Introduction
Lupus nephritis (LN) is a severe clinical manifestation of Systemic Lupus Erythematosus (SLE). Patients diagnosed in childhood (< 18 years) have a higher prevalence of LN (up to 80%) and a faster rate of damage accrual in the kidney compared to their adult counterparts [
1‐
4]. Flares of LN occur throughout the disease course and each flare increases the risk of permanent damage by increasing damage accrual within the kidney [
5]. LN is initiated by binding of autoantibodies to antigens expressed by native kidney cells [
6]. Mesangial cells (MCs) express high levels of antigens that are bound by autoantibodies, including Annexin II and α-actinin, and thus are targets for damage in LN [
7,
8]. Binding of autoantibodies to MCs leads to rapid internalisation and initiation of an inflammatory response, an early phase marker of glomerulonephritis in NZB/W F1 mice [
9]. The response of MCs to autoantibody binding in lupus nephritis has been extensively studied and it has been demonstrated that an immune response is generated. However, the response of MCs to the inflammatory process itself occurring within LN has yet to be fully investigated.
MCs comprise approximately a third of the cell population within the glomerulus. They play important roles in homeostasis by maintaining the structural architecture of the glomerulus, producing and maintaining the mesangial matrix, regulating the filtration surface area and phagocytosing apoptotic cells or immune complexes [
10]. MCs are similar to smooth muscle cells but with modified functions. They have the ability to contract which allows them to contribute to maintaining the structural architecture of the glomerulus and regulate the filtration surface area, but they are also involved in the immune response of the glomerulus [
11].
In response to damage (both immune complex deposition and cytokine-induced) MCs contribute to fibrotic changes that are occurring within the glomerulus by undergoing hypertrophy and proliferation. This has been demonstrated both in vitro and in vivo, as well as in biopsy samples taken from LN patients [
12,
13]. In addition to hyperproliferating, MCs deposit increased extracellular matrix proteins and increase production of matrix metalloproteinases, resulting in glomerular remodelling [
14,
15].
This study aimed to delineate the roles of MCs in the pathogenesis of LN using a cytokine-based, in vitro model with cytokines known to be up-regulated in the sera of patients with active LN [
16‐
19]. Further this study attempted to recapitulate this using a more physiological model in which MCs are treated with sera from patients with LN.
Discussion
LN is a severe manifestation of juvenile-onset SLE and is, alongside infection and cardiovascular disease, a major cause of SLE-associated morbidity and mortality in these children [
3]. MCs are important contributors to the fibrotic damage seen in glomerular diseases as they respond to injurious stimuli by proliferating and producing increased levels of ECM proteins [
12‐
15]. Delineating the path by which these changes occur may unveil new avenues for investigation in LN therapy.
To mimic the inflammatory environment of the LN kidney in vitro a model was designed using key cytokines known to be upregulated in the sera of patients with active LN compared to inactive disease and HCs [
16‐
19].
The contribution of MCs to the inflammatory milieu within the kidney was investigated by assessing the levels of pro-inflammatory cytokines and chemokines produced by MCs in response to the in vitro model. This study demonstrated that MCs express IL-6, IL-8 and IL-10 under normal conditions. This correlates with previously published data that demonstrated that IL-10 is essential for maintaining homeostasis within the kidney [
22] and low levels of IL-6 and IL-8 are expressed by MCs in vitro [
23,
24]. In response to the cytokines in our model, the levels of all three cytokines significantly increased. High levels of IL-6, IL-8 and IL-10 are important for the recruitment and maturation of neutrophils, B cells and T cells to the glomerulus [
25]. In this model, M-CSF was not expressed/very lowly expressed by untreated MCs but was released at high levels following inflammatory stimulation. M-CSF is involved in the recruitment and maturation of macrophages [
25]. It is important to note that a previous study in murine primary cells demonstrated IL-6 and IL-8 levels of approximately 80 pg/mL and 75 pg/mL respectively [
24]. However, this discrepancy with our findings can be explained by the different cell type analysed. These data demonstrate that in response to inflammatory activation, MCs are potentially playing an important contributory role in the recruitment and activation of immune cells from the circulation, and thus exacerbating the inflammatory response seen.
