Background
Glioma appears to be one of the most common types of primary brain tumors in adults [
1,
2]. Characterized by rapid progression, patients with glioma are most likely diagnosed at advanced stages, and the prognosis remains poor [
3], posing a large threat to human health. Although some advances in comprehensive treatment as well as early diagnosis have been made, only a few patients have experienced the expected effects when translated to the clinic [
4,
5]. Thus, it is imperative to explore the mechanisms concerning glioma formation and progression and to establish diagnostic and therapeutic targets for optimized management of glioma.
Long noncoding RNAs (lncRNAs) are defined as non-protein coding transcripts longer than 200 nucleotides. Recently, lncRNAs have gained much attention in the field of molecular biology. Increasing evidence indicates that lncRNAs are involved in diverse biological processes, including cell proliferation, differentiation, apoptosis, development and immune responses [
6,
7]. Papillary thyroid carcinoma susceptibility candidate 3 (PTCSC3) is an intergenic long noncoding RNA gene (lincRNA) located at 14q.13.3, which was newly identified as thyroid specific [
8]. Subsequently, lncRNA PTCSC3 was reported to be a tumor suppressor in thyroid cancer [
9], and the mechanism study demonstrated that lncRNA PTCSC3 reduced cell motility and invasiveness by downregulating the S100A4 pathway [
10]. However, little is known about the role of lncRNA PTCSC3 in other malignancies.
Our study was performed to assess the expression of lncRNA PTCSC3 in glioma cells and to evaluate its role and mechanism in tumor cell proliferation, invasion and migration. This is the first time that lncRNA PTCSC3 has been assessed in glioma. We assessed the expression level of lncRNA PTCSC3 in human microglia and glioma cell lines. Additionally, we demonstrated that lncRNA PTCSC3 overexpression suppressed proliferation, migration and invasion and inhibited the epithelial-mesenchymal transition (EMT) by suppressing the Wnt/β-catenin signaling pathway in glioma.
Methods
Cell culture
Several glioma cell lines (U87, U251, SHG44 & SHG139) were purchased from the Cell Bank Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Human microglia was purchased from the Scinencell Research Laboratories (Carlsbad, CA, USA). Human astrocyte was purchased from Lonza (Basel, Switzerland) and cultured in AGM™ Astrocyte Growth Medium. Other cells were cultured in DMEM (Gibco, Carlsbad, CA, USA) supplemented with 10% of fetal bovine serum (Gibco) and 1% of penicillin-streptomycin at 37 °C, 5% CO2 humidified atmosphere.
RNA extraction and quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR)
Total RNA was extracted from cell lines with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the concentration was measured by nanodrop spectrophotometer. One microgram of total RNA was reversely transcribed into first-strand cDNA using a Reverse Transcription Kit (Takara, Dalian, China). PCR was performed in VIIA7 system (Applied Biosystems, California, USA) with SYBR® Premix Ex Taq
TM II Kit (Takara, Dalian, China). GAPDH was used as an internal control. Gene primers are listed in Table
1. Comparison Ct (2-△△Ct) method was used to analyze the data.
Table 1
Sequence of primers used for qRT-PCR
lncRNA PTCSC3 | Forward Primer | GGCTTGAACAATCTTCCCACCTT |
| Reverse Primer | TTTGGCAACACCCTCACAGACAC |
MMP1 | Forward Primer | AAAATTACACGCCAGATTTGCC |
| Reverse Primer | GGTGTGACATTACTCCAGAGTTG |
MMP2 | Forward Primer | CCCACTGCGGTTTTCTCGAAT |
| Reverse Primer | CAAAGGGGTATCCATCGCCAT |
MMP9 | Forward Primer | AGACCTGGGCAGATTCCAAAC |
| Reverse Primer | CGGCAAGTCTTCCGAGTAGT |
MMP13 | Forward Primer | ACTGAGAGGCTCCGAGAAATG |
| Reverse Primer | GAACCCCGCATCTTGGCTT |
E-cadherin | Forward Primer | CGAGAGCTACACGTTCACGG |
| Reverse Primer | GGGTGTCGAGGGAAAAATAGG |
Fibronectin | Forward Primer | CGGTGGCTGTCAGTCAAAG |
| Reverse Primer | AAACCTCGGCTTCCTCCATAA |
Snail | Forward Primer | TCGGAAGCCTAACTACAGCGA |
