Background
Liver fibrosis is a dynamic wound-healing response to the continuous action of various injury factors, including non-alcoholic steatohepatitis, alcohol abuse, biliary obstruction, hepatitis B and C, and several other etiologies [
1,
2]. It is characterized by excessive accumulation of extracellular matrix components and can eventually lead to cirrhosis and even hepatocellular carcinoma (HCC) [
2,
3]. Thus, it is clear that there is an urgent need to develop novel diagnostic and therapeutic strategies for early stage of liver fibrosis.
LSEC are highly specialized endothelial cells located between blood cells and hepatocyte, facilitating the steric transport of cargo from the sinusoidal space to the space of Disse and into the parenchyma [
4,
5]. Under physiological conditions, the vital characterizations of LSEC are fenestrated, absence of diaphragm, and lack of basement membrane. Meanwhile, it can serve to maintain HSC quiescence [
6] and have the potential to promote HC regeneration [
7]. Under fibrotic conditions, LSEC lose fenestrations and form a continuous basement membrane. This phenomenon is called “capillarization,” which precedes the activation of HSC and the onset of liver fibrosis, suggesting that it could be a preliminary step necessary for fibrogenesis [
8]. Therefore, targeting LSEC might be a therapeutic approach to reverse liver fibrosis. Noteworthy, the fenestrated LSECs is maintained by two pathways: the eNOS-sGC pathway and NO-independent pathway [
8]. It has been reported that the eNOS activity is impaired in LSEC of fibrotic liver, while sGC activator can rescue the eNOS activity and restore LSEC fenestration [
9]. Additionally, KLF2, a transcriptional factor, upregulates eNOS expression and is essential to maintain functional endothelial phenotype [
10,
11]. Furthermore, increasing KLF2 in cirrhotic animals improves LSEC phenotype, ameliorates the dysfunctional endothelium, reduces oxidative stress, and deactivates HSC, thereby turning into regression of cirrhosis [
11]. Hence, further understanding of the cellular and molecular mechanism of LSEC may contribute to the development of more effective treatments.
LncRNAs are transcripts longer than 200 nucleotides but without protein coding potential [
12]. Thus far, accumulating evidences demonstrated that lncRNAs participate in diverse physiological and pathological processes and play critical regulatory roles in human diseases [
13,
14]. LncRNA
Airn (Antisense Igf2r RNA) is an imprinted and paternal expressed gene, which is nuclear localized and highly unstable in the form of non-splicing 108 kb ncRNA, whereas the spliced
Airn isoforms are as stable as other RNAs and are exported into the cytoplasm [
15]. Furthermore, Hosen et al. demonstrated that
Airn silencing reduced translation of IGF2BP2 protein and caused less binding of IGF2BP2 to target genes involved in cell survival, thereby augmenting cell death and reducing cell migration in cardiomyocytic HL-1 cells [
16]. However, the role and the underlying mechanism of
Airn in the development of liver fibrosis remain largely unclear.
In the present study, we aimed to elucidate the role of Airn in liver fibrosis. The results showed that Airn was significantly upregulated in liver tissues and LSEC of CCl4-induced liver fibrosis mouse model. Moreover, the expression of AIRN in livers and serums of live fibrosis patients was remarkably increased compared with healthy controls. In vivo studies revealed that Airn over-expression alleviated liver fibrosis. Additionally, it demonstrated that Airn maintained LSEC differentiation in vivo and in vitro through the KLF2-eNOS-sGC pathway, thereby suppressing HSC activation and promoting HC proliferation. Altogether, our results indicated that Airn was a critical and novel regulator of LSEC in liver fibrosis.
