL12 for further 10 min. Cells that had not adhered (recovered in medium and washes) were resuspended in 0.2 mL RPMI 7.5% BCS. Cells that remained adherent after 3 washes were recovered by 1-min incubation with trypsin/EDTA, immediately added with RPMI 7.5% BCS, washed and resuspended in 0.2 mL RPMI 7.5% BCS. Cells were counted by flow cytometry. The percentage of adherent cells was calculated as previously described [20]. Chemotaxis assays were carried out using 24-well transwell chambers with 5-µm pore polycarbonate membranes (Corning Life Sciences, Schiphol-Rijk, The Netherlands) as described [21]. Briefly, filters were soaked overnight in chemotaxis medium (RPMI 1% BSA). 500 µL of chemotaxis medium with or without 100 nM CXCL12 was placed in the lower chamber, and 100 µL of the cell suspension (5 × 105 cells/sample) in chemotaxis medium was placed in the upper chamber. Samples without chemokine were used as negative controls. After 3 h of incubation at 37 °C in humidified air with 5% CO₂, the upper chamber was emptied, filters were removed, and the cells in the lower chamber were counted by flow cytometry. The migration index was calculated by determining the ratio of migrated cells in treated versus untreated samples.

Total RNA was extracted from Mec-1 cells and retrotranscribed as previously described [22]. Two independent reverse transcription reactions were performed on each RNA sample. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in triplicate on each cDNA on 96-well optical PCR plates (Sarstedt) using SSo Fast EvaGreenR SuperMix (Bio-Rad) according to the manufacturer’s instructions and a CFX96 Real-Time system (Bio-Rad). After an initial denaturation for 3 min at 95 °C, denaturation in the subsequent 42 cycles was performed for 10 s at 95 °C, followed by 30 s of primer annealing at 60 °C. Results were processed and analyzed using CFX Manager Version 1.5 software (Bio-Rad). Transcript levels were normalized to HPRT1, used as a housekeeping gene. Primers used for amplification are listed in Additional file 1: Table S1.

All statistical analyses were performed with Microcal Origin 8, using Student t test; data, reported as the mean ± SD, were considered significant if p values ≤ 0.05.

LMW-PTP is overexpressed in several solid cancer types and its expression is related to tumour onset and progression [2, 23], but little is known about the LMW-PTP expression levels in human B cells [24]. We quantitated by immunoblot the expression levels of LMW-PTP in a variety of human B cell lines and we observed that LMW-PTP was expressed at high levels in some of them including the CLL-derived Mec-1 cell line (Additional file 1: Figure S1). Moreover, we assessed LMW-PTP protein levels in purified B lymphocytes from peripheral blood of healthy controls (HC) or CLL patients (B-CLL), in comparison with Mec-1 cells. As shown in Fig. 1a, LMW-PTP expression was strongly increased in CLL B cells compared with normal B cells, as well as in the CLL-derived cell line Mec-1, suggesting a relevant role for this phosphatase in CLL pathogenesis (**p ≤ 0.01). Interestingly, 24 h treatment of Mec-1 cells with 50 μM morin resulted in a strong decrease in LMW-PTP expression (Fig. 1b) compared to untreated control, that could be relevant for CLL disease progression and treatment (**p ≤ 0.01). The negative effect of morin on LMW-PTP protein expression is not specific for Mec-1 cells. It was indeed also observed in the lymphoblastoid cell line EBV-B (Additional file 1: Figure S2), which expresses LMW-PTP levels comparable to Mec-1 cells (Additional file 1: Figure S1).

Previous reports demonstrated that high levels of LMW-PTP were usually associated to aggressive cancer and induced resistance to chemotherapy, effects that could be strongly counteracted by LMW-PTP silencing [6, 7]. We first assessed the effectiveness of siRNA-mediated LMW-PTP knock-down (Additional file 1: Figure S3). We then assessed the effects of LMW-PTP silencing on Mec-1 cell viability, alone or in combination with fludarabine or ibrutinib, by Annexin V staining. As shown in Fig. 2, LMW-PTP silencing alone was able to strongly induce apoptosis of Mec-1 cells compared to untreated cells (nt) used as negative control, more than that observed when cells were treated with fludarabine (Fig. 2a) or ibrutinib (Fig. 2b) alone. Interestingly, the combination of fludarabine or ibrutinib treatment with LMW-PTP silencing induced significative higher levels of cell death (***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05). These data demonstrated that LMW-PTP silencing increases cell death alone and in combination with conventional drugs in Mec-1 cells.

