Background
Philadelphia-negative (Ph-ve) myeloproliferative neoplasm (MPN) is a stem cell disease with proliferation of myeloid lineage, leading to the development of distinct clinical entities including polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF) [
1‐
3]. JAK2 V617F mutation, resulting in constitutive activation of JAK-STAT signaling, occurs in about half of the patients with ET and PMF but in more than 90% of patients with PV [
1].
Gene methylation is an alternative mechanism of gene inactivation, and various tumor suppressor genes regulating the cell cycle, apoptosis and cell signaling have been shown to be hypermethylated in hematological malignancies [
4].
MicroRNA (miR) is a single-stranded, non-coding RNA molecule of 22-25 nucleotides, which leads to downregulation of target protein expression [
5]. miRs are involved in carcinogenesis [
6]. miRs can be either oncogenic (oncomir) when tumor suppressor genes (TSG) are targeted, or tumor suppressive (tumor suppressor miRs) when oncogenes are targeted [
7].
Recently,
miR-34a, miR-34b/c, miR-124-1 and
miR-203 hypermethylation have been implicated in carcinogenesis. Hypermethylation of
miR-34a, a transcriptional target of p53, has been demonstrated in solid and hematopoietic cancers [
8,
9], whereas restoration of which will inhibit CDK6 translation by complementary binding to the 3' untranslated region (3' UTR) of the
CDK6 mRNA and induce apoptosis, thereby showing the tumor suppressor role of
miR-34a[
8]. Epigenetic inactivation of
miR-34b, another p53 downstream target of the
miR-34 family, has also been implicated in acute myeloid leukemia (AML), and the re-expression of
miR-34b led to suppression of CREB expression and inhibition of cell proliferation [
10]. Promoter methylation of
miR-124-1, the first tumor suppressor miR found to be regulated by DNA methylation, has been shown to confer poor prognosis of acute lymphoblastic leukemia (ALL) [
11]. Moreover, hypermethylation of
miR-203 has been reported in chronic myeloid leukemia (CML), conferring a proliferative advantage to the tumor cells by inhibiting the oncogenic BCR-ABL fusion protein [
12]. In Ph-ve MPN, little is known about the epigenetic alteration of miR methylation. In this report, we studied the methylation status of
miR-34a, miR-34b/c, miR-124-1 and
miR-203 in PV, ET and PMF.
Methods
Patient samples
DNA was extracted from primary marrow samples at diagnosis of 45 patients with MPN [ET, N = 34 (75.5%); PV, N = 8 (17.8%) and PMF, N = 3 (6.7%)]. There were 24 (53.3%) male and 21 (46.7%) female patients with a median age of 67.5 years (range: 28 - 89 years), a median presenting platelet count of 848 × 10
9/L (range: 196 - 2275 × 10
9/L), a median presenting hemoglobin level (Hb) 13.3 g/dL (range: 9-22 g/dL), and a median presenting leukocyte count of 14.4 × 10
9/L (range: 7-28 × 10
9/L). Apart from five (11.1%) patients in whom the presenting symptomatology at presentation were not available for review, 25 (62.5%) were asymptomatic at diagnosis, four (10%) with bleeding, four (10%) with erythromelalgia, two (5%) with minor stroke, three (7.5%) with abdominal pain, and one each (2.5%) with blurred vision and weight loss. Of 39 patients with adequate follow-up information, five (12.8%) had myeloid transformations (MDS or AML) at the time of study. Of 40 patients with data on thrombosis, nine (22.5%) had thrombotic events. Apart from 5 patients with unknown JAK2 mutation status, 26 (65%) had JAK2 V617F mutation. (Table
1) The study has been approved by Institutional Review Board of Queen Mary Hospital with written informed consent.