| Reverse Primer | AGATGAGCATTGGCAGCGAG |
ZEB1 | Forward Primer | GATGATGAATGCGAGTCAGATGC |
| Reverse Primer | ACAGCAGTGTCTTGTTGTTGT |
FZD8 | Forward Primer | ATCGGCTACAACTACACCTACA |
| Reverse Primer | GTACATGCTGCACAGGAAGAA |
LRP6 | Forward Primer | TTTATGCAAACAGACGGGACTT |
| Reverse Primer | GCCTCCAACTACAATCGTAGC |
Axin1 | Forward Primer | GACCTGGGGTATGAGCCTGA |
| Reverse Primer | GGCTTATCCCATCTTGGTCATC |
C-myc | Forward Primer | GGCTCCTGGCAAAAGGTCA |
| Reverse Primer | CTGCGTAGTTGTGCTGATGT |
Cyclin D1 | Forward Primer | TGGAGCCCGTGAAAAAGAGC |
| Reverse Primer | TCTCCTTCATCTTAGAGGCCAC |
GAPDH | Forward Primer | AAGGTGAAGGTCGGAGTCAAC |
| Reverse Primer | GGGGTCATTGATGGCAACAATA |
Lentivirus transfection
The lncRNA PTCSC3 was ligated into pLVX-IRES-puro to construct the lncRNA PTCSC3 overexpression plasmid. The pRUF-IRES-puro-PTCSC3 and pLVX-IRES-puro constructs were transfected into the HEK293T viral packaging cell line together with psPAX2 and pMD2.G plasmids. Forty-eight hours after transfection, the supernatant was collected and used to infect the cells.
CCK-8 assay
U87 and U251 were selected as the appropriate cell lines for gain-of-function experiments. The two cell lines were seeded into 96-well plates at a density of 1 × 104 cells/well 48 h after transfection and cultured at 37 °C, 5% CO2 incubator. The viabilities of cells were assessed with the cell counting kit-8 (CCK-8; Dojindo Molecular Technologies, Japan) at four time points (12, 24, 48 & 72 h). The absorbance was detected by a TECAN infinite M200 plate reader at 450 nm.
For colony formation assay, 500 cells were seeded in each well of a six-well plate 48 h after transfection and cultured at 37 °C, 5% CO2 incubator with the medium being changed every 2 days. On the 7th day, the cultural media was removed, and cells were washed twice with PBS. After that, colonies were fixed in methanol for 20 min and stained with 1% crystal violet (Sigma) for 30 min, and then washed. Colonies were counted and photographed.
Flow cytometry assay
Fourty-eight hours after transfection, U87 and U251 cells were collected for cell cycle and apoptosis analysis. The cell cycle analysis was performed using the Cell Cycle Analysis Kit (Beyotime biotechnology, Jiangsu, China) according to the manufacturer’s instructions. The apoptosis assay was performed using the Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis Kit (Thermo Fisher Scientific, Waltham, MA, USA). The cells were detached by trypsinase, centrifuged at 1000 g for 5 min and then resuspended in 100 μL of binding buffer with 5 μL of Annexin v. After that, 1 μL of propidium iodide was added and mixed, followed by 15 min’ incubation in dark. Subsequently, 400 μL of binding buffer was added to resuspend the cells, which were analyzed by Gallios Flow Cytometry (Beckman Coulter, USA). The experiments were repeated triple times.
Transwell assay
Cell invasion abilities were performed with transwell assay using transwell chambers with 8-μm pores (Costar, Corning, NY, USA). In invasion assay, the upper side of the insert membrane was coated with matrigel (BD Biosciences, New Jersey, USA). A number of 1 × 104 cells in 200 μl of serum-free medium were added into the upper chamber and 600 μl of medium with 5% FBS as chemoattractant was added into the lower chamber. After 24 h’ incubation, the cells on the upper surface of the insert membrane were removed using cotton swab. The cells on the lower surface of the insert membrane were fixed in methanol for 20 min and then stained with 1% crystal violet for 30 min. The number of cells on the lower surface of the membrane was calculated with a microscope and then photographed. All experiments were performed in triplicate.
Scratch assay
Cells were seeded in each well of 6-well plates and cultured until 100% confluence. A scratch was performed using pipette tips and then serum-free medium was replaced. The scratch closing procedure was observed in 24 h and images were taken after 24 h’ incubation.