Methods
Study population
Study population analysis was performed as described in the previous study [
17]. Briefly, 28 human fibrotic livers and 6 human healthy livers from patients with hepatic hemangioma were obtained from surgical resections without preoperative treatment at Tianjin Third Central Hospital (Tianjin, China). Hepatic fibrosis was scored (stages F0–F4) according to the METAVIR fibrosis staging system by three hepatopathologists blinded to the study protocol and stratified as normal liver (F0), mild fibrosis (F1–F2), and advanced fibrosis (F3–F4). In addition, we collected 47 serum samples from patients diagnosed as cirrhosis at Tianjin Third Central Hospital (Tianjin, China), and 30 matched blood donor volunteers recruited from the same hospital with no medical history. All subjects were of the same ethnicity. Clinical and pathological characteristics including age, gender, ALT, AST, ALB, GTT, and etiologies were recorded and summarized in Additional file
1: Table S1. The study has been approved by the local Ethical Committee of Tianjin Third Central Hospital (Tianjin, China). Written informed consent was obtained from each patient according to the policies of the committee. The study methodologies were conformed to the standards set by the Declaration of Helsinki.
Animal in vivo study
All the animal protocols were in accordance with the Guidelines for Animal Experiments of Tianjin Medical University Animal Care and Use Committee. Airn knockout (Airn-KO) C57BL/6N mice were generated by CRISPR/Cas9 system (Cyagen, Suzhou China). In brief, genomic DNA was extracted from the Airn-KO mice and was PCR amplified using the primers (F: 5′-AGACACATTTAGTTGGTGGTTGGTCG-3′, R: 5′-TCTTCCACACCCAGGTGGCTTT-3′, R: 5′-AGGAAGTAGGCTCATGGGAGGAG-3′). The product of 800 bp was used for the amplicon and the sequence was confirmed by Sanger sequencing. All wild type (WT) and Airn-KO mice were generated from Airn heterozygous mice, they were kept in a standard 12-h light–dark cycle under the specific pathogen-free conditions with free access to water and food. All liver fibrosis models were performed in male mice unless indicated. For CCl4-induced liver fibrosis model, twenty WT mice and twenty Airn-KO mice were randomly divided into four groups: WT mice intraperitoneally injected oil (WT, n = 10), WT mice intraperitoneally injected CCl4 (WT + CCl4, n = 10), Airn-KO mice intraperitoneally injected oil (Airn-KO, n = 10), and Airn-KO mice intraperitoneally injected CCl4 (Airn-KO + CCl4, n = 10). They were administered 5% CCl4 (v/v) (Sigma-Aldrich, St. Louis, MO, USA) dissolved in oil (0.3 ml/kg body weight) thrice per week for 6 weeks via intraperitoneal injection. For BDL-induced liver fibrosis model, forty WT mice and forty Airn-KO mice were randomly divided into four groups. WT mice were treated with sham operation (WT, n = 20), WT mice were treated with BDL (WT + BDL, n = 20), Airn-KO mice were treated with sham operation (Airn-KO, n = 20) and Airn-KO mice were treated with BDL (Airn-KO + BDL, n = 20). Eighteen days later, all mice were sacrificed under anesthesia with 3% sodium pentobarbital (45 mg/kg, ip). For over-expressed Airn model, adeno-associated virus (AAV8) vectors were used to over-express Airn in mice, and AAV8-GFP was used as a control. Thus, forty Balb/c mice were divided into four groups randomly: Mice were treated with oil in combination with injection of AAV8-GFP (AAV8-GFP, n = 10), CCl4 in combination with injection of AAV8-GFP (AAV8-GFP + CCl4, n = 10), oil in combination with injection of AAV8-Airn (AAV8-Airn, n = 10), and CCl4 in combination with injection of AAV8-Airn (AAV8-Airn + CCl4, n = 10). Mice in AAV8-GFP + CCl4 group and AAV8-Airn + CCl4 group were injected with AAV8-GFP and AAV8-Airn respectively via the tail vein 2 weeks after the first injection of CCl4, and administered 5% CCl4 (v/v) dissolved in oil (0.2 ml/kg body weight) thrice per week via intraperitoneal injection. AAV8-GFP and AAV8-Airn group animals were injected with an equivalent volume of oil. After treatment with CCl4 for 8 weeks, all mice were sacrificed under anesthesia with 3% sodium pentobarbital (45 mg/kg, ip).