Table 1
Patient demographic data and status of microRNA methylation
F | 78 | ET | Epigastric pain | No | yes | U | U | M | U |
F | 81 | ET | Epigastric pain | No | yes | U | U | U | U |
M | 32 | ET | erythromelalgia | No | yes | U | U | U | U |
M | 81 | ET | N/A | No | yes | U | U | U | U |
M | 59 | ET | N/A | N/A (No record) | yes | M | U | U | U |
M | 76 | ET | Nil | No | yes | U | M | U | U |
M | 53 | ET | Nil | MDS | yes | U | U | U | U |
F | 89 | ET | Nil | N/A (No record) | yes | U | U | U | U |
F | 43 | ET | Nil | N/A (No record) | yes | M | U | M | U |
F | 82 | ET | Nil | No | yes | U | U | U | U |
M | 78 | ET | Nil | No | yes | U | U | U | U |
F | 79 | ET | Nil | No | yes | U | U | U | U |
M | 84 | ET | Nil | AML | yes | U | U | U | U |
F | 74 | ET | Nil | No | yes | M | U | M | U |
F | 56 | ET | Nil | No | yes | U | U | U | U |
M | 60 | ET | Nil | No | N/A | U | U | U | U |
M | 68 | ET | Nil | AML | yes | U | U | U | U |
M | 39 | ET | Nil | No | yes | U | U | U | U |
F | 79 | ET | Weight loss | No | yes | U | U | U | U |
F | 60 | ET | erythromelalgia | No | no | U | U | U | U |
M | 63 | ET | Minor stroke (LUL numbness) | No | no | U | U | U | U |
M | 47 | ET | erythromelalgia | No | no | U | U | U | U |
F | 62 | ET | erythromelalgia, Headache | No | no | U | U | U | U |
F | 83 | ET | N/A | N/A (No record) | no | U | U | M | U |
F | 32 | ET | Nil | N/A (No record) | no | U | U | U | U |
F | 42 | ET | Nil | No | no | M | U | U | U |
M | 85 | ET | Nil | No | no | U | U | U | U |
M | 71 | ET | Nil | No | no | U | U | U | U |
F | 28 | ET | Nil | No | no | U | U | U | U |
F | 87 | ET | Nil | No | no | U | U | U | U |
M | 48 | ET | Nil | No | no | U | U | U | U |
M | 48 | ET | Nil | No | no | U | U | U | U |
M | 41 | ET | epistaxis | No | N/A | U | U | U | U |
M | 82 | ET | N/A | No | N/A | U | U | U | U |
F | 41 | PMF | Easy bruising | N/A (No record) | yes | U | U | U | U |
M | 67 | PMF | Nil | No | yes | U | U | U | U |
F | 82 | PMF | Nil | No | yes | U | U | U | U |
F | 42 | PV | Minor stroke (RUL paraesthesia) | No | yes | U | U | U | U |
M | 48 | PV | Gum bleeding | No | yes | U | U | U | U |
F | 75 | PV | Nil | AML | yes | U | U | U | U |
M | 78 | PV | Nil | No | yes | U | U | U | U |
M | 57 | PV | Visual blurring (BRAO) | No | yes | U | U | U | U |
M | 44 | PV | abdominal pain (splenic infarction) | No | no | U | U | U | U |
M | 71 | PV | Gum bleeding | MDS | N/A | U | U | U | U |
F | 77 | PV | N/A | No | N/A | U | U | U | U |
Cell lines and culture
MEG-01 and K-562 cells were kindly provided by Dr Mo Yang, Department of Paediatrics, Queen Mary Hospital, The University of Hong Kong, Hong Kong. HEL cells were obtained from Dr Dong-Er Zhang, Department of Pathology and Molecular Biology, Moores Cancer Center, University of California San Diego, USA. SET-2 cells were purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DMSZ) (Braunschweig, Germany). SET-2 was derived from ET at megakaryoblastic leukemic transformation. HEL was derived from AML M6. Both SET-2 and HEL cells carry JAK2 V617F mutation. MEG-01 and K-562 were derived from blastic transformation of patients with CML. Cell cultures were maintained in RPMI media 1640 (Invitrogen, Carlsbad, CA), supplemented with 10% (20% for SET-2) fetal bovine serum (Invitrogen, Carlsbad, CA), 50 U/ml penicillin, and 50 μg/ml streptomycin (Invitrogen, Carlsbad, CA) in a humidified atmosphere of 5% CO2 at 37°C.
Methylation-specific polymerase chain reaction (MSP)
DNA was extracted from bone marrow samples at diagnosis and from cell lines by standard method. MSP for aberrant gene promoter methylation was performed as previously described [
13,
14]. Treatment of DNA with bisulfite for conversion of unmethylated cytosine to uracil (but unaffecting methylated cytosine) was performed with a commercially available kit (EpiTect Bisulfite Kit, Qiagen, Germany). Primers used for the methylated MSP (M-MSP) and unmethylated MSP (U-MSP) were shown in Table
2. DNA from normal bone marrow donors was used as negative control, while enzymatically methylated control DNA (CpGenome Universal Methylated DNA, Chemicon) was used as positive control in all the experiments. MSP was performed in a thermal cycler (9700, Applied Biosystems, Foster City, CA) with the following cycling conditions: 95°C for 5 minutes, specific cycles of 95°C for 30 seconds, specific annealing temperature for 30 seconds (Table
2), 72°C for 30 seconds, and a final extension of 10 minutes at 72°C. The MSP mixture contained 50 ng of bisulfite-treated DNA, 0.2 mM dNTPs, MgCl
2 (Table
2), 10 pmol of each primer, 1 × PCR buffer, and 2.5 units of AmpliTaq Gold DNA Polymerase (Applied Biosciences, Foster City, CA) in a final volume of 25 μl. Ten microliters of PCR products were loaded onto 6% non-denaturing polyacrylamide gels, electrophoresed, and visualized under ultraviolet light after staining with ethidium bromide.
