Background
Diabetic nephropathy (DN), a major complication developed in approximately one-third of diabetic patients during the disease course, is one of the crucial causes leading to end-stage renal disease (ESRD) worldwide [
1‐
3]. In the clinical practice, the presence of microalbuminuria is an important index for the onset or development of DN [
4]. The most consistent and significant symptoms in renal biopsies of patients with DN are glomerular lesions such as renal fibrosis and renal impairment caused by the high glucose condition [
5,
6]. Morphological and the ultrastructural changes mainly include glomerular basement membrane (GBM) thickening, mesangial expansion, glomerular hyperfiltration and tubulointerstitial fibrosis [
7,
8]. However, there has no available definitive therapy for DN or the ESRD currently, and the treatments are limited to the control of hyperglycemia, lipids and blood pressure [
9,
10]. Identifying novel molecular mechanisms participating in the progression of DN is of great significance to develop new therapeutic options for this disease.
Nuclear receptor-binding SET domain protein 2 (NSD2), also termed multiple myeloma SET domain or Wolf-Hirschhorn syndrome candidate 1, is a member of the SET histone methyltransferase family along with NSD1 and NSD3 [
11]. It specifically modifies dimethylation or trimethylation of histone H3 lysine 36 (H3K36me2/me3), or dimethylation of H4K20 [
12,
13]. Interestingly, NSD2 has been demonstrated to be downregulated in patients with type 2 diabetes mellitus, and NSD2 upregulation promoted the proliferation of pancreatic β cells and increased insulin secretion, leading to reduced glucose concentration [
14]. As a high-glucose condition is likely to induce glomerular lesions and renal impairment, aberrant NSD2 expression is likely to correlate with DN development as well.
N6-methyladenosine (m6A) is the commonest internal modification in eukaryotic mRNA since its discovery in the 1970s [
15‐
17]. The abundance and functions of m6A in RNA are governed by the interplay between its “writers” (methyltransferases, such as methyltransferase like 3 (METTL3) and METTL14); “erasers” (demethylases, such as fat mass- and obesity-associated protein) and “readers” (binding proteins, mainly including YT521-B homology domain family members (YTHDFs)) [
18]. A high-glucose condition has been previously reported to reduce m6A abundance to affect gene expression [
19]. Intriguingly, a “writer” of m6A modification, METTL3, was downregulated in the peripheral blood samples of diabetic patients [
20], and METTL3 has been indicated to be necessary for the insulin secretion [
21,
22]. We therefore, surmised that METTL3 possibly affects m6A methylation of NSD2 mRNA to regulate its expression in DN. This study was performed to examine the interaction between METTL3 and NSD2 mRNA and their functions in DN.
Methods
Clinical samples
Thirty-four patients with DN (46 ± 6.35 years old; 19 males and 15 females) treated at Liyang People’s Hospital from March 2019 to May 2020 were included into this research. Another 25 healthy individuals who underwent physical examination (43 ± 8.72 years old; 13 males and 12 females) were included as controls. This study was ratified by the Ethics Committee of Liyang People’s Hospital and adhered to the Declaration of Helsinki. Each respondent signed the informed consent.
The inclusion criteria of patients were as follows: (1) patients were diagnosed with diabetes: fasting blood sugar (FBG) ≥ 126 mg/dL (7.0 mmol/L) (American Diabetes Association Standards, 2013 [
23]); (2), the renal biopsy examination results accorded with the diagnosis standard of DN. The following patients were excluded: (1) patients with type I diabetes; (2) patients with other diseases or complications, such as primary or secondary renal diseases, heart failure, malignant hypertension, cardiovascular accident, infection, liver dysfunction or aberrantly high alanine transaminase level; regnant and lactating women; (3) pregnant and lactating women; (4) patients with cancer and (5) patients without complete clinical information.
Determination of renal impairment-related indicators
The FBG, serum creatinine (SCr), serum cystatin C (S-Cys-C), the 24-h urine protein (24-h U-protein) and urine cystatin C (U-Cys-C) were analyzed using an automatic biochemical analyzer (DxC700AU, Beckman Coulter, Fullerton, CA, USA).
