Introduction
Hepatocellular carcinoma (HCC) consists of diverse, histologically distinct hepatic neoplasms and is the fifth most common cancer worldwide [
1]. HCC is among the most lethal liver cancers and represents 70–90% of primary liver cancers [
2]. In the early stage, HCC is usually asymptomatic and most patients are diagnosed at an advanced stage [
3]. As most patients do not have the opportunity to undergo radical surgery, the overall patient outcome is poor. Therefore, novel, reliable, predictive biomarkers and treatments for HCC are urgently needed.
Long non-coding RNA (lncRNAs) is generally defined as RNA that lacks coding potential and has a transcript length of more than 200 nucleotides (nt) [
4‐
6]. Using high-throughput technologies, thousands of lncRNAs have recently been identified, and a large number of studies have demonstrated that dysregulated lncRNAs are closely related to human cancers [
7], such as HCC [
8], lung cancer [
9], breast cancer [
10], and colorectal cancer [
7]. The expression levels of certain lncRNAs are associated with the recurrence [
11], metastasis [
12], and prognosis of cancers. Therefore, the identification of cancer-associated lncRNAs will lead to a better understanding of the molecular biology of tumors and aid in developing novel therapeutic targets.
lncRNA TRPM2-AS, which is an antisense lncRNA of TRPM2, is 875 nt in length and located in the chr21q22.3 locus [
13]. TRPM2-AS was first studied in prostate cancer [
13] and then studied in the context of non-small cell lung cancer (NSCLC), where it was found to be related to the survival of NSCLC patients and chemo-resistance in NSCLC [
14,
15]. However, until now, the role of lncRNA TRPM2-AS in HCC has not been studied.
In the current study, we aimed to determine the expression of TRPM2-AS in HCC tissues and its relationship with HCC patient outcome and clinicopathological factors. Our findings provide new insights into HCC pathogenesis and suggest candidates for potential novel biomarkers for HCC.
Methods and materials
Study subjects
One hundred eight fresh HCC tissue and matched normal adjacent tissue samples were selected from patients with HCC at our hospital (Yuhuangding Hospital of Qingdao University Medical College) between 2010 and 2012. None of the patients had received preoperative therapy. The diagnosis of each specimen was confirmed histopathologically. Letters of consent were obtained from all patients, and the experimental protocols were approved by the local ethics committee. Patient charts were reviewed to obtain clinical data including age, gender, tumor size, AFP, HBsAg, vascular invasion, TNM stage (AJCC), tumor differentiation, and death or time of last follow-up. Patient survival was calculated from the day of surgery until death in months.
Cell lines and transfection
The HCC cell lines HCCLM3, Huh7, SMMC-7721, SK-Hep1, and HepG2 and one normal liver cell line (QSG-7701) were maintained at our institute. HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY, USA), and SK-Hep1, SMMC-7721, Huh7, HCCLM3, and QSG-7701 cells were cultured in Medium 1640 (Gibco, Grand Island, NY, USA) supplemented with 10% heat-inactivated FBS (Sigma-Aldrich, St. Louis, MO, USA).
Si-NC and Si-TRPM2-AS were used to transfect the cells at a concentration of 20 nM. Oligonucleotide transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Cells were collected 48 h after transfection. The siRNA sequences for TRPM2-AS1 were as follows: siRNA sense, 5′-GGGAAGAUGUCUCAGCAGACG-3′, and antisense, 5′-UCUGCUGAGACAUCUUCCCCU-3′.
Quantitative real-time PCR
Total RNA was extracted from tissues using TRIzol® Reagent (Life Technologies Corporation, Carlsbad, CA, USA) according to the manufacturer’s protocol, and cDNA was synthesized (Bio-Rad, Hercules, CA, USA). QPCR (7500Fast; ABI, Foster City, CA, USA) was performed to compare the mRNA expression levels of TRPM2-AS1 in 108 paired tumor and peritumor tissues from HCC patients. The primer sequences for TRPM2-AS1 were as follows: sense, 5′-CGTGACCAGGTTCAGACACA-3′, and antisense, 5′-TGGGCAGTTTGGTTCTGGTT-3′. The primer sequences for the house-keeping gene β-actin were as follows: sense, 5′-TGTCCACCTTCCAGCAGATG-3′, and antisense, 5′-TGTCACCTTCACCGTTCCAG-3′. Bax, Bcl-2, caspase-3, cyclin D1, cyclin E1, cyclin B1, and cyclin A2 expression was measured using the SYBR green qPCR assay (Takara, Dalian, China) and the primer sequences were shown in Table
1.
