nach oben

Journal of Experimental & Clinical Cancer Research

Erschienen in:

Open Access 01.12.2018 | Research

RETRACTED ARTICLE: LncRNA TUG1 promoted KIAA1199 expression via miR-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer

verfasst von: Junfeng Sun, Jiyi Hu, Guojun Wang, Zhen Yang, Chunlin Zhao, Xiefu Zhang, Jiaxiang Wang

Erschienen in: Journal of Experimental & Clinical Cancer Research | Ausgabe 1/2018

Abstract

Background

LncRNA TUG1 has been reported to be highly expressed in CRC samples and cells and promoted metastasis by affecting EMT, indicating a poor prognosis for colorectal cancer (CRC). In this study, we determined the underlying mechanism for tumor oncogenesis of lncRNA TUG1 in CRC metastasis.

Methods

The expressions of miR-600 and KIAA1199 in 76 CRC patients and CRC cells and CRC metastatic tissues were determined using qRT-PCR. Epithelial-mesenchymal transition (EMT)-related proteins were determined using western blot. CRC cell metastasis was assessed by colony formation, wound healing and transwell assay. Luciferase reporter gene assay was used to confirm miR-600 binding to KIAA1199 3’UTR.

Results

Our data showed that lncRNA TUG1 was upregulated in CRC cells, miR-600 was downregulated in CRC tissues, cell lines and CRC metastatic tissues, and low miR-600 expression predicted a poor clinical prognosis. Overexpression of miR-600 suppressed CRC cell migration/invasion and EMT-related proteins in vitro, inhibited tumor volume and weight, and decreased the number of CRC liver metastasis in vivo. KIAA1199 was upregulated in CRC tissues, and was negatively regulated by miR-600. KIAA1199 overexpression promoted CRC cell migration and invasion, which reversed the inhibition effect of miR-600 mimic on migration and invasion of CRC cells. Moreover, TUG1 negatively regulated miR-600, and inhibition of TUG1 suppressed CRC cell migration and invasion and EMT-related proteins via regulating miR-600.

Conclusion

Our study proved that TUG1 promoted KIAA1199 expression to accelerate EMT and metastasis of CRC cell through inhibition of miR-600 expression.

A Correction to this article is available online at https://doi.org/10.1186/s13046-021-01855-4.

This article has been retracted. Please see the retraction notice for more detail:https://doi.org/10.1186/s13046-021-01855-4

Background

Colorectal cancer (CRC) is the third most deadly cancer in the United States, which accounts for 8% of all cancer deaths in men and women [1]. It has been estimated that there are nearly 140,250 new CRC cases and 50,630 deaths of CRC in the United States in 2018 [1]. Surgery combined with adjuvant therapy resected cancerous lesions, inhibited CRC cell growth and decreased CRC metastasis{Acciuffi, 2018 #35}, thus reduced the occurance of CRC. However, 40–50% of CRC patients still had metastasis to lymph node, liver, lung, etc. [2‐4]. Increasing evidences show that epithelial-mesenchymal transition (EMT) plays an important role in the metastasis of CRC. Li et al. reported that inhibition of EMT induced the suppression of CRC cell migration and invasion [5]. Vu and Datta reviewed that EMT led to the increase of invasiveness and metastasis in CRC [6]. Besides, during EMT, epithelial marker E-cadherin is downregulated, and mesenchymal markers vimentin and N-cadherin are upregulated through regulating different EMT-related signaling pathways [7].

KIAA1199 is a gene firstly reported in Deiters’ cells and considered as the cause of non-syndromic hearing loss in 2003. Studies have shown that KIAA1199 was upregulated in many human cancers and negatively related with the survival rate [8, 9]. Researchers have shown that protein level of KIAA1199 was remarkably increased in colon cancer tissues and cells, and indicated markedly reduced survival [10, 11]. KIAA1199, as a cell-migration inducing protein, is overexpressed in metastatic CRC tissue, and inhibition of KIAA1199 inhibited migration and invasion of CRC cells and suppressed CRC metastasis [12]. However, the underlying mechanism of KIAA1199 in CRC is not fully revealed.