Western blot analysis
Total protein was extracted from collected cells with RIPA buffer containing phenylmethanesulfonylfl uoride (PMSF). After a 30-min reaction on ice, the protein lysate was centrifuged at 13000 rpm for 15 min and the supernatant was collected. The protein concentration was measured by the BCA Protein Assay Kit (Pierce, Illinois, USA). Ten microgram of each protein was subjected to 8% SDS-PAGE and transferred to PVDF membranes, which was then blocked with 5% BSA in TBST (TBS containing 0.1% Tween-20) at room temperature for 1 h and incubated with the corresponding primary antibodies diluted in blocking buffer at 4 °C overnight. After washing with PBST (PBS containing 0.1% Tween), secondary antibodies was added for incubation at room temperature for 1 h. The western blot images were captured using the LI-COR Odyssey Scanner. Primary antibodies recognizing human E-cadherin, Fibronectin, LRP6, Axin1, active catenin, C-myc, Cyclin D1 (mouse mAb, 1:1000, Abcam, Cambridge, MA, USA) and GAPDH (rabbit mAb, 1:2000, Cell Signaling Technology, Danvers, MA, USA) were used.
Immunofluorescence assay
U87 cells were seeded in 35-mm cell culture dishes (NEST Biotech, Wuxi, China). The cells were fixed with 4% PFA in PBS for 20 min and permeabilized with 0.5% Triton X-100 for 5 min at room temperature. After washing in PBS, cells were blocked with 5% BSA for 1 h and incubated with primary antibodies against E-Cadherin and Fibronectin (1:200, Abcam, Cambridge, MA, USA) overnight at 4 °C, and then detected using Alexa fluor 546-conjugated anti-mouse IgG secondary antibodies, followed by a 2-mg/mL solution of 4′, 6-diamidino-2-phenylindole (DAPI; Sigma–Aldrich, St. Louis, MO, USA) in PBS for nuclear staining. Cells were visualized under a confocal microscope (Leica, Solms, Germany).
RNAi
For RNAi-mediated knockdown experiment, lncRNA PTCSC3-specific siRNA and scramble negative control siRNA (ScrsiRNA) were purchased from GenePharma Co., Ltd (Shanghai, China). The sequences were as follow: lncRNA PTCSC3-siRNA, sense, 5′-AUCUUUUGCAUUAAUCUCCCU-3′, antisense, 5′-GGAGAUUAAUGCAAAAGAUGG-3′; ScrsiRNA, sense, 5′-UUCUCCGAACGUGUCACGUTT-3′, antisense, and 5′-ACGUGACACGUUCGGAGAATT-3′. U87 cells were transfected with 100 nM lncRNA PTCSC3 specific siRNA or scrsiRNA using Lipofectamine
TM2000 (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. The transfection efficiency was confirmed by qRT-PCR (See Additional file
1: Figure S1).
Statistical analysis and quantification
All statistical analyses were performed using Statistical Program for Social Sciences 19.0 software (SPSS, Chicago, IL, USA) and GraphPad Prism 5.0 (GraphPad Software, LaJolla, CA, USA). Data were presented as the means ± SD. The significance of differences between groups was estimated by Student’s t-test (two-sided, unpaired). P < 0.05 was considered to indicate a statistically significant difference. All experiments were repeated at least three times.
Discussion
It is well-known that lncRNAs are dysregulated in a variety of tumors and play important roles in carcinogenesis as well as cancer progression [
11]. In the present study, we detected the expression level of lncRNA PTCSC3 in glioma. We demonstrated that lncRNA PTCSC3 was downregulated in glioma cells compared with normal brain cells. To investigate the biological function of lncRNA PTCSC3, we performed gain-of-function experiments in glioma cell lines. These experiments indicate that overexpression of lncRNA PTCSC3 inhibited proliferation, migration and invasion in glioma cells. For the mechanism study, we explored the influences of dysregulated lncRNA PTCSC3 in the EMT and Wnt/β-catenin signaling pathways, revealing a negatively regulatory mechanism between these pathways.
