Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype

The cell culture medium RPMI 1640 and Dulbecco’s modified Eagle’s medium (DMEM), fetal calf serum (FCS), antibiotics, and trypsin were obtained from Invitrogen (Waltham, MA, USA). LPA (1-oleoyl-2-hydroxy-sn-glycero-3-phosphate; LPA18:1) was from Sigma-Aldrich (St. Louis, MO, USA). The pharmacological LPAR5 antagonist [5-(3-chloro-4-cyclohexylphenyl)-1-(3-methoxyphenyl)-1H-pyrazole-3-carboxylic acid] (TCLPA5) was from Echelon Tocris (Bristol, UK). CRT0066101, a PKD family antagonist, was a generous gift from Dr. Christopher Ireson (Cancer Research Technology, London, UK). Anti-PKD₁ PKD1 and anti-phospho-PKD1 (pPKD1, Ser^744/748) rabbit antibodies were from Cell Signaling (Beverly, MA, USA), anti-PKD2  and anti- pPKD2 (Ser⁸⁴⁸) rabbit antibodies were from Abcam (Cambridge, UK), and mouse anti- PKD3 antibody was from Santa Cruz (San Diego, CA, USA). Antibodies against cyclooxygenase-2 (COX-2) and arginase-1 (Arg-1; used only for western blotting) were from Cell Signaling (Beverly, MA, USA), and inducible nitric oxide synthase (iNOS) antibody was from BD Biosciences (San Jose, CA, USA). For immunofluorescence, the COX-2 and Arg-1 antibodies were from Santa Cruz (Dallas, TX, USA), and the antibodies against RELMα (FIZZ-1) and iNOS were from Abcam (Cambridge, UK). Anti-ionized calcium-binding adapter molecule 1 (Iba-1) was from Wako Chemicals (Neuss, Germany), and the CD11b antibody was from Novus Biologicals (Littleton, CO, USA). PE-CD40, APC-CD86, and PE-CD206 antibodies and their isotype controls were from e-Bioscience (San Diego, CA, USA). Antibodies against non-phosphorylated and phosphorylated mitogen-activated protein kinases ERK1/ERK2, p38 MAPK, JNK, and AKT, p65-NF-κB, c-Jun, STAT1, and STAT3 were from Cell Signaling (Beverly, MA, USA). Cyanine (Cy-2/Cy-3)-labeled antibodies were from GE Healthcare (Vienna, Austria). MISSION lentiviral transduction particles (shPKD1 and shPKD2), MISSION non-mammalian short hairpin RNA (shRNA) control transduction particles, poly-d-lysine (PDL) hydrobromide, FITC-conjugated tomato lectin, monoclonal anti-mouse β-actin (clone AC-74), and β-tubulin antibodies were from Sigma-Aldrich (St. Louis, MO, USA). All primers and kits used in qRT-PCR were from Qiagen (Hilden, Germany).

The murine microglial cell line BV-2 was from Banca Biologica e Cell Factory (Genoa, Italy). Cells were grown and maintained in the RPMI 1640 medium supplemented with 10% FCS, 1% penicillin, 1% streptomycin, and 10 ml l-glutamine (200 mM) at 37 °C in a humidified incubator under 5% CO₂ and 95% air. The culture medium was changed to fresh medium every 2 or 3 days. When cells reached confluence, cells were split or used for experiments.

PMM were isolated and purified from C57BL/6 cortices of neonatal (P0–P4) mice as previously described [43]. In brief, the brain cortices were isolated from the whole brain, stripped from their meninges, and minced with scissors into small pieces. Glial cells were separated by trypsinization (0.1% trypsin, 20 min, 37 °C, 5% CO₂), and the cell suspension was cultured in 75-cm² tissue culture flasks precoated with 5 mg/ml PDL in DMEM containing 15% FCS, 1% penicillin/streptomycin, and 10 ml l-glutamine. After 3 days in culture, the medium was changed to fresh DMEM containing 10% FCS and cells were cultured for another 10 to 14 days. Microglia were removed from the mixed glial cell cultures by smacking the culture flasks 10–20 times and seeded onto PDL-coated cell culture plates for future use. The purity of PMM was determined by immunocytochemistry (using CD11b immunostaining or tomato lectin staining) and was always > 95%.