microRNAs, a class of small noncoding RNAs that modulate gene expression at post-transcriptional level, are involved in the development, progression and metastasis of CRC cancer [13, 14]. miR-600 was first identified in breast cancer stem cells that regulated the balance between self-renewal and differentiation of breast cancer stem cells and influenced tumor progression [15]. Later, studies showed that miR-600 was downregulated in cancers, such as acute myeloid leukemia, cervical cancer [16, 17], which was associated with a positive prognosis of cancer. Recently, Zhang et al. found that miR-600 overexpression remarkably inhibited migration and invasion abilities of CRC cells [18], however, the underlying mechanism of miR-600 in CRC metastasis is unclear. According to the bioinformatics software Targetscan, there were potential binding sites between miR-600 and KIAA1199. Therefore, we assumed miR-600 as a potential upstream molecular of KIAA1199, and might involve in modulating CRC metastasis.

Researchers have found long noncoding RNAs (lncRNAs) were abnormally expressed in CRC, which was necessary for the proliferation, apoptosis, migration and invasion. Our previous report found that lncRNA TUG1 was upregulated in CRC samples and cells and promoted metastasis by affecting EMT, indicating a poor prognosis for CRC [19]. Bioinformatics software DIANA also predicted there were potential binding sites between TUG1 and miR-600. Thus, we assumed that lncRNA TUG1 promoted KIAA1199 expression via miR-600 to accelerate CRC metastasis and EMT.

Methods

Tissue collection

Seventy-six CRC tissues and matched adjacent normal tissues were collected from CRC patients who received surgical treatment at the department of Gastrointestinal Surgery, the First Affiliated Hospital of Zhengzhou University between March 2016 and June 2017. The patients were divided into two groups: miR-600 high expression group (n = 29) and miR-600 low expression group (n = 47) according to the mean relative expression level of miR-600 (mean fold 0.55 was used as the cut-off). No patients received radiotherapy, chemotherapy or targeted therapy before surgery. The study was approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University, and all patients signed informed consent. All specimens collected from surgery were immediately stored at − 80 °C.

Cell culture and transfection

Human CRC cell lines (HCT116, SW480, HT29, LOVO and SW620) and the normal human colon epithelial cell line NCM460 were purchased from the American Type Culture Collection (USA). The cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA) at 37 °C with 5% CO₂.

miR-600 mimic, miR-600 inhibitor, si-KIAA1199, pcDNA-KIAA1199, si-TUG1 and corresponding scrambled negative control (NC) vectors were synthesized by Invitrogen. Lentivirus miR-600 (lenti-miR-600) and lenti-vector were synthesized by GENECHEM (Shanghai, China). The vectors were transfected into CRC cells by Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions.

Quantitative real-time PCR

Total RNA was extracted from CRC tissues, matched adjacent normal tissues, CRC cells and the normal human colon epithelial cell using Trizol (Invitrogen, USA). cDNA was compounded using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Japan). Real-time PCR was performed to measure miR-600 and KIAA1199 expressions using One Step SYBR® PrimeScript™ PLUS RT-PCR Kit (Takara, Japan). Fold change expression of miR-600 and KIAA1199 was calculated using the 2^−ΔΔCt method. Primers used in this study were synthesized by Invitrogen. miR-600 primer 5’-CCCGUCCCGACCGGACUCGUUCCGAGAACAGACAUUCAUUGAGGUGACGGACUGUCUGUUCUCGGAAGGAUACUUCGACCUCGGUGUGUCGUGCACACUGAA-3′; KIAA1199 primer 5’-AGGCGTGACACTGTCTCGGCTACAG-3′.

Colony formation assay

SW620, LOVO or HCT116 cells were plated in 6-well plates at 1 × 10³ cells per well and maintained in DMEM containing 10% FBS for 2 weeks with the medium replaced every 4 days. After 2 weeks, the colonies were washed with PBS for 2 times, fixed with methanol and stained with crystal violet (Sinopharm Chemical Reagent, China). The number of colonies was counted under a microscope.

Wound healing assay

SW620, LOVO or HCT116 cells were transfected with miR-600 mimic, si-KIAA1199 pre-NC or si-NC. After 72 h, cells were collected and seeded into 6-well plates until 80% confluence. Then, a pipette tip was used to creat a wound. At 0 and 48 h, the spread extent of wound closure was observed by photograph.