Further, a more physiological model was used in which sera from patients with LN were used to stimulate MCs and the cytokine levels assessed. This demonstrated that serum treatments were unable to recapitulate the increase in IL-8 seen following cytokine stimulation. Active serum was able to induce an increase in M-CSF secretion compared to untreated MCs while no other treatments had an effect suggesting that something within the active sera was able to induce this secretion that was not present in the other groups. M-CSF levels in the sera were not different between groups. IL-6 and IL-10 were reduced in response to serum treatments, IL-6 levels were below the level of detection for the assay in all sera tested so it is unclear how these may differ between groups. IL-10, however, did not differ between patient groups and all groups reduced MC secretion suggesting that the IL-10 present in the sera may be binding MCs and initiating a negative feedback response, reducing the secretion from MCs.
One of the main known roles of MCs in glomerular injury is the induction of pro-fibrotic changes by remodelling of the ECM. This study identified an increase in the expression of genes responsible for the deposition of ECM proteins in response to the in vitro, cytokine-based model of LN. Increases in
COL1A1,
COL1A2 and
COL1A4 confirm that enhanced deposition of both healthy (type IV) and pathogenic (type 1) collagens are occurring in this model. This mimics what is seen in lupus-prone mice (NZBWF1/J mice) where increased type 1 collagen is seen to be deposited in the early stages of glomerulonephritis development [
26] and in graft-vs-host disease where early deposition of type IV collagen is seen [
27]. Increased collagen IV deposition has also been seen in the mesangium in human LN biopsies [
28]. Further increased deposition of
LAMB1 is occurring, laminin β1 has been shown to be increased in a model of graft-vs-host disease in early disease but then reduces as disease progresses [
29], increased laminin deposition was also seen in two of five human LN biopsies [
28]. It is important to note that in the mouse model laminin deposition occurred only early in disease course and it is unclear at what stage of a flare a biopsy would have been taken in the human disease cohort.
When the MCs were treated with LN patient sera there were significant increases noted for active disease sera in collagen I and a trend towards an increase in collagen IV, this suggests that similar changes may be occurring but that these are milder than that seen with cytokines. This may be due to the low concentration of serum used (10%) compared to that seen in blood (45–50%) or potentially due to the immunosuppressant treatment regimens being followed by the patients (Table
1).
Table 1Demographics, renal BILAG scores and medications for LN patients
Age (years) (median [range]) | 15.53 [12.18–16.58] | 14.55 [11.03–17.79] | 14.9 [12.12–16.6] |
Age at diagnosis (years) (median [range]) | 12.8 [6.28–13.29] | 10.46 [6.28–16.88] | – |
Females (%) | 100 (6) | 100 (6) | 100 (6) |
Nationality % (n) |
White British | 16.6 (1) | 33.3 (2) | 100 (6) |
Chinese | 16.6 (1) | 16.6 (1) | 0 |
Somali | 33.3 (2) | 33.3 (2) | 0 |
African | 16.6 (1) | 16.6 (1) | 0 |
Indian | 16.6 (1) | 0 | 0 |
Renal BILAG domains |
Renal Hypertension (%) n | 16.6 (1) | 0 | – |
Urine ACR (mg/dL) (median [range]) | 239.3 [0.7–592.4] | 7.5 [0.8–8.8] |
Renal Creatinine (mg/dL) (median [range]) | 45 [37–62] | 51 [30–61] |
Estimated GFR (mL/min/1.73m2) (median [range]) | 138 [99.8–158.1] | 121.5 [99.1–181.9] |
Medications (n) |
Hydroxychloroquine | 4 | 3 | – |
Azathioprine | 0 | 3 |
Mycophenolate mofetil | 6 | 3 |
Prednisolone | 5 | 5 |
Methotrexate (oral) | 0 | 0 |
Rituximab | 1 | 0 |
Cyclophosphamide | 1 | 0 |
ECM remodelling is a combination of the increased deposition of proteins and increased enzymatic breakdown of these proteins. Therefore, we looked at the mRNA levels of the main enzymes involved in MC remodelling – MMP2 and MMP9, no significant changes in the expression of MMP2 were noted but MMP9 levels were significantly increased in response to treatment with IL-1β and TNF-α. This correlates with a study that demonstrated that at the onset of proteinuria in lupus-prone (NZBxNZW F1) mice there is an increase in proteolytic activity that can be attributed to MMP9 expression [
14]. Further a decrease in the expression of TIMP1 (an MMP inhibitor) was seen with IFN-α and the combination of cytokines treatment suggesting that overall there is a net increase in the activity of these degradation enzymes.