Murine neuronal CATH.a cells (ATCC) were grown and maintained in the RPMI 1640 medium supplemented 10% horse serum, 5% FCS, 1% penicillin/streptomycin, 0.4% HEPES, and 0.2% sodium pyruvate at 37 °C in a humidified incubator under 5% CO₂ and 95% air. The culture was maintained by transferring floating cells to additional flasks. When cells reached confluence, they were split into new flasks (subcultivation ratio of 1:4) using 0.12% trypsin without EDTA or used immediately for the experiments.

Cells (BV-2 or PMM) were plated in 6-, 12-, or 24-well plates (PDL-coated in case of primary microglia) and allowed to adhere for 2–3 days. Cells were always incubated in serum-free medium overnight before the medium was changed to serum-free RPMI (BV-2) or DMEM (PMM) containing 0.1% fatty acid-free bovine serum albumin (BSA; control) or DMEM containing 0.1% BSA or LPA (1 μM). BSA was used as an LPA carrier. Aqueous LPA stock solutions (5 mM) were stored at − 70 °C. Only freshly thawed stocks were used for the experiments.

TCLPA5 is a specific inhibitor for LPAR5 [55], and CRT0066101 [56] is a PKD family inhibitor. CRT0066101 exhibits high selectivity for PKDs not interfering with the activity of a panel of > 90 protein kinases, including PKCα, MEK, ERK, c-Raf, and c-Src [56]. Both inhibitors were diluted in DMSO (stock concentrations 100 and 10 mM, respectively) and kept at − 20 °C. TCLPA5 solutions are stated to be stable at − 20 °C for a maximum of 40 days. During the experiments, TCLPA5 and CRT0066101 were used at a final concentration of 5 and 1 μM, respectively. Cells were preincubated with the antagonists as stated for each experiment.

BV-2 cells (seeded onto six-well plates at a density of 1 × 10⁵ cells/well) or PMM (cultured on PDL-coated 12-well plates at a density of 5 × 10⁵ cells/well) were used for analyses of PKD isoforms’ expression and the phosphorylation state of PKDs, JNK, AKT, ERK1/ERK2, and p38 MAPK, p65-NF-κB, c-Jun, STAT1, and STAT3. Culture medium was removed, and cells were washed twice with ice-cold PBS. The cells were lysed in RIPA buffer (50 mM Tris-HCl (pH 7.4), 1% NP-40, 150 mM NaCl, 1 mM Na₃VO₄, 1 mM NaF, 1 mM EDTA) containing protease inhibitors (aprotinin, leupeptin, pepstatin, 1 μg/ml each; Sigma-Aldrich), 10 μM PMSF, and phosphatase inhibitor cocktail (Thermo Scientific, Waltham, MA, USA) and then scraped and centrifuged at 13,000 rpm for 10 min. Protein content was determined using the BCA kit (Thermo Scientific) and BSA as standard. Protein samples (100 μg) were separated on 10% SDS-PAGE gels and transferred to polyvinylidene difluoride membranes. Membranes were blocked with 5% low-fat milk in Tris-buffered saline containing Tween 20 (TBST) for 2 h at room temperature (RT) and incubated with the primary antibodies overnight with gentle shaking at 4 °C. After removal of primary antibodies, the membranes were washed for 30 min in TBST and incubated for 2 h at RT with anti-rabbit (1:10,000) or anti-mouse (1:5000) as secondary antibodies. Following three washing steps with TBST for 1 h, immunoreactive bands were visualized using ECL or ECL plus reagents and detected with a chemiluminescence detection system (ChemiDoc; Bio-Rad, Berkeley, CA, USA). In some cases, the membranes were stripped using a stripping buffer (140 μl β-mercaptoethanol in 20 ml of 60 mM Tris/2% SDS (pH 6.8) buffer) under gentle shaking for 30 min at 50 °C in a water bath, washed for 1 h in TBST, blocked with 5% low-fat milk in TBST for 1 h at room temperature, and probed with the pan antibodies for PKD1, PKD2, JNK, AKT, ERK1/ERK2, and p38 MAPK, p65-NF-κB, c-Jun, STAT1, and STAT3. β-actin or β-tubulin was used as loading controls.