Transwell assay

SW620 and LOVO cells were transfected with miR-600 mimic or NC, and HCT116 cells were transfected with miR-600 inhibitor. After 72 h, 3 × 10⁴ cells were collected and placed in 100 μl serum-free DMEM medium in the upper chamber coated with Matrigel (BD, USA). DMEM medium supplemented with 10% FBS was added into the lower chamber. Twenty-four hours later, cells that migrated through Matrigel were fixed with methanol and stained with crystal violet (Sinopharm Chemical Reagent, China) for 15 min. To observe the invasion ability, cells were incubated for 48 h. Image J was used to quantify the number of migration and invasion cells.

Western blot

After transfection, CRC cells were lysed in Radio Immunoprecipitation Assay (RIPA) buffer (Thermo Scientific, USA), and protein concentration was measured by Pierce BCA Protein Assay Kit (Thermo Scientific, USA). Proteins were separated on a 12% SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to polyvinylidene difluoride (PVDF) membrane (Invitrogen, USA), which were blocked with 5% skim milk for 2 h. Blots were incubated with primary antibodies against E-cadherin (Cell Signaling Technology, USA), N-cadherin (Cell Signaling Technology, USA), Vimentin (Cell Signaling Technology, USA), Fibronecin (Abcam, USA), KIAA1199 (Invitrogen, USA), β-actin (Sigma, USA) and horseradish peroxidase-conjugated secondary antibody (Abcam, USA). Protein bands were visualized using ChemiDoc MP imaging system (Bio-Rad, USA). β-actin acted as an internal control.

Luciferase reporter gene assay

pMIR-KIAA1199 3’UTR Wild Type (WT) (400 ng) or pMIR-KIAA1199 3’UTR mutant (MT) were transfected into HCT116 cells with 40 ng pRL-TK vectors (Promega, USA). miR-600 mimic or miR-600 inhibitor or NC was co-transfected with reporter plasmids for 48 h. Cells were collected to measure luciferase activity by dual Glo™ Luciferase Assay System (Promega).

Experimental mouse model

BALB/c nude mice (5-week-old, male) were purchased from The Animal Experimental Center of Zhengzhou University, and the animal study was approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University. SW620 cells were transfected with lenti-miR-600 or lenti-vector and resuspended at a concentration of 1 × 10⁶ cells//100 μl. A total of 100 μl SW620 cells were subcutaneously injected into each BALB/c nude mouse (n = 6). Seven days after inoculation, tumor volume was measured, which was calculated by the formula: 0.5 × length×width². Nude mice were sacrificed after 25 days, and the weight of tumor tissues were measured. In addition, SW620 cells mentioned above were injected into the spleen subcapsular of each BALB/c nude mice at a concentration of 1 × 10⁶ cells/100 μl (n = 6) to establish nude mice liver metastasis model of CRC. Nude mice were sacrificed after 5 weeks, and liver tissues were obtained to count tumor nodules.

RNA immunoprecipitation (RIP) assay

Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA) was used for RIP experiment. Endogenous polycomb repressive complex2 (EZH2) (Invitrogen, USA) was used for RIP assay. Ago2 was assessed by IP-western, and TUG1 and miR-600 levels were measured by qRT-PCR.

Statistical analysis

SPSS software (version 18.0) was used for data analysis, and the data was expressed as mean ± standard error (SE). The overall survival was calculated using the Kaplan-Meier method. The data was analyzed by one-way ANOVA and t test, with P < 0.05 considered statistically significant.

Results

LncRNA TUG1,miR-600 expressions in CRC and their effect on CRC cells

Our previous research found lncRNA TUG1 was upregulated in CRC cell lines and CRC clinical samples, and play a vital role in EMT and migration of CRC [19]. Then, we measured the expression of miR-600 in 76 CRC tissue and adjacent normal tissue, and CRC cell lines (HCT116, SW480, HT29, LOVO, SW620) using qRT-PCR. miR-600 expression was decreased in CRC tissues compared with adjacent normal tissues (Fig. 1a). miR-600 expression was significantly decreased in CRC cell lines than the normal human colon epithelial cell line NCM460, with the lowest miR-600 expression in SW620 cell line and the highest in HCT116 cell line (Fig. 1b). In addition, decreased miR-600 expression was found in metastasis CRC tissue compared with the non-metastasis CRC tissue (Fig. 1c). According to the average value of miR-600 expression in CRC patients, we divided the patients into low miR-600 expression group (n = 47) and high miR-600 expression group (n = 29). Patient characteristics between the low miR-600 and the high miR-600 group were shown in Table 1. Kaplan-Meier curve revealed a poor clinical prognosis for patients with low miR-600 expression (Fig. 1d).