Because of the fact that morin is known to induce apoptosis in different types of cancer cells [17, 25] and that morin treatment was able to downregulate the expression levels of LMW-PTP in Mec-1 cells (Fig. 1b), we tested the effect of morin alone or in combination with fludarabine or ibrutinib on Mec-1 cell viability. Morin alone did not enhance apoptosis of Mec-1 cells beyond the low basal levels, compared to “dmso” sample used as negative control (Fig. 3a, b). Interestingly, treatment of Mec-1 cells with 50 µM morin in combination with increasing concentrations of fludarabine (ranging from 0.35 to 35 µM, see Fig. 3a) or ibrutinib (ranging from 0.1 to 10 µM, see Fig. 3b) induced a significant increase in cell death compared to fludarabine or ibrutinib alone (***p ≤ 0.001, **p ≤ 0.01). Similar results were obtained treating Mec-1 cells with suboptimal concentrations of fludarabine (3.5 µM) or ibrutinib (0.1 µM) and increasing the concentration of morin, ranging from 0.5 µM to 10 µM (see Fig. 3c, d).

Taken together these data demonstrate that morin, by reducing the LMW-PTP expression, enhances the sensitivity of Mec-1 cells to pro-apoptotic drugs.

Morin amplifies the inhibitory effects of conventional drugs on B-cell adhesion and migration.

The stromal microenvironment has emerged as key player in CLL pathogenesis [26], exerting the double function of creating a proliferative niche for leukemic cells and protecting them from the action of conventional chemotherapeutic drugs. Homing to lymphoid organs is strongly potentiated in CLL B cells, thereby prolonging leukemic cell residency into these protective niches [27]. Integrins and chemokine receptors are both implicated in B-cell homing, by regulating adhesion to endothelial cells and transendothelial migration, respectively [28, 29]. B-cell adhesion is mainly regulated by the integrin Very Late Antigen-4 (VLA-4), which interacts with its ligands vascular cell adhesion molecule 1 (VCAM-1) and FN.

The effect of morin on leukemic cell adhesion was addressed treating Mec-1 cells with 0.1 μM ibrutinib or 3.5 μM fludarabine for 16 h and then adding or not 50 μM morin for 6 h at 37 °C. Cells were subsequently plated on immobilized FN in the presence or absence of CXCL12 and the proportion of cells that had adhered after a short incubation was determined by flow cytometry. Morin treatment alone negatively regulated CXCR4-dependent adhesion to FN compared to the untreated sample (nt) used as negative control, with an effect comparable to the treatment with the conventional drugs fludarabine and ibrutinib (Fig. 4a). Interestingly the combination of morin with either fludarabine or ibrutinib was more effective at inhibiting the ability of Mec-1 cells to adhere to FN compared with single agent treatments. Consistent with this finding, real time and cytofluorometric analysis for VLA-4 expression revealed a strong reduction of transcript and protein levels in Mec-1 cells treated with 0.1 μM ibrutinib or 3.5 μM fludarabine or 50 μM morin or the combination of morin with either fludarabine or ibrutinib for 24 h (Fig. 4b, c). Statistical significance is indicated (***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05).

The effect of morin treatment on B-cell chemotaxis was addressed in transwell migration assays, using CXCL12 as chemoattractants. CXCR4-dependent migration was impaired in morin treated Mec-1 cells compared with untreated cells used as negative control, as well as in Mec-1 cells treated with 0.1 μM ibrutinib or 3.5 μM fludarabine as single agents (Fig. 5a). The migratory potential was further inhibited when cells were treated with the combination of morin and fludarabine or ibrutinib (Fig. 5a). qRT-PCR and cytofluorometric analysis of CXCR4 expression in Mec-1 cells did not reveal any significant modulation in the transcript or protein levels following morin treatment alone or in combination with fludarabine or ibrutinib (Fig. 5b, c). The relative gene transcript abundance was determined using the ddCt method, relative to the untreated sample (nt). Statistical significance is indicated for panel a and d (***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05).

CXCR4 expression at the plasma membrane is dynamically regulated by its downmodulation in the presence of high ligand concentrations and its recycling when these decrease [30], and it was previously demonstrated that enhanced receptor recycling contributes to the increased surface CXCR4 levels on CLL cells and enhanced migratory responses [31]. Interestingly, here we showed that morin treatment strongly inhibited CXCR4 receptor recycling in Mec-1 cells, both as single agent or in combination with fludarabine or ibrutinib (Fig. 5d), accounting for the inhibitory effect observed on CXCR4-dependent migration (Fig. 5a). Hence, morin acts, alone or in combination with fludarabine or ibrutinib, as a negative regulator of both cell adhesion and CXCR4-dependent migration in Mec-1 cells by affecting VLA-4 expression levels and inhibiting CXCR4 receptor recycling, respectively.