Double immunofluorescence was carried out in BV-2 and PMM. Cells were seeded in chamber slides (PDL-coated in case of primary cells) at a density of 1.5 × 10⁴ and 3 × 10⁴ cells/well, respectively. Cells were serum-starved overnight and incubated in the absence or presence of LPA or LPA plus inhibitors as indicated. Cells were washed with prewarmed PBS, fixed with paraformaldehyde (4% in 0.1 M PBS) for 15 min, and permeabilized with 0.5% Triton X-100/PBS for 10 min at 25 °C. Following three washing steps with PBS, cells were incubated with blocking buffer (Thermo Scientific, Waltham, MA, USA) for 1 h at 4 °C and incubated with the primary antibody (1:50) overnight at 4 °C. The slides were then washed with PBS and incubated with fluorescently labeled secondary antibody (1:200) for 30 min. All slides were washed three times with PBS stained with Hoechst 33342 (Invitrogen, Waltham, MA, USA) and mounted using a mounting medium (Dako, Vienna, Austria). Confocal fluorescence microscopy imaging was performed using a Leitz/Leica TCSSP2 microscope (Leica Lasertechnik GmbH, Heidelberg, Germany). Quantitation of fluorescence intensity and morphological analysis were performed with ImageJ. At least 50 cells out of three different areas per chamber were analyzed.

PMM were cultured on PDL-coated 24-well plates at a density of 1.2 × 10⁵ cells/well. Polybrene (8 μg/ml) solution and viral particles (multiplicity of infection = 2) were added onto cultured microglia. We used shRNA control transduction lentiviral particles and PKD1-specific (shPKD1 NM_008858, clone ID: TRCN0000024007, sequence: CCGGCCTTCAGCTTTAACTCCCGTTCTCGAGAACGGGAGTTAAAGCTGAAGGTTTTT) and PKD2-specific (shPKD2 NM_178900, clone ID: TRCN0000322346, sequence: CCGGGTACGACAAGATCCTGCTCTTCTCGAGAAGAGCAGGATCTTGTCGTACTTTTTG) constructs. After 12 h of treatment with the shRNA control transduction particles and the PKD1 and PKD2 silencing constructs, the medium was replaced by a prewarmed conditioned medium prepared from mixed glial cultures after centrifugation and filtration through a 0.45-μm filter. Cells were kept at 37 °C/5% CO₂ for 72 h and collected to validate silencing efficacy by qPCR or to proceed with the experiments described below.

BV-2 cells and PMM were seeded onto 24-well plates at a density of 2 × 10⁴ and 5 × 10⁴ cells/well, respectively. Cells were cultured in serum-free medium overnight and then treated with the indicated concentrations of LPA, with LPA plus DMSO (to account for vehicle effects), or with 1 μM LPA in the absence or presence of TCLPA5 (5 μM) or CRT0066101 (1 μM). Control cells were incubated in serum-free medium in the absence or presence of DMSO (negative controls) or treated with N-arachidonylglycine (NAGly; 1 μM; Sigma-Aldrich).

For silencing experiments, PMM (non-transduced or transduced with lentiviral particles containing sh-scrambled, shPKD1 or shPKD2) were cultured on PDL-coated 24-well plates at a density of 1.2 × 10⁵ cells/well. After transduction, the cells were incubated in serum-free medium in the absence or presence of LPA (1 μM).

Images were acquired every 20 min for 24 h at five different positions of each well using a Zeiss Cell Observer microscope. Data analysis was carried out using ImageJ. Image intensity correction was achieved by correcting each image median value to 125 (8-bit images have a resolution of 255-Gy levels). Image stabilization was achieved using the Lucas-Kanade method with a macro for ImageJ (K. Li, “The image stabilizer plugin for ImageJ” http://​www.​cs.​cmu.​edu/​~kangli/​code/​Image_​Stabilizer.​html; ^®Kang Li) to correct for changes in position due to mechanical tolerances in the microscope stage. Equalization of low-frequency variations in the background signal of the image using an FFT bandpass filtering and reducing low- and high-frequency changes in the images (low-frequency filter set to 40 pixels and high-frequency filter set to 6 pixels) enabled simple thresholding of the images. After thresholding, which allowed object selection, a Gaussian blur was applied. The resulting TIFF images were analyzed using ImageJ inherent functions. The ImageJ Manual Tracking plug-in was used to manually track the cells. In random, a minimum of 20 viable cells per condition was selected and followed. Using the ImageJ Chemotaxis and Migration Tool plug-in, the accumulated distance (the total cell path traveled by the cell), the Euclidean distance (the distance between the start and end points), and cell velocity were calculated. Experiments were repeated at least two times.

