Background
Sepsis is a life-threatening condition caused by an excessive immune response to pathogen-induced infections [
1]. It has become one of the leading predisposing clinical factors associated with the incidence of acute lung injury (ALI), a severe syndrome comprising a wide variety of acute respiratory failure disorders [
2]. During the progression of sepsis-induced ALI, the upregulation of inflammatory and apoptotic pathways lead to the disruption of alveolar epithelial cells, the increase of epithelial permeability and the influx of edema fluid into the alveolar space [
3]. It has been reported that persistently increased plasma levels of proinflammatory cytokines, such as TNF-α and interleukin (IL)-6, were highly predicative of mortality in patients with ALI [
4,
5]. One study also showed that the increase of pro-apoptotic proteins, such as Bcl-2-associated X protein (Bax), favored the extensive apoptosis of alveolar epithelial cells and epithelial injury in ALI [
6]. These findings suggested that the strategies to modulate inflammatory and apoptotic pathways might provide new opportunities to ameliorate sepsis-induced ALI in humans.
Long noncoding RNAs (lncRNAs) are a class of endogenous RNAs longer than 200 nucleotides and lack of protein-coding capabilities [
7]. Emerging evidence has shown that they play key regulatory and functional roles in disease-associated gene transcription and chromatin modification [
8]. Many lncRNAs have been identified to enhance or suppress inflammatory responses via regulating the expression of inflammatory mediators [
9]. For instance, lncRNA E330013P06 contributed to a diabetes-induced proinflammatory phenotype via upregulating the level of proinflammatory genes and the formation of foam cells in macrophages [
10]. LncRNA NKILA protected endothelial cells from inflammation by promoting the expression of kruppel like factor 4 and attenuating the transcriptional activity of nuclear factor kappa B [
11]. Taurine up-regulated gene 1 (TUG1) is the lncRNA which was first detected in taurine-treated mouse retinal cells [
12]. The downregulation of TUG1 has been demonstrated to inhibit cell proliferation in osteosarcoma and urothelial carcinoma cells [
13,
14]. Knockdown of TUG1 in small cell lung cancer cells increased apoptosis and cell cycle arrest by regulating the expression of its target gene LIMK2b [
15]. It was also shown that the overexpression of TUG1 alleviated cold-induced liver damage in mice via attenuating hepatocyte apoptosis and inflammation [
16]. However, it remains unclear whether TUG1 has a regulatory role in sepsis-induced ALI.
In this study, we aimed to investigate the expression and regulation role of TUG1 in sepsis-induced ALI using a murine septic model and an in vitro cell culture model induced by lipopolysaccharide (LPS) stimulation. Further bioinformatic prediction analysis showed that miR-34b-5p was a potential downstream target of TUG1. The correlation between TUG1 level of miR-34b-5p were also examined. These findings suggested that TUG1 might be involved in the pathogenesis of sepsis-induced ALI via mediating the expression of its downstream target.
Methods
Mouse model of CLP-induced sepsis
Forty-eight adult male C57BL/6 mice (Charles River Laboratories, Beijing, China) were housed in a controlled environment with 12-h light-dark cycle, a temperature of 22–24 °C and a humidity of 60%. Mice were given ad libitum access to food and water. All experiments in this study were approved by the Animal Care and Use Committee of Guizhou Provincial People’s Hospital and performed in accordance with the Guide for the Care and Use of Laboratory Animals [
17]. After one-week acclimatization, mice were randomly assigned into 4 groups: sham, CLP, CLP + Ad-GFP, and CLP + Ad-TUG1 (
n = 12 per group). To establish the mouse model of sepsis-induced ALI, thirty-six mice underwent cecal ligation and puncture (CLP) surgery [
18,
19]. Briefly, animals were anesthetized by intraperitoneal injection of 10% chloral hydrate (3 mL/kg, Sigma-Aldrich, St. Louis, USA) and fixed in supine position on the operating Table. A 0.4-cm longitudinal midline incision was made on the abdomen to expose the cecum. Then the exposed cecum was ligated at 1 cm from the tip using 3–0 silk sutures and perforated once by a 20-gauge needle at 0.5 cm distal from the ligation. After gently squeezing the cecum to extrude a small amount of feces, the bowel was repositioned in the abdominal cavity. Then the abdominal musculature, peritoneum and skin were closed. Mice received subcutaneous injection of normal saline immediately following the surgery for fluid resuscitation. Sham-operated group underwent the same surgical procedure except for the ligation or puncture of the cecum. After CLP procedure, mice were monitored for survival. The mouse lung tissues were harvested immediately after death or euthanasia by sodium pentobarbital (10 mg/kg intraperitoneal body weight) at the end of the study.