These changes in enzymes were also assessed in MCs following sera treatments and the increase in MMP9 was recapitulated following treatment with active sera while no changes in MMP2 or TIMP1 could be detected.
One of the main drivers of fibrosis is TGF-β1 therefore we looked at levels of TGF-β1 in each of our models to determine whether this could be driving the fibrotic changes we are seeing. At 4 h post-cytokine treatment a significant increase in latent TGF-β1 could be seen and this was decreased at 24 h suggesting the TGF-β1 may be being internalised and eliciting downstream effects. It has previously been shown that in rat mesangial cells TGF-β1 is an autocrine mediator of fibrotic change [
30] and thus could explain this temporal modulation. As it was found that the LN patient sera treatments induced a milder phenotype the expression of latent TGF-β1 was only assessed at 24 h where it was shown to be significantly increased in response to treatment with sera from patients with active disease (renal BILAG A/B). This may suggest that the response to sera treatments is delayed compared to that of cytokine treatments. To differentiate between de novo production of TGF-β1 and levels already present in the sera an ELISA was performed to determine the concentration of latent TGF-β1 in RPMI (+ 10% patient sera). Levels were found to be almost identical to that seen in the conditioned media from MCs. When considering that MCs themselves produce approximately 1 ng/mL TGF-β1 this may suggest that a reduction is occurring through internalisation or that a negative feedback loop is occurring due to the expression of TGF-β1 in the sera.
MCs express ALK5 and through this receptor TGF-β1 can induce downstream ECM remodelling [
31]. An ALK5 blocker SB-431542 was used to inhibit the effects of TGF-β1 in this model and was able to attenuate all ECM remodelling genes previously shown to be up-regulated in our model following cytokine treatment suggesting that this remodelling is occurring via TGF-β1 activity.
Given that mesangial cells do not show increased expression of these markers in response to human sera we are unable to demonstrate the use of TGF-β1 blockade using SB-431542 in a more physiological model, one future possibility may be to demonstrate that mesangial cells show increased expression of these markers in human kidney tissue, such as from kidney biopsies for patients with lupus nephritis or explore mouse models.
Materials and methods
Materials
All recombinant cytokines were purchased from Peprotech, London, UK. All primers were purchased from Eurofins Genomics, Ebersberg, Germany.
Human conditionally immortalised mesangial cell culture
Human conditionally immortalised MCs were kindly provided by Professor Moin Saleem (Children’s Renal Unit and Academic Renal Unit, University of Bristol, Southmead Hospital, Bristol, UK). These cells were conditionally immortalised using the temperature sensitive large T antigen-SV-40 transgene as previously described [
32]. These cells have been shown to differentiate fully by 7–10 days after switching from 33 °C to 37 °C. Cell passages between 15 and 30 were used in all experiments, for all experiments
n = 5–6 independent experiments were used. MCs were routinely cultured in RPMI-1640 medium with L-glutamine (Lonza, Leeds, UK) supplemented with 10% foetal calf serum (ThermoScientific) and insulin transferrin selenium (Sigma-Aldrich, Dorset, UK).
After 7–10 days of differentiation conditionally immortalised MCs were treated with cytokines designed to model the inflammatory environment of the kidney in LN patients, namely: IL-1β, TNF-α, IFN-α and IFN-γ (all known to be involved in the pathogenesis of LN) at 10 ng/mL each alone and in combination (i.e. 10 ng/mL each of IL-1β, TNF-α, IFN-α and IFN-γ altogether). These were chosen as being key cytokines known to be upregulated in the sera of patients with active LN compared to inactive disease and healthy control [
16‐
19]. Following 24 h incubation conditioned media were collected, and RNA was extracted using Trizol (ThermoScientific).