BV-2 cells were cultured in six-well plates at a density of 3 × 10⁵ cells/well and incubated in serum-free RPMI or pretreated with TCLPA5 (5 μM) or CRT0066101 (1 μM) for 3 h. Chemotaxis assays were carried out using CIM-16 well plates and an xCELLigence RTCA-DP instrument (Roche Diagnostics, West Sussex, UK). LPA solutions were prepared at the desired concentrations, and 160 μl of them was loaded in the lower wells of the CIM-16 plate. NAGly and serum-free medium served as positive and negative chemotaxis controls, respectively.

Following upper chamber attachment, the upper wells were first filled with 50 μl of prewarmed serum-free medium and the plate was left at RT for 30 min to pre-equilibrate. Cultured cells were trypsinized and resuspended in serum-free medium in the absence or presence of TCLPA5 (5 μM) or CRT0066101 (1 μM). Fifty microliters of the cell suspensions (containing 3 × 10⁴ cells) was placed into the upper wells. The plate was transferred to the RTCA-DP instrument, and data were collected every 5 min over 24 h. As cells pass through the pores of the filter with an embedded gold microelectrode, an increase in electrical impedance corresponds to increased numbers of migrating cells (cell index). Data were normalized and analyzed using the RTCA software 1.2.1. Experiments were performed at least three times in triplicate.

BV-2 cells (24-well plates, 5 × 10⁴ cells/well) or PMM (PDL-coated 24-well plates, 2.5 × 10⁵ cells/well) were incubated in serum-free medium overnight and then treated with LPA (1 μM), LPA plus DMSO, LPA plus TCLPA5 (5 μM), or LPA plus CRT0066101 (1 μM). As negative controls, cells were incubated in serum-free medium in the presence of 0.1% BSA or DMSO. Total RNA was extracted using the RNeasy Mini or RNeasy Micro kit, respectively (Qiagen, Hilden, Germany), and quantitated using NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA). RNA was reverse-transcribed using the SuperScript^® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR^® Green PCR kit (Qiagen, Hilden, Germany). Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration. Expression profiles and associated statistical parameters were analyzed using the relative expression software tool (REST; http://​www.​gene-quantification.​de/​rest-index.​html) using a pairwise re-allocation test. Gene-specific primers were purchased from Qiagen, and the primer sequences of target genes are listed in Table 1.

IL-1β, TNF-α, IL-6, CCL5 (RANTES), CXCL2 (MIP-2), and CXCL10 (IP-10) concentrations in the cellular supernatants were quantitated using the murine ELISA development kits (PeproTech, NJ, USA) [43]. Briefly, BV-2 and PMM were seeded in triplicate onto 12-well and PDL-coated 24-well plates at a density of 5 × 10⁴ and 2.5 × 10⁵ cells/well, respectively. After overnight serum starvation, cells were incubated in serum-free medium containing LPA (1 μM) in the absence or presence of the antagonists for the indicated time periods. For each time point, the supernatants were collected and kept at − 70 °C until further use. The assays were performed according to the manufacturer’s instructions. Standard curves for each ELISA were done in triplicates. The concentrations of the cytokines and chemokines were determined using the external standard curve.

iNOS activity was assessed indirectly using the total nitric oxide assay kit (Enzo Life Sciences, Switzerland). In this Griess assay, nitrate is reduced to nitrite by means of nitrate reductase. The accumulated total nitrate levels were measured in the supernatant of cells that were incubated in serum-free medium, containing LPA in the absence or presence of the antagonists for 24 or 48 h. Fifty microliters of the supernatant from each sample was processed according to the manufacturer’s protocol. The total nitrate concentration per sample was determined using the external calibration curve (0–100 μM nitrate).

Intracellular reactive oxygen species (ROS) levels were measured using the DCFDA cellular ROS detection kit (Abcam, Cambridge, UK). After internalization and subsequent hydrolysis, the redox indicator probe carboxy-H₂DCFDA is converted to carboxy-H₂DCF, which, in the presence of oxidant species, is converted to fluorescent carboxy-DCF [57]. BV-2 cells were seeded in black clear-bottom 96-well plates at a density of 5 × 10⁴ cells/well [43]. Cells were allowed to adhere overnight and then incubated with 20 μM DCFDA for 40 min at 37 °C in the dark. The solution was removed, and the cells were incubated in serum-free medium, containing LPA in the absence or presence of the antagonists for 3 and 6 h. Fluorescence intensity was measured with excitation and emission wavelengths of 485 and 535 nm, respectively.