Histology and immunohistochemistry
The immunohistochemistry was performed essentially as described previously [
18]. The slides were treated with primary antibody α-SMA (1:200, rabbit polyclonal, Abcam, ab5694), COL1α1 (1:200, rabbit polyclonal, Abcam, ab34710), CD31 (1:25, mouse monoclonal, ab9498), LAMININ (1:200, rabbit polyclonal, Abcam, ab11575), and PCNA (1:800, rabbit monoclonal, Cell Signaling Technology, #13110), overnight at 4 °C. The slides were incubated with secondary antibody (1:500) (HRP-conjugated anti-rabbit IgG), and the reaction products were visualized using diaminobenzidine (DAB) and monitored by microscopy.
Scanning electron microscopy
Briefly, livers were fixed with glutaraldehyde, postfixed with OsO4, dehydrated with graded alcohols, dried with hexamethyldisilazane, sputter-coated with gold, and examined using a Gemini 300 scanning electron microscope (Zeiss, Germany). Porosity (percentage of LSEC surface occupied by fenestrae) was measured in scanning electron microscopy (SEM) micrographs of cells.
Isolation and culture of primary HCs, HSCs, KCs, and LSECs
Primary mouse HSC and HC were isolated by pronase/collagenase perfusion digestion followed by density gradient centrifugation, as previously described [
17]. In brief, primary LSEC were isolated from the 8-week-old Balb/c mice by in situ perfusion with 30 ml SC1 solution and 30 ml 0.05% Collagenase IV solution sequentially. The cell suspension was centrifuged at 50
g for 4 min and then the supernatant was centrifuged at 500
g for 8 min at 4 °C. Pelleted cells were resuspended in 10 ml of 18% Nycodenz solution (Sigma-Aldrich, St. Louis, MO, USA); 6 ml of 12% Nycodenz solution, 6 ml of 8% Nycodenz, and 4 ml of DMEM were orderly loaded on the top of the cell suspension. The added gradient centrifugal liquid was centrifuged at 1450
g and 4 °C for 22 min without brake. LSECs were recovered from the interface between the 8 and 12% Nycodenz solutions, mixed with an equal volume of DMEM and centrifuged at 600
g for 6 min at 4 °C. Cells were resuspended and incubated with anti-CD146 magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany). Finally, LSEC were cultured in collagen IV-coated plates with LSEC medium, and cell viability was determined by the trypan blue exclusion method.
RNA pull-down
Airn was transcribed in vitro with T7 RNA polymerase (Thermo Scientific #K0441, MA, USA), and it was further treated with RNase-free DNase I to remove excess DNA. Next, the RNA was purified, biotin labeled (Thermo Scientific 20163, MA, USA), and attached with streptavidin agarose bead (Thermo Scientific 20164, MA, USA). Whole-cell lysates from freshly liver cell suspension were added to the labeled RNA according to the manuscript. The recruited proteins were subjected to western blot analysis.
Chromatin immunoprecipitation (ChIP)
ChIP assays were performed essentially as described previously [
18,
19]. Anti-EZH2 (rabbit polyclonal, Abcam, ab186006) and IgG were used to immunoprecipitated chromatin fragments. Finally, qRT-PCR assays were performed to analyze the precipitated chromatin DNA. The immunoprecipitated DNA was quantitated by qRT-PCR. The ChIP primer sequences were as follows: Klf2-pro 1(-272--120) (Forward) 5′-GCGCGCTAACTATGCTGTTG-3′ and Klf2- pro 1 (Reverse) 5′-CGGTATATAAGCCTGGCGGT-3′, Klf2-pro2 (-916--804) (Forward) 5′- GCTCCTTGGATGAGGC-TT-GT-3′ and Klf2-pro2 (Reverse) 5′-AGCATTAGGTTCAAGGCCCC-3′, Klf2- pro3 (-1299--1155) (Forward) 5′-TGTTTGCCTCCGGGGTTAAG-3′ and Klf2- pro3 (Reverse) 5′-GGGGGATGGGCACATCAAAT-3′, Gapdh intron (Forward) 5′-ATCCTGTAGGCCAGGTGATG-3′ and (Reverse) 5′-AGGCTCAAGGGCTTTTAAGG-3′. The data of ChIP was shown as a percentage relative to input DNA.