Preparation and delivery of adenoviral vectors in vivo
Adenoviral vectors containing the enhanced green fluorescent protein gene were purchased from Life Technologies (Shanghai, China). The TUG1 cDNA (or a negative control) was transferred to the Ad-TUG1 (or Ad-GFP) vector using Gateway™ LR Clonase II Enzyme Mix (Invitrogen, Carlsbad, USA) as previously described [
20]. Then 20 μL of adenovirus solution (10
7 particles/μL) were intravenously injected via the tail vein into designated group 1 week before the CLP operation.
Histological analyses
The lung tissues of all mice were harvested immediately after death or at the end of the study (3-day post-operation). The same portion of the lung samples were used for histopathological examination. Paraffin-embedded tissues were cut into 5 μm sections, stained with hematoxylin and eosin (H&E), and observed under a light microscope (magnification 400×). The degree of lung injury was evaluated using the lung injury scoring as previously described [
21]. Five randomly selected fields were scored per slide. To detect cell apoptosis, tissue sections were stained with TUNEL reagent (Roche, Basel, Switzerland) according to the manufacturer’s instructions and observed using a fluorescence microscope (magnification 400×). Sectioned tissue samples were also stained for caspase-3 antibody (#ab13847, Abcam, Cambridge, UK) using immunohistochemistry method (magnification 400×). The percentage of positively stained cells was calculated in 6 randomly selected fields.
Patients samples
A total of 35 patients who were diagnosed with acute respiratory distress syndrome (ARDS) in our hospital were recruited and their blood samples were collected. The blood samples were also harvested from 68 healthy subjects. Each patient provided a written informed consent. All experimental protocols were approved by the Ethics Committee of the Guizhou Provincial People’s Hospital and performed following the World Medical Association Declaration of Helsinki [
22]. The serums from all the samples were prepared and the serum level of TUG1 was measured using an enzyme-linked immunosorbent assay (ELISA) kit (Novus Biologicals, Centennial, USA).
Cell culture and transfection
Primary murine pulmonary microvascular endothelial cells (PMVECs) were isolated and cultured in DMEM (Sigma-Aldrich) as previously described [
23]. The adenoviral vectors expressing TUG1 or a non-specific control sequence were synthesized as mentioned above. When reached 70–80% confluency, PMVECs were transfected with 1 μg adenoviral vector expressing TUG1 or control adenoviral vector for 48 h using ViraPower™ Adenoviral Expression System (Invitrogen) according to the manufacturer’s instructions. Twenty-four hours after transfection, PMVECs were stimulated with 100 ng/mL LPS (Sigma-Aldrich). Six hours following LPS treatment, PMVECs were fixed, stained with TUNEL and DAPI (Thermo Fisher Scientific, Waltham, USA) for the detection of apoptosis. DAPI stains cell nucleus, recognizing both apoptotic and non-apoptotic cells. The apoptotic cells were detected with dual TUNEL and DAPI staining. The number of TUNEL-positive cells were counted in six randomly selected fields per slide using a fluorescence microscope (magnification, × 200). The miR-34b-5p mimics and its corresponding control mimics (50 nM) were synthesized by GenePharm and transfected into PMVECs using Lipofectamine 2000 (Invitrogen). In rescue experiment, PMVECs were co-transfected with 1 μg adenoviral vector expressing TUG1 (or control adenoviral vector) and 50 nM miR-34b-5p mimics 24 h before LPS stimulation. PMVECs co-transfected with control adenoviral vector and control mimics were used as a control group.
Dual-luciferase reporter assay
TUG1 3′-UTR fragment containing the putative binding site of miR-34b-5p was amplified and cloned into the downstream of luciferase gene in the pmirGlo vector (GenePharm, Shanghai, China). The mutant TUG1 3′-UTR was used to construct TUG1-MUT vector. HEK-293 cells were co-transfected with miR-34b-5p mimics (or miR mimics) and TUG1-WT (or TUG1-MUT) at 70–80% confluency. The synthesized GAB1 3′-UTR sequence (Ribobio, Guangzhou, China) or a mutant sequence were cloned into pmirGlo vectors (GenePharm) to construct luciferase reporters GAB1-WT and GAB1-MUT. HEK-293 T cells were co-transfected with GAB1-WT (or GAB1-MUT, 500 ng total DNA) and miR-34b-5p mimics (or miR mimics, 500 ng total DNA) at 70–80% confluency. The luciferase activities were assessed 48 h post transfection using Dual-Luciferase Reporter Assay System (Promega Biotech Co., Madison, USA).