Evidences are accumulating that lncRNAs play pivotal roles in various maligancies. LncRNA H19 was reported to be overexpressed in pancreatic ductal adenocarcinoma and plays oncogenic role through promoting cancer cell proliferation [
12]. It was also recognized as a novel biomarker for diagnosis of gastric cancer in plasma [
13]. Urothelial Carcinoma Associated 1 (UCA1), which acts as oncogenic lncRNA and promotes bladder cancer progression [
14], has been studied in a meta-analysis that up-regulated UCA1 was significantly corrected with LNM and poor OS in patients with various cancers [
15]. In glioma, the exploration of lncRNAs is still superficial. LncRNA-ATB was abnormally upregulated in glioma and played an oncogenic role in glioma cells by inhibiting miR-200a and facilitating TGF-β2 [
16]. LncRNA HULC, which was highly upregulated in liver cancer, was discovered as an oncogene in glioma [
17]. Another lncRNA MALAT1 (metastasis-associated lung adenocarcinoma transcript 1), which was initially found to be highly expressed in lung cancer and was a favorable prognostic factor for the survival of patients with stage I non-small-cell lung cancer (NSCLC), was demonstrated to have a tumor suppressive role in glioma by attenuating ERK/MAPK-mediated growth and MMP2-mediated invasiveness [
18]. This is the first time that lncRNA PTCSC3 was reported in glioma. LncRNA PTCSC3 initially demonstrated that it was a susceptible gene in papillary thyroid carcinoma and that is also maintains the role of inhibition in thyroid cancer invasion [
9,
10]. Our results showed that lncRNA PTCSC3 was downregulated in glioma cells. The analysis of tumor cell proliferation and invasion abilities in lncRNA PTCSC3-elevated cells showed the inhibitory role of lncRNA PTCSC3 in glioma, which is similar to its role in thyroid cancer.
To elucidate the possible mechanism by which lncRNA PTCSC3 regulates the proliferation and invasion of glioma cell, qRT-PCR and western blot analysis of the key molecular factors of EMT-associated biomarkers, including E-cadherin, fibronectin, Snail and ZEB1, were assessed in our study. EMT is a process involved in embryonic development, during which cells lose their epithelial features and adopt characteristics of mesenchymal cells. The EMT also plays a role in cancer invasion and metastasis in a sequence of discrete steps [
19,
20]. Decreased expression of the epithelial marker E-cadherin and increased expression of mesenchymal markers, such as N-cadherin and fibronectin, are the most important features of EMT [
21]. Transcriptional repressors Snail and ZEB have critical roles in regulating the EMT [
22‐
24]. The activation of these transcriptional factors results in induction of the EMT phenotype [
25]. Among the EMT markers we evaluated, the overexpression of lncRNA PTCSC3 led to the downregulation of E-cadherin and upregulation of Fibronectin, Snail and ZEB1, indicating that overexpression of lncRNA PTCSC3 represses the EMT.
EMT activation is induced by a variety of signaling pathways [
26‐
28]. Here, we investigated the Wnt/β-catenin signaling pathway in glioma cell lines. Wnt signals are transduced across the membrane by low-density lipoprotein receptor–related protein (LRP) receptors [
29]. According to our result, LRP6 was inactivated when lncRNA PTCSC3 was overexpressed. The APC/Axin/GSK/β-catenin-complex has been called a “destruction complex” in Wnt signaling [
30]. In normal conditions, the complex remains stable. When Axin dissociates, β-catenin translocates to the nucleus and activates the transcription of specific target genes, such as c-Myc and cyclin D1 [
31]. Previous reports indicate that the separation of the “destruction complex” leads to an increase in Axin1 protein expression and a concomitant decrease in β-catenin the cellular environment [
32]. Our data revealed results similar to previous studies indicating that dissociation of the complex resulted in an increase in Axin1 and a reduction in active β-catenin as well as the subsequent inactivation of c-Myc and cyclin D1. The dissociation of the “destruction complex” was initiated by the inactivation of LRP6, which was primarily controlled by the overexpression of lncRNA PTCSC3.
Matrix metalloproteinases (MMPs) digest extracellular substrates and promote invasion of blood vessels and lymphatics in the spread of cancers [
33]. MMP2 and MMP9 are induced by the EMT pathway and promote post-EMT invasion of underlying tissues [
21]. Another study also generalized that MMP-2 and MMP-9 are activated by Snail [
34]. Moreover, MMPs degrade E-cadherin, disrupting adhesive junctions, to facilitate the EMT [
35]. Unsurprisingly, this study showed that MMP2 and MMP9 expression was downregulated in lncRNA PTCSC3-overexpressing cells, concomitant with the elevated expression of E-cadherin.
Our study illuminated a complicated mechanism network of how lncRNA PTCSC3 regulated glioma progression. As it was indicated, Wnt/β-catenin signaling pathway was initiated by LRP6, which was the target of lncRNA PTCSC3; the “destruction complex” was separated, resulting in a series of downstream alterations (Axin1, C-myc, Cyclin D1, etc.). The activation of Wnt/β-catenin signaling pathway induced EMT activation, which could also be regulated by Snail and ZEB1. The expression of MMP2 and MMP9 were downregulated, which was induced by the activation of EMT. In return, the decreased expression of MMP2 and MMP9 could also lead to an accumulation of E-cadherin.