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA from serum samples of patients, mouse kidney tissues, and from SV40-ES-13 cells was extracted using the TRIzol Reagent (Invitrogen, Thermo Scientific Pierce, Rockford, IL, USA). A PrimeScript™ RT reagent kit (Takara Holdings Inc., Kyoto, Japan) was used for cDNA synthesis. Gene expression was quantified using TB Green® Premix ExTaq
TMII (Takara) on a CFX96 PCRsystem (Bio-Rad Inc., Hercules, CA, USA). Relative gene expression normalized to GAPDH was calculated by the 2
−ΔΔCt method. The primers are listed in Table
1.
Table 1
Primer sequences for RT-qPCR
hsa-NSD2 | Forward: TGTGTGAGCTGCCATGCTTCCA |
Reverse: TGAGCATCCTGCTGCCAGACAA |
hsa- METTL3 | Forward: CTATCTCCTGGCACTCGCAAGA |
Reverse: GCTTGAACCGTGCAACCACATC |
mmu-NSD2 | Forward: TTCCGCTGTCCTCTCCATAGCT |
Reverse: GCAATCACCGAACATCCTGCTG |
mmu-METTL3 | Forward: CAGTGCTACAGGATGACGGCTT |
Reverse: CCGTCCTAATGATGCGCTGCAG |
mmu-YTHDF1 | Forward: GCATCAGAAGGATGCAGTTCATG |
Reverse: GATGGTGGATAGTAACTGGACAG |
hsa-GAPDH | Forward: GTCTCCTCTGACTTCAACAGCG |
Reverse: ACCACCCTGTTGCTGTAGCCAA |
mmu-GAPDH | Forward: CATCACTGCCACCCAGAAGACTG |
Reverse: ATGCCAGTGAGCTTCCCGTTCAG |
Animal experiments
Male C57BL/6 mice (7 weeks old) procured from Vital River Co., Ltd. (Beijing, China) were fed in a 12-h dark/light cycle with free access to feed and water. This study was approved by the Animal Care and Ethics Committee of Liyang People’s Hospital and carried out in compliance with the Animals in Research: Reporting In vivo Experiments (ARRIVE) guidelines. All animal procedures were in accordance with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85–23, revised 1996). Great efforts were made to minimize the pain of animals.
A murine model of DN was induced by the concomitant administration of unilateral nephrectomy (UN), high-fat-diet (HFD) and streptozotocin (STZ) as previously reported [
24]. In short, the mice subjected UN after one week of acclimation to have the renal artery, renal vein and nephrotoxin of the left kidney ligated and resected. In general, mice underwent UN would not show significant symptoms, and the procedure would not affect the risk of developing hyperglycemia, hypertension or nephrotoxin. After two days, the mice were fed with normal feed (10% kcal from fat; Control group; n = 15) or HFD (70% kcal from HFD; HFD group; n = 90). All feed was procured from Trophic Animal Feed High-Tech Co., Ltd. (Nantong, Jiangsu, China).
After three weeks, the mice given HFD were intraperitoneally injected with STZ (100 mg/kg) to induce DN. The mice were continually fed for five weeks. Mice with DN were further assigned into six groups (n = 15 in each): DN group; adenovirus vector (AAV)-negative control (NC) group; AAV-NSD2 group; AAV-NSD2 + Glucagon group; AAV-METTL3 group and AAV-METTL3 + AAV-shRNA group after corresponding treatments with AAV-NC, AAV-NSD2, AAV-NSD2 + glucagon, AAV-METTL3 and AAV-METTL3 + AAV-shRNA, respectively.