RNA immunoprecipitation (RIP) assay
The RIP assay was performed in PMVECs using mouse monoclonal anti-Argonaute2 (anti-Ago2) antibody (#SAB4200085, Sigma-Aldrich) as a positive control and an anti-IgG antibody (#R9255, Sigma-Aldrich) as a negative control using the Imprint® RNA Immunoprecipitation Kit (Sigma-Aldrich) as previously described [
24]. Briefly, PMVECs were harvested, centrifuged and resuspended in RIP lysis buffer. Cell lysates were incubated with anti-Ago2 or anti-IgG overnight at 4 °C. The 40 μL Protein A magnetic beads were added to get the immunoprecipitation complex. Total RNA was extracted using GenElute™ Total RNA Purification Kit (Sigma-Aldrich). The relative RNA enrichment of TUG1 and miR-34b-5p were analyzed by quantitative real-time PCR.
Quantitative real-time PCR (qRT-PCR)
Mouse lung tissue samples and PMVECs were harvested at the end of the study. Target miRNA was isolated from using mirVana™ miRNA Isolation Kit (Invitrogen). The reverse transcription of miR-34b-5p was performed using All-in-One™ miRNA RT-qPCR Detection Kit (GeneCopoeia Inc., Rockville, USA). Total RNAs were extracted using TRIzol LS Reagent (Invitrogen) and reverse transcribed to cDNA using ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. Target genes were amplified using 7300 Real-Time PCR System (Thermo Fisher Scientific). The expression of miR-34b-5p and mRNAs were normalized by U6 and β-actin, respectively. The sequences of the primers were: miR-34b-5p: CGAGGCAGTGTAATTAGCTGATTGT; U6 forward: CTCGCTTCGGCAGCACA, U6 reverse: AACGCTTCACGAATTTGCGT; TNF-α forward: GGGGCCACCACGCTCTTCTGTC, TNF-α reverse: TGGGCTACGGGCTTGTCACTCG; IL-1β forward: CCAGGATGAGGACCCAAGCA, IL-1β reverse: TCCCGACCATTGCTGTTTCC; IL-6 forward: TAGCCGCCCCACACAGACAG, IL-6 reverse: GGCTGGCATTTGTGGTTGGG; β-actin forward: ATCACTGCCACCCAGAAGAC, β-actin reverse: TTTCTAGACGGCAGGTCAGG.
Enzyme-linked immunosorbent assay (ELISA)
Total proteins extracted from the lung tissue homogenates and PMVECs lysates were analyzed for the levels of TNF-α, IL-1β, IL-6, IL-4 and IL-10 using ELISA kits followed the manufacturer’s instructions (MyBioSource Inc., San Diego, CA, USA). The absorbance at 450 nm was detected using a Power Wave Microplate Reader (Bio-TEK, USA).
Western blot
Total proteins isolated from homogenized mouse lung tissues and PMVECs lysates were prepared in RIPA buffer with protease inhibitors, and normalized by protein content using bicinchoninic acid assay (Pierce, Rockford, USA). Proteins at 40–80 μg were separated on a 10% SDS-PAGE gel under reducing conditions and then transferred to polyvinylidene fluoride (PVDF) membranes (MilliporeSigma, Burlington, USA). After blocking, PVDF membranes were incubated with designated primary antibodies (Abcam, Cambridge, UK) at 4 °C for 12 h: Bax (1:2000, #ab32503), B-cell lymphoma 2 (Bcl-2, 1:800, #ab59348), cleaved poly ADP ribose polymerase (cleaved PARP, 1:2000, #ab32064), cleaved caspase-3 (1:1000, #ab49822), GRB2 associated binding protein 1 (GAB1, 1:800, #ab59362), and β-catenin (1:2000, #ab32572). Then PVDF) membranes were incubated with goat anti-rabbit secondary antibody (1:2000, #ab6721) for 50 min. The density of the protein bands was quantified using Alphalmager™ 2000 Imaging System (Alpha Innotech, San Leandro, USA).
Statistical analysis
All experiments in this study were performed in triplicate and repeated three times. All data are shown as mean ± standard deviation. The statistical significance was analyzed using two-tailed Student’s t-test or one-way ANOVA (SPSS software, version 24.0, Chicago, USA). A value of p < 0.05 (indicated by * or #) was considered statistically significant. * p < 0.05, ** p < 0.01; # p < 0.05, ## p < 0.01. Survival data was analyzed using the Kaplan-Meier method. The linear correlation coefficient was used to estimate the correlation in TUG1 mRNA expression vs. miR-34b-5p level and miR-34b-5p level vs. GAB1 mRNA expression.