Lactate dehydrogenase (LDH) activity was used as an indicator of cytotoxicity (Cayman Chemical, Ann Arbor, MI, USA) of CATH.a neurons.

BV-2 cells were seeded in triplicate onto 12-well plates at a density of 5 × 10⁴ cells/well. After overnight serum starvation, cells were incubated in serum-free medium, containing LPA in the absence or presence of the antagonists for the indicated time periods. For each time point, the supernatants were collected and kept at − 70 °C until further use.

The CATH.a neurons were seeded in a 96-well plate at a concentration of 1 × 10⁵ cells/well and allowed to adhere. Following overnight serum starvation, the cells were incubated with the supernatants collected from the abovementioned BV-2 cells. Three wells containing only the medium without cells were used for background control. In order to measure maximum and spontaneous release, cells were incubated with 10% Triton X-100 and assay buffer, respectively. Cells were kept at 37 °C (5% CO₂) for 24 h, and then the plate was centrifuged at 1300 rpm for 5 min. One hundred microliters of the supernatants was transferred to a new 96-well plate, and 100 μl of LDH reaction solution was added to each well. The plate was incubated at 37 °C (5% CO₂) for 30 min under gentle shaking, and the absorbance at 490 nm was measured using a plate reader.

All experiments were performed using three or four replicates per experimental group and repeated three times (unless otherwise stated). For statistical analysis, data obtained from independent measurements are presented as mean + SD or mean + SEM as indicated in the figure legend. Statistical tests were performed using the GraphPad Prism (version 5.0a) for Mac (GraphPad Software, Inc., San Diego, CA, USA). Data were analyzed by one-way ANOVA followed by the Bonferroni post hoc test or unpaired Student’s t test. In the case of qPCR experiments, the expression profiles and associated statistical parameters were analyzed using the REST (http://​www.​gene-quantification.​de/​rest-index.​html) using a pairwise re-allocation test. Values of p < 0.05 were considered significant, unless otherwise stated.

PKD expression analysis in BV-2 and PMM by qPCR revealed that BV-2 cells express PKD2 and PKD3 (Fig. 1a; with mean Ct values: PKD2 25.8 and PKD3 24.9), while PMM express mRNA for all three PKD family members (Fig. 1b; mean Ct values: PKD1 29.0, PKD2 26.9, and PKD3 24.9). PKD1–3 protein was detected in mouse brain lysates, in the cortex, and in PMM. In line with mRNA data, protein expression levels of only PKD2 and PKD3 were detected in BV-2 cells (Fig. 1c).

In BV-2 cells, LPA induced phosphorylation of PKD2, JNK, AKT, ERK1/ERK2, and p38 MAPK (Additional file 1: Figure S1). Preincubation with TCLPA5 (an LPAR5 inhibitor) (0.5–8 h) prior to subsequent treatment with LPA (1 μM) in the presence of the inhibitor revealed that the antagonist suppressed activation of downstream signaling proteins (Additional file 1: Figure S1A) that regulate microglial function. Bar graphs in Additional file 1: Figure S1B represent densitometric evaluation of the western blots. Inhibition of PKD isoforms with CRT0066101 (a PKD family inhibitor) suppressed the LPA-induced activation of PKD2, JNK, AKT, ERK1/ERK2, and p38 MAPK (Additional file 2: Figure S2A). Densitometric evaluation is shown in Additional file 2: Figure S2B.

In PMM, activation of PKD1 and PKD2 was observed after 10 min, reached a maximum after 20 min, and then decreased (Fig. 2). This PKD activation pattern correlated with the time course of JNK, AKT, ERK1/ERK2, and p38 MAPK phosphorylation (data not shown). In the presence of TCLPA5 or CRT0066101, phosphorylation of PKD1 and PKD2, JNK, AKT, ERK1/ERK2, and p38 MAPK was significantly attenuated (Fig. 2a). Bar graphs in Fig. 2b represent densitometric evaluation.

PKDs translocate between different cellular compartments to be able to fulfill their functions in response to activation [58]. Therefore, we studied subcellular localization of endogenous PKD in BV-2 cells and PMM in response to LPA. In unstimulated BV-2 cells, tubulin and PKD2 was detected mainly at perinuclear areas (Fig. 3a, upper panel). After LPA stimulation (Fig. 3a, lower panel), cell area increased and induced the formation of new tubulin-positive plasma membrane protrusions, likely lamellipodia. PKD2 translocated to newly formed tubulin-positive membrane projections (Fig. 3a, lower panel).