Table 1
Primers for qRT-PCR
Bax | CCCGAGAGGTCTTTTTCCGAG | CCAGCCCATGATGGTTCTGAT | 155 |
Bcl-2 | GGTGGGGTCATGTGTGTGG | CGGTTCAGGTACTCAGTCATCC | 89 |
Caspase-3 | CATGGAAGCGAATCAATGGACT | CTGTACCAGACCGAGATGTCA | 139 |
cyclin D1 | GCTGCGAAGTGGAAACCATC | CCTCCTTCTGCACACATTTGAA | 135 |
cyclin E1 | GCCAGCCTTGGGACAATAATG | CTTGCACGTTGAGTTTGGGT | 104 |
cyclin A2 | CGCTGGCGGTACTGAAGTC | GAGGAACGGTGACATGCTCAT | 120 |
cyclin B1 | AATAAGGCGAAGATCAACATGGC | TTTGTTACCAATGTCCCCAAGAG | 111 |
Cell viability assay
Cell viability assays were performed using the Cell Counting Kit-8 (CCK-8) (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Cells were cultured in 96-well plates at a cell density of 1000 cells per well for 24, 48, 72, and 96 h. The absorbance was read at 450 nm to determine the cell viability in each well. All experiments were independently repeated three times.
Apoptosis assay
Cells were plated in 6-well plates, and 48 h after transfection, the cells were collected and resuspended in staining solution containing Annexin V-FITC and propidium iodide (PI; Tianjin Sungene Biotech Co. Ltd., Tianjin, China). The stained cells (1 × 105) were analyzed using a flow cytometer.
Cell cycle assay
Forty-eight hours after transfection, the cells were collected and fixed in 75% ethanol overnight at 4 °C and then incubated with 1 mg/mL RNase A for 30 min at 37 °C. Subsequently, cells were stained with propidium iodide (PI; Becton Dickinson, San Jose, CA, USA) in PBS according to the manufacturer’s instructions. The stained cells (1 × 105) were analyzed by flow cytometry.
Statistical analysis
Data were analyzed using the Statistical Package for the Social Sciences (SPSS), Version 18 (SPSS, Chicago, IL, USA). Pearson’s chi-squared test was used to analyze the relationship between TRPM2-AS1 expression and clinicopathological characteristics. Kaplan-Meier plots were constructed to visualize survival outcomes, which were compared using a log-rank test. All experiments were performed in triplicate. The differences between the groups were analyzed using Student’s t test, and p < 0.05 was considered statistically significant in all cases.
Discussion
In this study, we tested the expression of the novel lncRNA TRPM2-AS in HCC tissues and their surrounding non-tumorous tissues. We found that the upregulation of TRPM2-AS in HCC primary tumors was associated with a poor prognosis. When analyzing the clinicopathological factors, we found a significant association between TRPM2-AS expression and tumor size, AJCC stage, and tumor differentiation. We also identified the function of TRPM2-AS in HCC cells using a loss-of-function approach. The inhibition of TRPM2-AS inhibited HCC cell proliferation. Therefore, these results indicated that TRPM2-AS may function as a tumor oncogene and may explain the significant association between TRPM2-AS expression and tumor size in HCC, which leads to a poorer prognosis in HCC patients with high TRPM2-AS expression levels.
lncRNAs were first regarded as spurious transcriptional noise [
16,
17]. As thousands of lncRNAs were discovered, however, they were found to affect a diverse range of biological processes, including the cell cycle, cell differentiation, and cell metabolism through various mechanisms at transcriptional, post-transcriptional, and epigenetic regulatory levels [
17,
18]. Moreover, after the dysregulation of many lncRNAs was found to be associated with a variety of diseases [
19], including cancer, lncRNAs were also considered to be oncogenic or tumor-suppressor genes as well as protein-coding genes.
Although lncRNAs have been shown to play important biological roles and are dysregulated in many human diseases, the functional mechanism of lncRNAs is poorly understand and represents a difficult aspect of lncRNA research [
20]. Their mechanism of action mainly includes (1) chromatin remodeling by binding to the promoter regions or changing histone markers and the chromatin state [
21], (2) acting as scaffold molecules through the direct interaction with proteins or protein complexes as scaffolds or allosteric activators/inhibitors [
22], and (3) competing with endogenous RNAs by acting as competing endogenous RNAs that bind miRNAs and reduce their inhibitory effect on their natural targets [
23]. These functions are likely not mutually exclusive and an individual lncRNA may act through several of them [
20].
Orfanelli et al. [
13] first investigated the function of TRPM2-AS in prostate cancer, demonstrating that high TRPM2-AS expression was associated with a poor clinical outcome and that, in vitro, TRPM2-AS knockdown led to prostate cancer cell apoptosis. TRPM2-AS was then shown to be related to resistance to anti-tumor drugs in carcinoma cells via the p53-p66 pathway in NSCLC. Here, we drew a similar conclusion that high TRPM2-AS expression was associated with a poor clinical outcome and that the inhibition of TRPM2-AS resulted in apoptosis in HCC cells, and this is the first report to demonstrate the function of TRPM2-AS in HCC.
Although we confirmed the role of TRPM2-AS in inhibiting proliferation in HCC cells, we did not clarify the mechanism of inhibition. Further studies are needed to determine whether TRPM2-AS retains this inhibitory effect in vivo and to identify the downstream molecules affected by TRPM2-AS.
In conclusion, we demonstrated that the upregulation of TRPM2-AS is associated with the patient overall survival rate after hepatic resection. TRPM2-AS knockdown was also found to effectively suppress the tumorigenicity of HCC cell lines. We suggest that controlling proliferation by inhibiting TRPM2-AS may represent a novel therapeutic approach for HCC.
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.