Table 2
MSP primer sequences and reaction conditions
miR-34a
| | | | |
M-MSP | GGGGATGAGGATTAGGATTTC | ACAAAACGCATAAAAACGACG | 1.5 mM/58°C/35 | |
U-MSP | GGGGATGAGGATTAGGATTTT | CAAACAAAACACATAAAAACAACA | 1.5 mM/58°C/35 | |
miR-34b/c
| | | | |
M-MSP | ATTCGTTTCGTTTCGCGTTCGTTTC | CGACTACAACTCCCGAACGATCCG | 2.0 mM/58°C/35 | |
U-MSP | TTTTTATTTGTTTTGTTTTGTGTTTGTTTTG | CAACTACAACTCCCAAACAATCC | 1.25 mM/56°C/38 | |
miR-124-1
| | | | |
M-MSP | AAAGAGTTTTTGGAAGACGTC | AATAAAAAACGACGCGTATA | 1.5 mM/55°C/35 | |
U-MSP | AATAAAGAGTTTTTGGAAGATGTT | AAAAAAATAAAAAACAACACATATAC | 2.0 mM/55°C/35 | |
miR-203
| | | | |
M-MSP | GAGTATTTTCGGTTTAGACGAGAC | CCTTTTATACGACGCAACCG | 1.5 mM/58°C/35 | |
U-MSP | TTTGAGTATTTTTGGTTTAGATGAGAT | AACACCTTTTATACAACACAACCA | 1.5 mM/58°C/35 | |
5-aza-2'-deoxycytidine (5-AzadC) treatment
HEL cells were homozygously methylated for miR-34b/c. Cells were seeded in six-well plates at a density of 1 × 106 cells/ml, and cultured with 1.5 μM of 5-AzadC for 7 days. Cells on day 0 and day 7 of treatment were harvested.
RNA isolation and stem-loop reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was isolated using
mir Vana™ miRNA Isolation Kit (Ambion, Austin, TX), according to the manufacturer's instructions. RT was performed using Taqman
® MicroRNA RT Kit and Taqman
® MicroRNA Assay Kit (Applied Biosciences, Foster City, CA), according to the manufacturer's instructions. Total RNA was reverse transcribed in 1 mM dNTPs, 50 U MultiScribe™ Reverse Transcriptase, 1X RT Buffer, 3.8 U RNase Inhibitor, and 1X stem-loop RT primer at the following thermal cycling condition: 16°C for 30 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Quantitative real-time PCR was performed using 1.33 μl of 1:15 diluted RT product in 1X Taqman
® Universal PCR Master Mix, and 1X Taqman
® Assay at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. RNU48 was used as reference for data analysis using the 2
-ΔΔCt method [
15]. Conventional RT-PCR for primary
miR-34a was performed as previously described [
9].
Statistical analysis
Correlation between combined miR methylation status (i.e. those with methylation of any of these four miRs) with categorical variables (gender, MPN subtype, occurrence of myeloid transformation, development of thrombosis [either at diagnosis or after diagnosis of MPN] and presence of JAK2 V617F mutation) and continuous variables (age, presenting Hb, leukocyte and platelet counts) was computed by the Chi-square test (or Fisher Exact test) and Student's T-test. All p-values were two-sided.
Discussion
Little information is available about the role of miRs in MPNs. Based on a literature search on the PubMed using keywords of "microRNA, methylation and myeloproliferative", no publication could be found. Therefore, this is likely the first report on methylation of miRs in MPN. In this study, we examined the methylation of
miR-34a,
-34b/c,
-124-1 and
-203 for a range of MPNs. In an attempt to identify miRs specifically involved in erythropoiesis, miR expression from
in vitro expansion of erythroid cells derived from peripheral blood mononuclear cells were compared with controls, which showed
miR-451 upregulation was specific to erythropoiesis [
16]. On the other hand, during
in vitro differentiation of megakaryocytes derived from CD34+ hematopoietic progenitors, downregulation of
miR-10a,
-10b,
-17,
-20,
-106 and
-126 was observed [
17]. Moreover, when comparing the miR expression profiling of megakaryoblastic cell line with
in vitro differentiated megakaryocytes, upregulation of
miR-99a,
-101,
-126, and
-135 was also found [
17]. Therefore, the upregulation and downregulation of these specific miRs were associated with megakaryocytic and erythropoietic differentiation.