In untreated PMM, PKD1 shows nuclear and cytosolic (in cellular protrusions/extensions) staining (Fig. 3b, upper panel). In response to LPA, PMM acquired a flattened morphology (tomato lectin staining) and a major part of originally cytosolic PKD1 translocated to the nucleus (Fig. 3b, lower panel). In contrast, PKD2 translocation in response to LPA is less pronounced in PMM (Fig. 3c). No nuclear PKD2 staining was observed in untreated or LPA-treated cells. In the absence of LPA, the majority of PKD2 was detected in membrane protrusions and as diffuse staining in the cytosol (Fig. 3c, upper panel). In response to LPA, PKD2 was (as in untreated cells) still detected in the cytosol (Fig. 3c, lower panel).

During earlier work, we unraveled LPAR5 as a critical receptor that controls an LPA-induced pro-inflammatory microglial phenotype [43]; here, we determined downstream signaling pathways that are activated by LPAR5. These experiments indicated that LPA induced phosphorylation of IKK, IκB, p65-NF-κB, STAT1, STAT3, and c-Jun in BV-2 cells (Additional file 3: Figure S3A). Pharmacological inhibition of LPAR5 and PKD1–3 by TCLPA5 and CRT0066101, respectively, attenuated phosphorylation of all transcription factors analyzed (Additional files 4 and 5: Figures S4 and S5). In primary microglia, phosphorylation of p65-NF-κB, STAT1, STAT3, and c-Jun was detectable after 2 or 8 h and gradually declined afterwards (Fig. 4a). Phosphorylation of p65-NF-κB remained upregulated until 24 h post LPA treatment. Inhibition of LPAR5 and PKD1–3 effectively mitigated transcription factor phosphorylation at both time points analyzed (Fig. 5).

Following a chemotactic signal, microglia migrate towards the site of lesion and activate transcriptional programs that result in phenotypic transformation. We chose to analyze the effect of LPA on a selected set of migration/invasion-related genes in PMM in the absence or presence of the LPAR5/PKD inhibitors. Two hours post LPA (1 μM) treatment, Mmp9, Mmp14, Wasf2, and Vegfa gene expression was upregulated. At 8 h, Itga5, Vasp, Wasf2, and Vegfa were increased more than twofold and returned to or below baseline after 24 h (Fig. 6). Inhibitor studies revealed that both TCLPA5 and CRT0066101 reversed the effects of LPA on Itga5, Itgav, Mmp9, Mmp14, Vasp, Wasf2, and Vegfa expression (Fig. 7).

In the presence of LPA, BV-2 cells (Fig. 8a) and PMM (Fig. 8b) changed morphology. This transformation was associated with increased cell area, cell perimeter, and Iba-1 fluorescence intensity (bar graphs in Fig. 8). LPAR5 antagonism by TCLPA5 significantly attenuated LPA-mediated morphological alterations and Iba-1 fluorescence in both BV-2 and primary microglia (Fig. 9a, b). In line with biological functions in other cells, the pan PKD antagonist CRT0066101 repressed the morphological transformation of both cell types (Fig. 9a, b). These data indicate that LPAR5 acts as a sensor and at least one member of the PKD family acts as a transducer of LPA-mediated signals that impact microglial morphology and activation.

Having established activation of signaling cascades that are potential drivers of cell locomotion and morphological transition, we examined the impact of LPA on microglial chemokinesis and chemotaxis. Using time-lapse video microscopy, we analyzed the tracks of individual control and LPA-treated BV-2 cells (Fig. 10a). The concentration-dependent migrational response of BV-2 cells to LPA (Fig. 10b) is bell-shaped, reaching a maximum at 1 μM and returning almost to baseline at 5 μM of LPA. The mean velocity of unstimulated cells was 0.6 μm/min and increased twofold in response to 1 μM LPA (Fig. 10b). The total accumulated migration distance increased twofold (Fig. 10c, control vs. 1 μM LPA), and the Euclidean distance increased threefold (Fig. 10d, control vs. 1 μM LPA).