Plasmid constructs
The cDNA of full-length
Airn was sequentially amplified by PCR and ligated into the lentiviral shuttle pCCL.PPT.hPGK.IRES.eGFP/pre [
18] to generate the over-expression plasmid (LV-
Airn and the empty plasmid as the LV-Control). The cloning primer sequences were as follows: LV-
Airn BamHI Forward 5′- CGCGGATCCAATAATCTCCACCCCCTG-3′, LV-
Airn BamHI Reverse 5′- CGCGGATCCTTAAGACCCTGTTGAAATTT-3′. These plasmids were used to produce lentivirus in HEK-293T cells with the packaging plasmids. Infectious lentiviruses were harvested at 36 and 60 h after transfection and filtered through 0.45 μm PVDF filters for in vitro experiments. AAV8 vectors for capsid screening were produced by transfecting AAV-293 cells using polyethylenimine (PEI) with an AAV vector plasmid (pAAV.CMV.PI.EGFP.WPRE.Bg-h, addgene, #105530) and helper plasmid including pAAV2/8 (addgene, #112864) and pAdDeltaF6 (addgene, #112867). For in vivo experiments, AAV vectors were produced in large scale and purified through iodixanol gradient density centrifugation, and full AAV particles were collected from the 40–60% interface of iodixanol phase for in vivo experiments. Male mice at 6–8-week-old were injected by tail vein with 1×10
12 pfu/mouse genome copies of AAV8-GFP or AAV8-
Airn. The cloning primer sequences were as follows: AAV8-
Airn HindIII Forward 5′- CCCAAGCTTAATAATCTCCACCCCCTG-3′, AAV8-
Airn BamHI Reverse 5′- CGCGGATCCTTAAGACCCTGTTGAAATTT-3′.
Cell culture
The non-tumorigenic mouse hepatocyte cell line AML12 was cultured in DMEM with 10% fetal bovine serum (FBS, Gibco, Gaithersburg, MD, USA), 1 × insulin-transferrin-sodium selenite media supplement (ITS, Sigma-Aldrich), 40 ng/ml dexamethasone, 100 U/ml penicillin, and 100 μg/ml streptomycin. The cell line HEK293T or AAV293 were maintained in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin, both cells were cultured in humidified air at 37 °C and 5% CO2.
Small interfering RNA (siRNA) transfection
Primary LSECs (1×106/well) were seeded in collagen-coated 6-well plates and transfected with siAirns and siRNA-Control for 48 h; RNA and protein of cells were harvested and isolated. siAirns and siRNA-Control were gained from GenePharma, and the sequences are as follows: siAirn-1 (mouse), sense 5′-CCAGUUACCACGCAGACAUTT-3′ and antisense 5′-AUGUCUGCGUGGUAACUGGTT-3′, siAirn-2 (mouse), sense 5′- CCGUCACCAUGUGUCCUUUTT-3′ and antisense 5′- AAAGGACACAUGGUGACGGTT-3′, siAirn-3 (mouse), GCAGCUCUCAUCUGUGUUATT-3′ sense 5′- and antisense 5′- UAACACAGAUGAGAGCUGCTT-3′, NC (mouse), sense 5′-UUCUCCGAACGUGUCACGUTT-3′, and anti-sense 5′-ACGUGACACGUUCGGAGAATT-3′.
Nuclear-cytoplasmic fractionation
Cytoplasmic and nuclear RNA and protein isolation were performed with PARIS™ Kit (Invitrogen, Grand Island, NY, USA), following the manufacturer’s instruction and were performed essentially, as described previously [
18].