Upon routine clinical visits, patients within the UK JSLE Cohort Study are assessed according to the British Isles Lupus Assessment Group (BILAG) 2004 index [
33,
34]. Following differentiation MCs were also treated with 10% sera from patients with active LN (renal BILAG A/B), inactive LN (renal BILAG D/E) and age- and sex- matched HCs (Table
1). Following 24 h incubation conditioned media were collected, and RNA was extracted using Trizol (ThermoScientific).
Cells were pre-treated for 30 mins with SB-431542 (ALK5 receptor blocker) to inhibit TGF-β1 binding as previously described [
35] before stimulation with the combined cytokine treatment. Following this conditioned media was collected and RNA was extracted using Trizol.
Multiplex
A Luminex magnetic bead assay was purchased from R&D Systems, Abingdon UK which was able to detect IL-6, IL-8, IL-10 and M-CSF. The assay was performed on conditioned media collected from cells treated with cytokines for 24 h according to manufacturer’s instructions to assay protein levels in conditioned media from cytokine-treated MCs. The plate was read using a Merck Millipore Luminex MAGPIX® analyser.
ELISA
TGF-β1, IL-6, IL-8 and M-CSF DuoSets were purchased from R&D Systems, Abingdon, UK. The assays were performed on conditioned media from cells that had been stimulated with cytokines or patient sera for 24 h according to the manufacturer’s instructions to determine protein levels in conditioned media from treated MCs.
qRT-PCR
RNA was extracted from MCs treated with cytokines for 24 h using the RNeasy miniprep kit (Qiagen, Manchester, UK) following the manufacturer’s instructions. The RNA concentration was determined by Nanodrop and 200-500 ng RNA was transcribed into cDNA using either the AffinityScript multi-temp cDNA synthesis kit (Agilent Technologies, Cheshire, UK) following the manufacturer’s instructions for 24 h cytokine treatments or the Primerdesign all-in-one Reverse Transcription mix (Primerdesign, York, UK) following manufacturer’s instructions (for sera and TGF-β1 blocking assays). qRT-PCR was performed using the primers described in (Table
2) with the Brilliant III Ultra-fast SYBR QPCR mastermix kit (Agilent Technologies) following the manufacturer’s instructions (for 24 h cytokine treatments) or the Primerdesign PrecisionPLUS qPCR Master Mix kit (for sera and TGF-β1 blocking assays). The geometric mean of tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein Zeta (YWHAZ), β-actin (ACTB) and TUBB was used as an internal reference control for normalisation and used to calculate the ΔΔCt value.
Table 2List of primers used for qRT-PCR
YWHAZ | ACTGGGTCTGGCCCTTAACT | GGGTATCCGATGTCCACAATGTC |
ACTB | CATTGCGGTGGACGATGGA | AGATCAAGATCATTGCTCCTCCTG |
TUBB | GGACCGCATCTCTGTGTACT | CTGCCCCAGACTGACCAAATA |
COL1A1 | CCACGCATGAGCGGACCCTAA | ATTGGTGGGATGTCTTCGTCTTGG |
COL1A2 | ACAAGGCATTCGTGGCGATA | ACCATGGTGACCAGCGATAC |
COL3A1 | GACCTGGAGAGCGAGGATTG | GTCCATCGAAGCCTCTGTGT |
COL4A1 | GCCAGCAAGGTGTTACAGGATT | AGAAGGACACTGTGGGTCATCTATT |
LAMB1 | CCGGAAAGGAAGACGGGAAG | CGCCAGGTCCTGCTGTTTCTAA |
LAMB2 | CAGGCAGAGTTGACACGGAA | AGCCAGCACGCTTAGCAGTAG |
MMP2 | CCATGAAGCCCTGTTCACCA | CTTCTTGTCGCGGTCGTAGT |
MMP9 | GGCGCTCATGTACCCTATGT | TTCAGGGCGAGGACCATAGA |
TIMP1 | GGAATGCACAGTGTTTCCCT | GCCCTTTTCAGAGCCTTGGA |
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.