The AAV overexpressing NSD2 (AAV-NSD2) and METTL3 (AAV-METTL3), and the vector silencing NSD2 (AAV-shRNA) were all procured from GenePharma Co., Ltd. (Shanghai, China). The empty AAV vector (AAV-NC; GenePharma) was used as control. The virus titer was 1 × 109 TU/mL. Mice subjected to AAV treatment were injected with the corresponding AAV at one week after STZ injection. The AAV was injected at 20 μL each time, and the injection was conducted once a week for four weeks. The clinical dose of glucagon for human is 0.5 U/70 kg. The corresponding dose for mice (0.5/70) × 9.1 = 0.065 (U/kg), which was used to treat the mice.
At week 0, 3, 5 after STZ injection, respectively, five mice in each group were collected for analysis. The blood and urine samples were collected and centrifuged at 3,000 × g at 4 °C for 20 min. The supernatant was stored at -80 °C. The systolic blood pressure (SBP) of mice were detected using a mouse noninvasive blood pressure measurement system (Yuyan Instruments Co., Ltd., Shanghai, China). After that, the mice were sacrificed via intraperitoneal injection of 150 mg/kg pentobarbital sodium. The right kidney was collected and weighed. Thereafter, the kidney was cut into two halves. One half of the tissue was stored at -80 °C, and another half of the tissue was fixed with 4% paraformaldehyde (PFA) and embedded in paraffin.
Histochemical staining
The paraffin-embedded tissues were cut into 5-μm sections. The sections were dewaxed and rehydrated. The pathological changes in kidney tissues were determined using a hematoxylin and eosin (HE) staining kit (G1120, Solarbio Science & Technology Co., Ltd., Beijing, China) or a Masson's trichrome staining kit (G1340, Solarbio) following the manufacturer’s protocol. All images were photographed using a camera-equipped light microscope (Nikon Instruments Inc., Tokyo, Japan).
Enzyme-linked immunosorbent assay (ELISA)
Frozen mouse kidney tissue was made into homogenate (0.1 M Tris/HCl, pH 7.4, containing 0.5% Triton X-100, 5 mM β-ME, and 0.1 mg/ml PMSF) and centrifuged at 1,400 × g at 4℃ for 5 min to collect the supernatant. The contents of superoxide dismutase (SOD, #K335, BioVision, Milpitas, CA, USA), malondialdehyde (MDA, #K739, BioVision), interleukin (IL)-6 (ab100713, Abcam Inc., Cambridge, MA, USA), monocyte chemotactant protein-1 (MCP-1, ab100722, Abcam), and hydroxyproline (ab222941, Abcam) were determined adhering to the instructions of the ELISA kits.
Cell treatment
A mouse mesangial cell line SV40-MES-13 (CL-0470) was procured from Procell Life Science & Technology Co., Ltd. (Hubei, China). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco Company, Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS) and 5.6 mM glucose at 37 °C with 5% CO2.
The pEXP-RB-Mam plasmid-based overexpressing vector-NSD2, vector-METTL3 and the control vector NC used for cell transfection were procured from RiboBio Co., Ltd. (Guangzhou, Guangdong China). Short hairpin (sh) RNAs of YTHDF1 and NSD2(sh-YTHDF1 and sh-NSD2) and the control sh-NC were procured from Genepharma. All transfection was conducted using the Lipofectamine 2000 (Thermo Fisher Scientific) according to the instruction manual. The cells cultured in DMEM containing 5.6 nM glucose were set as normal-glucose (NG) group, while those cultured in the medium containing 30 nM glucose were set as high-glucose (HG) group.