Despite that multiple TSGs were shown to be silenced by hypermethylation in AML [
4,
14,
18‐
22], methylation of tumor suppressor genes was less frequently reported in MPN. Only recently, there were a few reports of methylation of the negative regulators of the JAK-STAT signaling pathway,
SOCS1, SOCS2 and
SOCS3, in Ph-ve MPN regardless of the JAK2 V617F mutation status [
23‐
26].
Furthermore, based on previous work by us and others,
CDK6 has been shown to be the target of multiple miRs including
miR-34a,
-34b/c and
-124-1[
27,
28]. Moreover,
CREB is the target of
miR-34b and
-203[
10,
29]. Finally,
ABL is an additional target of
miR-203[
12]. Consequently, epigenetic silencing of tumor suppressor
miR-34a,
miR-34b/c,
miR-124-1 and
miR-203 will confer proliferative advantage to the tumor cells [
27‐
29]. In contrast to a previous report which showed
miR-203 was methylated in Ph+ve but not Ph-ve MPN or leukemia, using MSP primers in the similar region [
12], we demonstrated that
miR-203 was hypermethylated in primary MPN samples, which was further verified by direct sequencing of the methylated MSP products. Therefore, it would appear that
miR-203 methylation is involved in a wider spectrum of MPNs or leukemias, regardless of their Ph chromosome status. Finally, while two patients had concomitant methylation of
miR-203 and
-34b/c, none had concomitant methylation of
miR-34a and
-34b/c, both transcriptional targets of p53, and hence avoiding duplication of tumor suppressor gene inactivation of the same pathway.
In HEL and MEG-01 cells, both U- and M-MSP signals of
miR-203 were absent, which might be due to the following possibilities: (1) sample DNA degradation, (2) inappropriate PCR condition, or (3) homozygous deletion of the region. Since simultaneous U-MSP analysis of the same DNA sample for
miR-34a,
miR-34b/c, and
miR-124-1 promoter successfully generated the U-MSP signals, hence the absence of MSP signals for
miR-203 in HEL and MEG-01 cells could not be explained by a poor DNA quality. Moreover, as
miR-203 U-MSP was successful in all the other samples including cell lines, normal controls, patient samples and methylated positive control, inappropriate MSP conditions appears unlikely. Therefore, the absence of both M- and U-MSP signals in HEL and MEG-01 cells might be caused by deletions of the region. However, karyotypic data of HEL and MEG-01 cells did not reveal homozygous deletion of 14q32, and hence whether absence of MSP amplification of
miR-203 might be due to microdeletion of this region requires further study [
30]. Furthermore, hypomethylation treatment of the HEL cells, which was homozygously methylated for the
miR-34b/c, a microRNA cluster localized to 11q23, showed significant re-expression of mature
miR-34b and
miR-34c. This finding is consistent with that both
miR-34b and
miR-34c are under the promoter regulation of the same CpG island. By contrast,
miR-34a, another member of the
miR-34 family localized to 1p36, was not constitutively expressed. Moreover, hypomethylating treatment did not lead to expression of primary
miR-34a, suggesting additional mechanism, possibly histone modification, in the regulation of
miR-34a expression [
9]. Furthermore, in addition to showing miR silencing in cell line, it is important to show the correlation of miR methylation and miR expression in the primary sample. In this connection, we shall collect both DNA and RNA from diagnostic bone marrow samples in the future.
In order to identify miRs that are methylated specifically at the time of transformation to AML or MDS, and hence implicated for pathogenesis of myeloid transformation, ideally one should analyze the paired marrow samples at both diagnosis and leukemic/myelodysplastic transformation. This is exemplified by our recent publication in the study of epigenetic inactivation of
miR-34b/c methylation in myeloma, in which we showed that while
miR-34b/c is not methylated at diagnosis, it is frequently methylated at the time of relapse or disease progression. This is as evidenced by the significantly more frequent methylation of
miR-34b/c of myeloma samples at relapse in patients with both diagnostic and relapse marrow samples[
31].
Finally, unlike the association of TSG with clinical parameters, such as the association of
CDKN2B and
WIF1 methylation with high presenting leukocyte count in acute promyelocytic leukemia [
32,
33], methylation of these miRs did not correlate with demographic, presenting blood counts, JAK2 V617F mutation or complications including thrombosis and myeloid transformations.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
All authors read and approved the final manuscript. CSC is responsible for design of study, interpretation of data and writing manuscript. TSW is responsible for provision of study material. KYW and TKF are responsible for conduction of experiment. HGD is responsible for provision of cell lines. KFW is responsible for provision of patients' material.