RNA-seq and computational analysis
Briefly, primary LSECs infected with two separated siAirn were lysed with Trizol reagent. Total RNA was qualified and quantified using a Nano Drop and Agilent 2100 bioanalyzer (Thermo Fisher Scientific, MA, USA). The library was amplified with phi29 to make DNA nanoball (DNB) which had more than 300 copies of one molecule, DNBs were loaded into the patterned nanoarray, and single-end 50 bases reads were generated on BGIseq500 platform (BGI-Shenzhen, China). The threshold we used to screen up- or downregulated mRNAs was fold change >1.4 and p<0.05. The transcriptome sequencing data have been deposited in NCBI Gene Expression Omnibus (GEO) under the following accession number: GSE174175.
Fluorescence in situ hybridization (FISH)
Airn probes were synthesized by GenePharma Technology (Shanghai, China). FISH was performed using a FISH Kit (GenePharma) according to the manufacturer’s instructions. Nuclei were stained with DAPI. Images were acquired on a Zeiss confocal microscope LSM700. The sequences of FISH probe were as follows: probe1: 5′- TATAATGTTGAAGCCTCGGC-3′, probe 2: 5′-CAGGATGTCTGCGTGGTAAC-3′, probe 3: 5′-ATTTCTAAGGTGGTTTCCGA -3′, probe 4: 5′-TCTGTAGTTTTCTAATGGCC-3′, probe 5: 5′-CTGGGGAAAGAAGTGTGTCT-3′, probe 6: 5′-TTTTTTTAAGACCCTGTTGA-3′.
Western blot analysis
Cells were lysed with cell lysis buffer (Cell Signaling Technology) supplemented with protease inhibitor cocktail, 1% PMSF, and 1% phosphatase inhibitor. Protein concentrations were measured by the BCATM Protein Assay Kit (Bio-Rad Laboratories, Hercules, CA, USA) using BSA as standard. Appropriate amount of protein samples (40 μg for liver tissues; 25–50 μg for cells) along with 4× loading buffer and ddH2O were boiled for 4 min and then subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Following by electrophoresis, the separated proteins were blotted onto polyvinylidene fluoride (PVDF) membranes in transfer buffer with constant current of 300 mA for 3 h at 4 °C. Then the PVDF membranes were sequentially washed with TBST containing 0.2% Tween-20, blocked with 5% nonfat milk in TBST and incubated with the interested primary antibodies diluted in TBST containing 0.2% Tween-20 overnight at 4 °C. Antibodies used for immunoblotting included VEGFR2 (1:1000, rabbit monoclonal, Cell Signaling Technology, #9698), eNOS (1:1000, mouse monoclonal, Abcam, ab76198), VE-Cadherin (1:1000, rabbit polyclonal, Abcam, ab33168), PCNA (1:1000, rabbit monoclonal, Cell Signaling Technology, #13110), α-SMA (1:1000, rabbit polyclonal, Abcam, ab5694), COL1α1 (1:1000, rabbit polyclonal, Abcam, ab34710), MMP2 (1:1000, rabbit monoclonal, Abcam, ab92536), TIMP1 (1:1000, mouse monoclonal, Santa Cruz, sc-21734), KLF2 (1:1000, mouse polyclonal, Santa Cruz, sc-166238). GAPDH were severed as control for total protein amount. Then, all of membranes were incubated with the HRP-conjugated secondary antibody for 1 h at room temperature. Every experiment was repeated at least three times independently.
Confocal microscopy
Immunofluorescence analysis was performed as described previously [
20]. Antibodies used for confocal microscopy included VEGFR2 (1:200, rabbit monoclonal, Cell Signaling Technology, #9698), VE-Cadherin (1:200, rabbit polyclonal, Abcam, ab33168), F4/80 (1:50, rabbit monoclonal, Abcam, ab16911), α-SMA (1:200, rabbit polyclonal, Abcam, ab5694), COL1α1 (1:200, rabbit polyclonal, Abcam, ab34710), Ki67 (1:200, rabbit monoclonal, Abcam, ab16667), PCNA (1:800, rabbit monoclonal, Cell Signaling Technology, #13110), and KLF2 (1:50, mouse polyclonal, Santa Cruz, sc-166238). Cells were incubated with FITC-conjugated secondary antibodies (Thermo Fisher Scientific, HRP-conjugated anti-rabbit IgG or anti-mouse IgG, Alexa Fluor 594) in a dark environment at room temperature for 1 h. Next, cells away from light were stained with DAPI (Sigma, USA) for 20 min. Finally, the slides were mounted with an anti-fade mounting medium and were observed with a Zeiss confocal microscope LSM700.