Table 1

Relationship between miR-600 expression and clinicopathological characteristics in colorectal cancer patients

Characteristics	Number	miR-600 expression		P value
Characteristics	Number	Low(n = 47)	High(n = 29)	P value
Age				0.690
≤ 60	31	20	11
> 60	45	27	18
Gender				0.677
Male	39	25	14
Female	37	22	15
Tumor location				0.284
Colon	40	27	13
Rectum	36	20	16
Tumor invasion depth				< 0.001*
T1, T2	24	6	18
T3, T4	52	41	11
Lymph node metastasis				0.022*
Yes	44	32	12
No	32	15	17
Distant metastasis				0.422
M1	11	8	3
M0	65	39	26

*Statistically signifcant

Next, we transfected miR-600 mimic or miR-600 inhibitor into SW480 and LOVO cell lines to overexpress or inhibit miR-600 (Fig. 2a), and evaluate the effects on cellular behaviors. Colony formation assay showed that the numbers of colonies were significantly decreased in miR-600-overexpressed SW620 and LOVO cell lines, whereas the numbers of colonies were increased in miR-600-inhibited HCT116 cell line (Fig. 2b). Wound healing assay showed that overexpression of miR-600 suppressed migration of SW620 and LOVO cells, and inhibition of miR-600 accelerated migration of HCT116 cells (Fig. 2c). Transwell assay showed that overexpression of miR-600 suppressed migration and invasion of SW620 and LOVO cells, and inhibition of miR-600 accelerated migration and invasion of HCT116 cells (Fig. 2d and e).

qRT-PCR analysis showed that overexpression of miR-600 suppressed N-cadherin, vimentin and Fibronectin expressions, and accelerated E-cadherin expression in SW620 and LOVO cells. Inhibition of miR-600 accelerated N-cadherin, vimentin and Fibronectin expressions, and suppressed E-cadherin expression (Fig. 3a). These findings proved miR-600 suppressed EMT in CRC cells. The findings of western blot analysis of the effect of miR-600 on E-cadherin, N-cadherin, vimentin and Fibronectin expressions were consistent with the findings of qRT-PCR (Fig. 3b). We transfected lenti-miR-600 or lenti-vector into SW620 cells, and established CRC xenografts in nude mice with lenti-miR-600 overexpression. miR-600 expression was significantly increased in lenti-miR-600 group, and overexpression of miR-600 significantly suppressed tumor volume and weight (Fig. 3c). Nude mice liver metastasis model of CRC was established to observe tumor nodules in liver tissues. We found overexpression of miR-600 significantly decreased the number of CRC liver metastasis after spleen injection (Fig. 3d).

KIAA1199 was upregulated in CRC cells

Using bioinformatics softwares (Targetscan and DIANA), the following potential targets of miR-600 that related to CRC migration were predicted, namely FOXG1, KIAA1199, IGF1R, MAP2K4, SCARA5, EFEMP1, IRS1, RAB22A, RAB1A, ATF3, HMGB1. The expressions of these genes in CRC tissues and adjacent normal tissue were downloaded from Gene Expression Omnibus (GEO, GSE21510), which found the expression of KIAA1199 in CRC tissue was significantly higher than normal tissue (Fig. 4a). qRT-PCR analysis also showed that KIAA1199 mRNA level was upregulated in CRC tissues than adjacent normal tissues (Fig. 4b).