Discussion
Sepsis is a serious complication of infection characterized by dysregulated immune responses, microvascular thrombosis and subsequent multiple organ dysfunction, and has become a major etiology of ALI [
30]. During the progression of sepsis, the accumulation of endotoxin, inflammatory cytokines and thrombotic factors in the alveoli contributes to the pulmonary edema formation, neutrophil migration, and tissue damage in the lungs [
31]. It has been reported that patients with sepsis-induced ALI had higher organ dysfunction, illness severity, and in-hospital mortality rates compared to the ones with non-sepsis-induced ALI [
32]. Although the ventilatory management of ALI has a proven survival advantage, the investigations of potential therapeutic treatment prior to the progression of respiratory failure are currently underway [
33]. In the present study, we reported that lncRNA TUG1 ameliorated sepsis-induced ALI by the suppression of inflammatory responses and apoptotic activity, via targeting miR-34b-5p and GAB1. These data highlighted the potential therapeutic role of TUG1 in management of sepsis-induced ALI.
TUG1 is a spliced, polyadenylated lncRNA located at chromosome 22q12 [
12]. The regulatory roles of TUG1 in the pathogenesis of inflammation-related disorders and the potential underlying mechanisms have been widely discussed. The induction of TUG1 protected interstitial cells of Cajal from TNF-α-induced apoptosis and proinflammatory cytokines expression via downregulating miR-127 [
16]. A study in H9c2 cardiomyoblasts found that TUG1 induction alleviated LPS-induced cell injury, manifested by declined apoptosis rate, decreased secretion of pro-apoptotic factors and inflammatory cytokines, by inhibiting the expression of miR-29b [
34]. In this study, we found that the level of TUG1 was significantly reduced in mice following CLP surgery compared to the sham-operated group. The injection of TUG1-expressing adenoviral vector in CLP mice, however, alleviated CLP-induced lung tissue damage, accompanied with significantly downregulated inflammatory responses and apoptosis. The anti-apoptotic and anti-inflammatory effects of TUG1 were also observed in PMVECs, in which the LPS-induced secretion of proinflammatory cytokines and apoptosis were efficiently inhibited in cells overexpressing TUG1.
It has been recently uncovered that lncRNA can function as a miRNA sponge to inactivate its target miRNAs [
35]. In our study, miR-34b-5p was predicted as a direct downstream target of TUG1 and their expressions were negatively correlated. MiR-34b-5p is a member of miR-34b family which is dominantly expressed in the lungs [
36]. Recent evidence suggests that miR-34b-5p is prominently upregulated in inflammation-associated diseases, such as intracranial aneurysm and acute graft-versus-Host disease [
37,
38]. Xie et al. showed that inhibition of miR-34b-5p attenuated lung inflammation and the expressions of Bax and cleaved-caspase-3 in mice subjected to LPS stimulation [
39]. Here, we showed that TUG1-supressed apoptosis and the expressions of TNF-α, IL-1β and IL-6 in LPS-treated PMVECs were restored by the delivery of miR-34b-5p mimics, implicating the adverse regulatory role of miR-34b-5p in ALI.
We further explored the downstream cascade of TUG1/miR-34b-5p axis involved in the regulation of ALI, and found that GAB1 was directly targeted by miR-34b-5p. GAB1 is a scaffolding protein that belongs to the GRB2-associated binding family [
40]. The alveolar epithelium-specific knockout of GAB1 in mice reduced the level of surfactant protein in alveolar type-II cells, promoted LPS-induced pulmonary inflammation, and aggravated bleomycin-triggered fibrotic lung injury, suggesting a vital role of Gab1 in the regulation of alveolar homeostasis [
41]. In this study, we found that GAB1 was significantly downregulated in mice following CLP surgery, whereas the injection of TUG1 adenoviral vector significantly recovered the expression of GAB1 in CLP-treated mice. Moreover, in vitro data showed that the production of GAB1 was inversely regulated by miR-34b-5p, but was positively correlated with the expression of TUG1, suggesting the involvement of GAB1 in sepsis-induced ALI.
Conclusions
Taken together, the expression of lncRNA TUG1 was downregulated in CLP-operated mice. The induction of TUG1 ameliorated sepsis-induced lung injury, the secretion proinflammatory cytokines, and apoptosis via inhibiting miR-34b-5p and promoting GAB1. Our study highlighted the therapeutic potential of TUG1 for the management of sepsis-induced ALI.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.