Quantitative real-time polymerase chain reaction
qRT-PCR analysis was performed as described previously [
17]. The sequences of primers are listed as follows.
Gene symbol | Forward 5′–3′ | Reverse 5′–3′ |
Gapdh (mouse) | GGCATGGACTGTGGTCATGAG | TGCACCACCAACTGCTTAGC |
β-Actin (mouse) | ATGCCACAGGATTCCATACCCAA | CTCTAGACTTCGAGCAGGAGATGG |
Airn NR_002853.2 | AAGCACAGCACCGCCAGT | CCATGTCCTTTCTTTTCCACTACC |
Airn NR_027772.1 | AAGCACAGCACCGCCAGT | CAAAGGTGCTTGCCTCCAA |
Airn NR_027773.1 | AAGCACAGCACCGCCAGT | CAGGACCTCAAGTCAGGAACCT |
Airn NR_027784.1 | AAGCACAGCACCGCCAGT | AGGCCTTTGTTCACATCTCTTCA |
eNos (mouse) | GGCAACTTGAAGAGTGTGGG | CTGAGGGTGTCGTAGGTGATG |
Vegfr2 (mouse) | TTTGGCAAATACAACCCTTCAG | GCAGAAGATACTGTCACCACC |
VE-cadherin (mouse) | CAGCACACTAGCCTGGTGTTA | CGCCCATGATTCTGCATGTAGA |
Lyve-1 (mouse) | CAGCACACTAGCCTGGTGTTA | CGCCCATGATTCTGCATGTAGA |
Cd31 (mouse) | ACCGGGTGCTGTTCTATAAGG | TCACCTCGTACTCAATCGTGG |
Et-1 (mouse) | CACCGTCCTCTTCGTTTTGC | GGCTCTGCACTCCATTCTCA |
Laminin (mouse) | GAAAGGAAGACCCGAAGAAAA | CCATAGGGCTAGGACACCAAA |
Hgf (mouse) | GCGAATTGGTGTTCTGCCTG | GAGATGCCGGGCTGAAAGAA |
Wnt2a (mouse) | CTCGGTGGAATCTGGCTCTG | CACATTGTCACACATCACCCT |
Angpt2 (mouse) | AGAAGAGCAAACCACCTTCAG | GTCACAGTAGGCCTTGATCTCC |
Col1α1 (mouse) | ATCGGTCATGCTCTCTCCAAACA | ACTGCAACATGGAGACAGGTCAGA |
α-SMA (mouse) | TCGGATACTTCAGCGTCAGGA | GTCCCAGACATCAGGGAGTAA |
Mmp2 (mouse) | GTGTTCTTCGCAGGGAATGAG | GATGCTTCCAAACTTCACGCT |
Pcna (mouse) | TTTGAGGCACGCCTGATCC | GGAGACGTGAGACGAGTCCAT |
Ki67 (mouse) | CATCCATCAGCCGGAGTCA | TGTTTCGCAACTTTCGTTTGTG |
F4/80 (mouse) | TGACTCACCTTGTGGTCCTAA | CTTCCCAGAATCCAGTCTTT CC |
Cd11b (mouse) | TCCTGTACCACTCATTGTGG | GGGCAGCTTCATTCATCATG |
GAPDH (human) | ACCCAGAAGACTGTGGATGG | TTCAGCTCAGGGATGACCTT |
β-ACTIN (human) | GCCGGGACCTGACTGACTAC | TTCTCCTTAATGTCACGCACGAT |
AIRN NR_047514.1 | GGAAAAGGGATGCGGTGTTT | CCTTTTCAGGACGTGACCCG |
AIRN NR_047511.1 | AACTTTTGCCCAGTCGGCTC | CCATGGCAGCTTGGTTTCAG |
Cell Counting Kit-8 (CCK-8) assay
Cell Counting Kit-8 (CCK-8) assay CCK-8 assay was carried out for detection of cell proliferation in AML12 cells. AML12 cells were inoculated in 96-well plates with 2×103 cells per well. Absorbance at 450 nm was recorded at specified time points using the CCK-8 kit, based on which the viability curve was plotted.