Luciferase reporter method was used to detect whether miR-600 can directly target KIAA1199 3’UTR. KIAA1199 WT sequence or KIAA1199 MUT sequence were cloned into the luciferase reporter vector. Then, KIAA1199 WT or MUT and miR-600 mimic or inhibitor were transfected into SW620 or HCT116 cells. We observed a significantly decrease in the luciferase activity of KIAA1199 WT vector after transfected with miR-600 mimic in SW620 cells, and there was no significant difference in the activity of KIAA1199 MUT (Fig. 3c). We observed a significantly increase in the luciferase activity of KIAA1199 WT vector after transfected with miR-600 inhibitor in HCT116 cells, and there was no significant difference in the activity of KIAA1199 MUT (Fig. 3c), providing the evidence of direct interaction between miR-600 and KIAA1199. miR-600 mimic significantly decreased KIAA1199 expression in SW620 and LOVO cells, whereas miR-600 inhibitor significantly increased KIAA1199 expression in HCT116 cells (Fig. 4d), which indicated that KIAA1199 was negatively regulated by miR-600.

KIAA1199 promoted CRC cell migration and EMT

As shown in Fig. 4e, si-KIAA1199 significantly suppressed KIAA1199 expression in SW620 and LOVO cells. What’s more, wound healing assay (Fig. 4f) and Transwell assay (Fig. 4g) showed that si-KIAA1199 suppressed migration and invasion of SW620 and LOVO cells, whereas KIAA1199 overexpression promoted CRC cell migration and invasion, which rescued the inhibition effect of miR-600 mimic on migration and invasion of CRC cells (Fig. 5a and b). Western blot analysis showed that KIAA1199 overexpression promoted EMT related proteins, which rescued the inhibition effect of miR-600 mimic on the expression of N-cadherin, vimentin and Fibronectin (Fig. 5c).

LncRNA TUG1 negatively regulated miR-600 to accelerate cell metastasis and EMT in CRC

According to the prediction result of bioinformatics software (DIANA), there were binding sites between TUG1 and miR-600. TUG1 WT or TUG1 Mutant sequences were cloned into the luciferase reporter vector. Then, TUG1 WT or TUG1 MUT and miR-600 mimic or pre-NC were transfected into SW620 cells. We observed a significantly decrease in the luciferase activity of TUG1 WT after transfected with miR-600 mimic, and there was no significant change in the activity of TUG1 MUT, indicating miR-600 directly bound to TUG1 (Fig. 6a). qRT-PCR analysis showed that si-TUG1 significantly decreased TUG1 level and increased miR-600 level in SW620 and LOVO cells (Fig. 6b), whereas pcDNA-TUG1 significantly increased TUG1 level and decreased miR-600 level in HCT116 cells (Fig. 6c). Then, Ago2 antibody was added into SW620 cell lysate for RIP. qRT-PCR showed that TUG1 and miR-600 enrichment was significantly increased in Ago2 than IgG (Fig. 6d). We also observed TUG1 level was negatively correlated with miR-600 level in CRC tissue (Fig. 6e). Transwell assay (Fig. 6f) and Western blot analysis (Fig. 6g) showed that miR-600 inhibitor rescued the inhibition effect of si-TUG1 on the migration/ invasion of CRC cells and EMT related protein expression.

Discussion

Numerous studies have shown that lncRNAs play critical role in modulating tumor processes, such as apoptosis, proliferation and metastasis [20, 21]. Although our previous report has proved lncRNA TUG1 promoted the aggressiveness of CRC cells and facilitated EMT in CRC cells [19], the exact molecular mechanism mediated by lncRNA TUG1 in CRC is still unclear. So, we further attempted to reveal the possible mechanism of lncRNA TUG1 mediated CRC metastasis in this study. It has been reported that lncRNAs could facilitate or suppress tumor processes via competitively binding with miRNAs, and bioinformatics software analysis is commonly used to predict the potential binding sites between miRNA and the interacted genes [22]. In this study, bioinformatics software DIANA predicted there were potential binding sites between TUG1 and miR-600. We observed TUG1 knockdown increased miR-600 expression in CRC cells, whereas overexpression of TUG1 decreased miR-600 expression. Besides, TUG1 knockdown suppressed CRC cell migration and invasion and EMT, and miR-600 inhibitor reversed these inhibition effects, indicating lncRNA TUG1 could negatively regulated miR-600 to promote migration and invasion of CRC cells and EMT in CRC cells.