Chemotaxis experiments were performed in real time using the xCELLigence system. Migration of serum-starved cells across uncoated CIM plates was studied in the absence or presence of LPA in the lower chamber of the Transwell inserts. NAGly that drives migration through GPR18 [59] was used as positive control. LPA induced directional migration at 0.5 and 1 μM LPA as compared to controls (Fig. 10e). LPA at 2 μM had no effect on directional migration. NAGly induced a twofold higher increase in migration as observed for 1 μM LPA (Fig. 10e). PMM also responded to LPA with increased chemokinesis. Tracks of primary cells studied in the absence (left panel) or presence (right panel) of LPA are shown in Fig. 10f. LPA treatment increased cell velocity (2-fold) as well as accumulated (1.8-fold) and Euclidean (1.5-fold) distances (Fig. 10g–i).

Pharmacological antagonism of LPAR5 or PKD by TCLPA5 or CRT0066101 effectively attenuated chemokinesis of BV-2 cells (Fig. 11a–c). Chemotaxis experiments using BV-2 in the xCELLigence system (Fig. 11d) revealed that both inhibitors decreased migration to the lower chamber. Statistical evaluation of relative impedance values (24-h LPA treatment) is shown in Fig. 11e. Both TCLPA5 and CRT0066101 decreased chemokinetic parameters of PMM back to baseline values (Fig. 11f–h).

To be able to differentiate between effects mediated by PKD1 and/or PKD2 on the migration of PMM, we chose an shRNA approach. Silencing of PKD1 and PKD2 was efficient (in comparison to PMM transduced with scrambled shRNA, levels were reduced by 80 and 60%, respectively), and no effect on the non-targeted isoform was observed (Fig. 12a). Stimulation of scr-shRNA-transduced cells with LPA resulted in increased chemokinesis (Fig. 12b–d). Silencing of PKD1 had no effect, while PKD2 silencing resulted in complete inhibition of chemokinesis. Next, we sought to examine the impact of PKD1/PKD2 silencing on the selected set of migration/invasion-related genes. We observed that only two (Wasf2 and Vegfa) out of the seven LPA-upregulated genes (Fig. 6) were differentially affected by PKD1 and PKD2 silencing: PKD1 silencing had no significant effects on Wasf2 and Vegfa expression, while PKD2 silencing reduced the expression of both genes to or below baseline levels (Fig. 12e).

We have previously shown that LPA induces cytokine and chemokine secretion in microglia in an LPAR5-dependent manner [43]. Here, we show that IL-6, CXCL10, TNF-α, CXCL2, IL-1β, and CCL5 secretion was upregulated by LPA in BV-2 cells and significantly reduced by CRT0066101 (Additional file 6: Figure S6). Similar effects were observed in primary microglia (Fig. 13).

We performed immunofluorescence staining and analysis using confocal microscopy (Fig. 14). These experiments revealed induction of iNOS and COX-2 in response to LPA (1 μM; 24 h), while the M2 markers Arg-1 and RELMα were decreased. Pretreatment with CRT0066101 attenuated iNOS and COX-2 expression whereas Arg-1 and RELMα levels were slightly increased (Fig. 14, bar graphs). Immunoblotting experiments supported the abovementioned results. Treatment with CRT0066101 reduced LPA-dependent COX-2 expression and increased expression of the M2 marker Arg-1 (Fig. 15a). Bar graphs represent densitometric evaluation of immunoreactive bands of three independent experiments (Fig. 15a, right panel). Using flow cytometry, we then analyzed the expression pattern of different surface markers in LPA-stimulated BV-2 cells in the absence or presence of CRT0066101. As shown in Fig. 15b, PKD inhibition abrogated LPA-induced CD40 and CD86 expression, whereas CD206 levels were unaffected at all time points investigated (Fig. 15b).

We further examined the impact of CRT0066101 on ROS and nitric oxide (NO) production in BV-2 cells. LPA increased ROS and NO concentrations, while both were significantly reduced by PKD antagonism (Fig. 15c, d). Finally, we determined potential neurotoxicity of the LPA-induced BV-2 secretome. CATH.a neurons were incubated with conditioned media collected from LPA-treated (in the absence or presence of TCLPA5 or CRT0066101) BV-2 cells. Neuronal cell death was quantified using an LDH activity kit. BV-2 medium collected from LPA-stimulated cells was cytotoxic for CATH.a neurons as evident from the fourfold increase in LDH activity (Fig. 15e). In contrast, the medium obtained from LPA-treated microglia in the presence of LPAR5 or PKD inhibitor did not affect neuronal viability.