5-Ethynyl-2’- deoxyuridine (EdU) assay
Cells were inoculated in 24-well plates (104 cells/ well) and labeled with 10 μmol/L EdU at 37 °C for 2 h. After 15 min fixation in 4% paraformaldehyde, cells were incubated with phosphate buffered saline (PBS) containing 0.3% Triton-100 for 15 min. After washing with PBS, 125 μL of dying solution was applied per well and incubated in dark for 30 min. The nucleus was stained with 1×Hoechst 33342 for 10 min. EdU-positive cells, Hoechst-labeled nucleus, and merged ones were captured under a microscope.
Statistical analysis
Data were expressed as mean ± SD. All the statistical analyses were performed with the SPSS 13.0 (IBM, Armonk, NY, USA). Statistical analyses were performed using either Student’s t test (two-group comparison) or one-way analysis of variance (more than two groups) followed by post hoc comparison, and differences with p<0.05 were considered significantly.
Discussion
Liver fibrosis represents the consequence of a sustained healing response originating from chronic injury. It is characterized by excessive accumulation of extracellular matrix components and can eventually lead to cirrhosis [
2,
29]. Angiogenesis with an abnormal angioarchitecture is a hallmark related to liver fibrogenesis, which implicates a potential target for therapeutic interventions [
30]. However, the occurrence of angiogenesis in liver fibrosis remains controversial. For instance, Taura et al. demonstrated that CD31, a marker for endothelial cells, was increased as fibrosis developed [
31]. Moreover, Lao et al. investigated the expression of VEGF was continuously increased during sustained damage for CCl
4, suggesting that liver fibrosis is accompanied by increased vascular density [
32]. However, Liu et al. suggested that angiogenesis increased sharply at the early stage of liver fibrosis, while gradually diminished along with the formation of insoluble scars in late-stage fibrotic livers [
30]. In this study, we also found that the expression of angiogenesis markers CD34 and CD31 in human and mouse fibrotic livers were significantly increased in mild fibrosis and drastically reduced in advanced fibrosis (Additional file
1: Fig. S13A, B). Moreover, our study revealed that the role of
Airn in LSEC is to repress capillarization and might be stimulated to over-express to inhibit CD34 and CD31, maintaining the differentiation. This could explain the result that
Airn expression levels was significantly upregulated in mild fibrotic liver samples but not in advanced fibrotic liver tissues. All these data supported our conclusion that
Airn played an important role in the angiogenesis in liver fibrosis.