Evidence has shown that miRNAs play critical roles in modulating proliferation, metastasis and EMT of CRC, such as miR-590-5p, miR-198, miR-19b-3p, etc. [23‐25]. miR-600 is a newly identified miRNA and its role in proliferation, apoptosis, migration in cancer cells is largely unknown. Zeng et al. reported that miR-600 could be significantly associated with prolonged survival time in cervical cancer [17]. Zhang et al. found that miR-600, as a negative regulator of p53, could suppress proliferation, migration and invasion in mutant p53-expressing human CRC cell [18]. However, the expression of miR-600 in CRC cell lines or tissues has not been discussed, and its role in EMT and CRC metastasis has not been explored. In this study, we focused on the role of miR-600 in migration and invasion of CRC cell, EMT in CRC cells and CRC metastasis. We observed that miR-600 was downregulated in CRC tissues and cell lines and CRC metastatic tissue, and low miR-600 expression predicted a poor clinical prognosis for CRC patients. Besides, we found overexpression of miR-600 inhibited migration and invasion of CRC cells, which was consistent with previous report [18]. Moreover, miR-600 overexpression inhibited EMT in CRC cells in vitro, suppressed tumor volume and weight in vivo, and reduced the number of liver metastasis in vivo, which brought new evidence to the role of miR-600 in CRC progression.

KIAA1199, also defined as cell migration inducing protein (CEMIP), has been reported to be overexpressed in many cancers and promoted cancer metastasis through different signaling pathways, such as Wnt signaling and MEK1/ERK1/2 signalling [26, 27]. Evensen et al. found KIAA1199 was upregulated in breast cancer metastatic tissues, and resulted in EMT in breast cancer cells, inhibited cell migration in vitro and decreased metastasis in vivo [8]. Recently, researchers showed that KIAA1199, one of the direct targets of miR-216a, was highly expressed in CRC metastatic tissues, and KIAA1199 downregulation inhibited CRC cell migration and invasion in vitro [12]. However, there was no research studying the function of miR-600 on KIAA1199 in CRC metastasis. Our present study first proved that KIAA1199 was a direct target of miR-600, and was negatively regulated by miR-600 to modulate CRC cell migration and invasion, revealing new mechanism of miR-600 on CRC progression.

Limitations

our study had a relatively small sample size which may be an important factor affecting the extrapolation of our results. The statistical test for miR-600-related survival is of borderline significance. Thus, a larger study should be performed to clearly determine the relationship between miR-600 expression and CRC patients survival.

Conclusion

In this study, we discovered miR-600 was downregulated and KIAA1199 was upregulated in CRC tissues and cell lines, which predicted a poor clinical prognosis. Overexpression of miR-600 suppressed CRC cell migration/invasion and EMT-related proteins, inhibited tumor volume and weight, and decreased the number of CRC liver metastasis via KIAA1199. Inhibition of TUG1 suppressed CRC cell migration and invasion and EMT-related proteins via regulating miR-600. Our study first proved that TUG1/miR-600/KIAA1199 promoted CRC cell migration and EMT in vitro and metastasis in vivo.

Acknowledgements

Thank Hengxuan Ding, Dan Liu and Jianhua Shang of Zhengzhou University for their help in specimen collection and molecular experiments.

Funding

Financial Support: This study was supported by Natural Science Foundation of China (No.81702343).

Competing interest

All authors declare that there is no competing interest.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. Ca A Cancer Journal for Clinicians. 2018;68(1):7.CrossRef

Zhang M, et al. RHBDD1 promotes colorectal cancer metastasis through the Wnt signaling pathway and its downstream target ZEB1. J Exp Clin Cancer Res. 2018;37(1):22.CrossRef

Rychahou P, et al. Colorectal cancer lung metastasis treatment with polymer-drug nanoparticles. J Control Release. 2018;275:85–91.CrossRef

Marquez J, et al. Targeting liver sinusoidal endothelial cells with miR-20a-loaded nanoparticles reduces murine colon cancer metastasis to the liver. Int J Cancer. 2018;

Li J, et al. MicroRNA-140 inhibits the epithelial-mesenchymal transition and metastasis in colorectal Cancer. Mol Ther Nucleic Acids. 2018;10:426–37.CrossRef

Vu T, Datta P. Regulation of EMT in colorectal Cancer: a culprit in metastasis. Cancers (Basel). 2017;9(12):E171.