LSEC are the most numerous non-parenchymal cells in the liver; therefore, they are destined to play an irreplaceable role in various liver diseases. Capillarized LSEC have been shown to precede fibrosis and promote HSC activation and hepatocyte damage [
8]. Furthermore, LSEC are important for acting as autocrine and paracrine source for signals of liver fibrosis [
33]. It has been reported that LSEC secrete Wnt2 and HGF and promote hepatocyte proliferation and liver regeneration [
7]. Moreover, differentiated LSEC can maintain HSC quiescence by producing NO [
6], HB-EGF [
34], and SK1 [
35], while capillarized LSEC lose their capacity to inactivate HSC by secreting EIIA-fibronectin [
36], PDGF, TGF-β [
37], TNF-α, and IL1 [
32], thus promoting fibrogenesis. Therefore, targeting LSEC has great therapeutic prospect for liver fibrosis. In the current study, we confirmed that
Airn deficiency aggravated CCl
4- and BDL-induced LSEC capillarization, while over-expression of
Airn alleviated CCl
4-induced LSEC capillarization in vivo
. Moreover, over-expression of
Airn remarkably enhanced the expression of VEGFR2, eNOS, and LYVE-1; meanwhile, it significantly suppressed the expression of LAMININ and ANGPT2 in primary LSEC in vitro. Further study indicated that
Airn inhibits HSC activation indirectly by regulating LSEC differentiation and promoting HC proliferation directly and indirectly by the increased paracrine secretion of Wnt2a and HGF from LSEC, providing the proof that
Airn plays a vital role in the orchestration of LSEC/HSC/HC interaction during liver fibrosis and
Airn repressed liver fibrosis mainly via inhibiting LSEC capillarization. In addition, VE-cadherin (CD144) is an endothelial specific adhesion molecule locating at endothelial cell junctions and plays a role for paracellular permeability and maintenance of cell polarity [
38]. Cyrill et al. revealed that capillarization was characterized by ectopic basement membrane deposition, formation of a continuous EC layer, and increased expression of VE-cadherin [
39]. However, Alessio et al. revealed VE-cadherin expression was reduced by inhibitors of NOS [
40]. It has been also reported that VE-cadherin could inhibit proliferation in part by altering cytoskeletal structure and decreasing cell spreading [
41]. Interestingly, in our study, the results demonstrated that knockdown of
Airn significantly reduced VE-cadherin expression, and over-expression of
Airn remarkably enhanced the expression of VE-cadherin. However, the mechanism by which
Airn regulate VE-cadherin still needs further investigation.
Currently, a mechanism discovered to date is that lncRNA could serve as molecular scaffold and recruit proteins or RNAs to target genes, thereby exerting biological functions. It has been reported that about 20% of lncRNAs, such as HEIH, XIST, KCNQ1OT1, and HOTAIR, expressed in various cell types are bound by PRC2, suggesting that these lncRNAs may have a general role in recruiting PRC2 to their target genes [
42]. Emerging evidence suggests lncRNAs could bind to PRC2 and directly regulate the expression of specific genes, for instance, LINC00673 repressed LATS2 expression by recruiting PRC2 to the promoter, subsequently promoting gastric cancer development and progression [
27], and lncRNA GHET1 could epigenetically repress transcription of KLF2 by recruiting PRC2 to KLF2 promoter in hepatocellular carcinoma cells [
28]. In addition, lncRNAs can also act as endogenous competing RNAs to regulate gene expression, for example, SCARNA10 interacted with PRC2 and blocked PRC2-mediated repression of pro-fibrogenic genes expression [
19]. Lethe interacts with NF-κB subunit RelA to inhibit RelA DNA binding and target gene activation [
43].
Airn may use the same mechanism as SCARNA10 and Lethe do to promote the expression of KLF2, functioning as a decoy lncRNA. In this article, the results showed that
Airn physically interacts with EZH2, thus promoting the expression of LSEC differentiation and capillarization related genes. The mechanism could be that
Airn bound to PRC2 competitively, thus blocking the PRC2 binding sites with the target genes and releasing PRC2 inhibition of KLF2 and LSEC differentiation related genes.
Conclusions
In conclusion, we identified that
Airn was increased in human and mice fibrotic livers and revealed that
Airn deficiency aggravated CCl
4- and BDL-induced liver fibrosis in vivo. Over-expression of
Airn suppressed CCl
4-induced liver fibrosis in vivo. Additionally,
Airn maintained LSEC differentiation in vivo and in vitro. Furthermore,
Airn inhibited HSC activation indirectly and promoted HC proliferation by paracrine secretion of Wnt2a and HGF from LSEC. Mechanistically, the results demonstrated that
Airn interacted with EZH2 to maintain LSEC differentiation through KLF2-eNOS-sGC pathway, thereby promoting HSC quiescence and HC proliferation (Additional file
1: Fig. S14). Our work identified that
Airn was beneficial to liver fibrosis by maintaining LSEC differentiation and might be a serum biomarker for liver fibrogenesis.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.