Zeisberg M, Neilson EG. Biomarkers for epithelial-mesenchymal transitions. J Clin Investig. 2009;119(6):1429.CrossRef

Evensen N, et al. Unraveling the role of KIAA1199, a novel endoplasmic reticulum protein, in cancer cell migration. J Natl Cancer Inst. 2013;105(18):1402–16.CrossRef

Deng F, et al. Overexpression of KIAA1199: an independent prognostic marker in nonsmall cell lung cancer. J Cancer Res Ther. 2017;13(4):664–8.CrossRef

10.

Fink S, et al. Induction of KIAA1199/CEMIP is associated with colon cancer phenotype and poor patient survival. Oncotarget. 2015;6(31):30500–15.CrossRef

11.

Birkenkampdemtroder K, et al. Repression of KIAA1199 attenuates Wnt-signalling and decreases the proliferation of colon cancer cells. Br J Cancer. 2011;105(4):552–61.CrossRef

12.

Zhang D, et al. Down-regulation of KIAA1199/CEMIP by miR-216a suppresses tumor invasion and metastasis in colorectal cancer. Int J Cancer. 2017;140(10):2298–309.CrossRef

13.

Al-Haidari A, et al. MiR-155-5p controls colon cancer cell migration via post-transcriptional regulation of human antigen R (HuR). Cancer Lett. 2018;421:145–51.CrossRef

14.

Li J, et al. MiR-186-5p upregulation inhibits proliferation, metastasis and epithelial-to-mesenchymal transition of colorectal cancer cell by targeting ZEB1. Arch Biochem Biophys. 2018;640:53–60.CrossRef

15.

El Helou R, et al. miR-600 acts as a bimodal switch that regulates breast Cancer stem cell fate through WNT signaling. Cell Rep. 2017;18(9):2256–68.CrossRef

16.

Li H, et al. A regulatory circuitry between miR-193a/miR-600 and WT1 enhances leukemogenesis in acute myeloid leukemia. Exp Hematol. 2018;

17.

Zeng Y, et al. Integrative miRNA analysis identifies hsa-miR-3154, hsa-miR-7-3, and hsa-miR-600 as potential prognostic biomarker for cervical cancer. J Cell Biochem. 2018;119(2):1558–66.CrossRef

18.

Zhang P, et al. miR-600 inhibits cell proliferation, migration and invasion by targeting p53 in mutant p53-expressing human colorectal cancer cell lines. Oncol Lett. 2017;13(3):1789–96.CrossRef

19.

Sun J, et al. The long non-coding RNA TUG1 indicates a poor prognosis for colorectal cancer and promotes metastasis by affecting epithelial-mesenchymal transition. J Transl Med. 2016;14:42.CrossRef

20.

Ding J, et al. Long noncoding RNA CRNDE promotes colorectal cancer cell proliferation via epigenetically silencing DUSP5/CDKN1A expression. Cell Death Dis, e2997. 2017;8(8):e2997.

21.

Li K, et al. Long non-coding RNA linc00460 promotes epithelial-mesenchymal transition and cell migration in lung cancer cells. Cancer Lett. 2018;420:80–90.CrossRef

22.

Xie C, et al. Long noncoding RNA HCAL facilitates the growth and metastasis of hepatocellular carcinoma by acting as a ceRNA of LAPTM4B. Mol Ther Nucleic Acids. 2017;9:440–51.CrossRef

23.

Murakami T, et al. Tenascin C in colorectal cancer stroma is a predictive marker for liver metastasis and is a potent target of miR-198 as identified by microRNA analysis. Br J Cancer. 2017;117(9):1360–70.CrossRef

24.

Kim C, et al. Hypoxia-induced microRNA-590-5p promotes colorectal cancer progression by modulating matrix metalloproteinase activity. Cancer Lett. 2018;416:31–41.CrossRef

25.

Jiang T, et al. miR-19b-3p promotes colon cancer proliferation and oxaliplatin-based chemoresistance by targeting SMAD4: validation by bioinformatics and experimental analyses. J Exp Clin Cancer Res. 2017;36(1):131.CrossRef

26.

Matsuzaki S, et al. Clinicopathologic significance of KIAA1199 overexpression in human gastric cancer. Ann Surg Oncol. 2009;16(7):2042–51.CrossRef

27.

Boerboom A, et al. KIAA1199: a novel regulator of MEK/ERK-induced Schwann cell dedifferentiation. Glia. 2017;65(10):1682–96.CrossRef

Titel: RETRACTED ARTICLE: LncRNA TUG1 promoted KIAA1199 expression via miR-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer
verfasst von: Junfeng Sun
Jiyi Hu
Guojun Wang
Zhen Yang
Chunlin Zhao
Xiefu Zhang
Jiaxiang Wang
Publikationsdatum: 01.12.2018
Verlag: BioMed Central
Erschienen in: Journal of Experimental & Clinical Cancer Research / Ausgabe 1/2018
Elektronische ISSN: 1756-9966
DOI: https://doi.org/10.1186/s13046-018-0771-x

Neu im Fachgebiet Onkologie

24.04.2024 | DGIM 2024 | Nachrichten

Springer Medizin

RETRACTED ARTICLE: LncRNA TUG1 promoted KIAA1199 expression via miR-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer

Abstract

Background

Methods

Results

Conclusion

Background

Methods

Tissue collection

Cell culture and transfection

Quantitative real-time PCR

Colony formation assay

Wound healing assay

Transwell assay

Western blot

Luciferase reporter gene assay

Experimental mouse model

RNA immunoprecipitation (RIP) assay

Statistical analysis

Results

LncRNA TUG1,miR-600 expressions in CRC and their effect on CRC cells

KIAA1199 was upregulated in CRC cells

KIAA1199 promoted CRC cell migration and EMT

LncRNA TUG1 negatively regulated miR-600 to accelerate cell metastasis and EMT in CRC

Discussion

Limitations

Conclusion

Acknowledgements

Funding

Competing interest

Publisher’s Note

Neu im Fachgebiet Onkologie

Bei Senioren mit Prostatakarzinom auf Anämie achten!

ICI-Therapie in der Schwangerschaft wird gut toleriert

Krebspatienten impfen: Was? Wen? Und wann nicht?

Müde im Alter? Auch an die Nebenniere denken

Update Onkologie

Springer Medizin

Abstract

Background

Methods

Results

Conclusion

Background

Methods

Tissue collection

Cell culture and transfection

Quantitative real-time PCR

Colony formation assay

Wound healing assay

Transwell assay

Western blot

Luciferase reporter gene assay

Experimental mouse model

RNA immunoprecipitation (RIP) assay

Statistical analysis

Results

LncRNA TUG1,miR-600 expressions in CRC and their effect on CRC cells

KIAA1199 was upregulated in CRC cells

KIAA1199 promoted CRC cell migration and EMT

LncRNA TUG1 negatively regulated miR-600 to accelerate cell metastasis and EMT in CRC

Discussion

Limitations

Conclusion

Acknowledgements

Funding

Competing interest

Publisher’s Note

Weitere Artikel der Ausgabe 1/2018

Monitoring the effect of first line treatment in RAS/RAF mutated metastatic colorectal cancer by serial analysis of tumor specific DNA in plasma

FAK-ERK activation in cell/matrix adhesion induced by the loss of apolipoprotein E stimulates the malignant progression of ovarian cancer

TRIM52 up-regulation in hepatocellular carcinoma cells promotes proliferation, migration and invasion through the ubiquitination of PPM1A

Isoliquiritigenin suppresses human melanoma growth by targeting miR-301b/LRIG1 signaling

TFAP2C promotes stemness and chemotherapeutic resistance in colorectal cancer via inactivating hippo signaling pathway

Phytosomal curcumin causes natural killer cell-dependent repolarization of glioblastoma (GBM) tumor-associated microglia/macrophages and elimination of GBM and GBM stem cells

Neu im Fachgebiet Onkologie

Bei Senioren mit Prostatakarzinom auf Anämie achten!

ICI-Therapie in der Schwangerschaft wird gut toleriert

Krebspatienten impfen: Was? Wen? Und wann nicht?

Müde im Alter? Auch an die Nebenniere denken

Update Onkologie