Western blot analysis
Total protein in SV40-MES-13 cells or kidney tissues was extracted using the radio-immunoprecipitation assay cell lysis buffer (Beyotime Biotechnology Co. Ltd., Shanghai, China). After protein determination using a Pierce™ BCA kit (Thermo Fisher Scientific), an equal amount of protein was run on 10% SDS-PAGE and transferred loaded onto polyvinylidene fluoride membranes (Invitrogen). The membranes were blocked in 5% non-fat milk for 2 h and incubated with the primary antibodies anti-NSD2 (1:1,000, ab259940, Abcam), anti-Fibronectin (1:1,000, ab2413, Abcam), anti-collagen type I alpha 1 chain (COL1A1; 1:1,000, ab260043, Abcam), anti-E-cadherin (1:1,000, #3195, Cell Signaling Technology (CST), Beverly, MA, USA), anti-YTHDF1 (1:1,000, ab252346, Abcam) anti-METTL3 (1:1,000, ab195352, Abcam) and the internal control anti-GAPDH (1:1,000, #5174, CST) at 4℃ overnight, followed by incubation with horseradish peroxidase (HRP)-conjugated IgG (1:1,000, ab6721, Abcam) at 25℃ for 2 h. The protein signals were developed using the Pierce™ ECL system (Thermo Fisher Scientific). Relative protein level was examined using the Image J.
5-ethynyl-2’-deoxyuridine (EdU) labeling assay
Proliferation of the cells was examined using a BeyoClick™ EdU-647 kit (Beyotime). In short, the cells were sorted in 6-well plates. After adherence, the medium was renewed, and each well was loaded with 10 μM EdU solution and the cells were incubated at 37℃ for 2.5 h. Next, the cells were fixed in 4% PFA (Beyotime) for 15 min, permeabilized in 0.3% Triton X-100 (Elabscience Biotechnology Co., Ltd., Wuhan, Hubei, China) for 8 min, and then added with 500 μL Apollo staining buffer in the dark for 40 min. The nuclei were stained with 4', 6-diamidino-2-phenylindole (DAPI) for 10 min. The staining was observed under a fluorescence microscope (Zeiss, Oberkochen, Germany) and quantified using the Image J software.
Immunofluorescence staining
The cells were fixed in 4% PFA for 10 min and incubated in 1% BSA/10% normal goat serum/0.3 M glycine-contained 0.1% PBS-Tween for 1 h to permeate the cells and block the non-specific protein–protein interaction. After that, the cells were incubated with anti-Fibronectin (1:250, ab2413, Abcam), anti-COL1A1 (1:250, ab270993, Abcam) and anti-E-cadherin (1:50, #3195, CST) at 4℃ overnight and then with fluorescence-conjugated IgG H&L (Alexa Fluor® 488; 1:500, ab150077, Abcam) or IgG H&L (Alexa Fluor® 647; 1:500, ab150079, Abcam) at 25℃ for 2 h. The nuclei were stained with DAPI (blue). The cells were observed under the fluorescence microscope. The mean fluorescence intensity (MFI) of proteins was analyzed using the Image J software.
m6A quantification
Total m6A RNA methylation was determined using an EpiQuik kit (Epigentek, NY, USA) according to the manufacturer’s protocol. Total RNA was isolated using the TRIzol reagent as well. Each well was loaded with 80 μL binding solution. The RNA samples, positive control and negative control were loaded into the designative wells and allowed to stand at 37 °C for 90 min. After being washed in washing buffer for three times, the samples were incubated with 50 μL diluted capture antibody at 22℃ for 60 min, and with 50 μL detection antibody and 50 μL diluted enhancer solution for 30 min. After that, 100 μL developer solution was further added for a 10-min incubation to produce color change. The reaction was terminated by 100 μL stop solution. The optical density at 450 nm was read using a microplate reader. The m6A RNA quantity was evaluated according to the standard curve. The ratio of the amount of m6A RNA methylation to the amount of total input RNA was examined.
m6A methylated RNA immunoprecipitation-qPCR (MeRIP-qPCR)
Total RNA from cells was extracted using a miRNeasy Mini kit (Qiagen GmbH, Hilden, Germany) through DNA digestion using the RNase-free DNase Set (Qiagen). Magnetic beads (Millipore Corp., Billerica, MA, USA) were coated with 5 μg anti-m6A (ab208577, Abcam) or anti-IgG (Abcam) at 22℃ for 30 min. The antibody-coated beads were incubated with 50 µg total RNA in RNase-inhibiting IP buffer at 4 °C overnight. After digestion in proteinase K, the m6A-bound RNA was precipitated by the phenol–chloroform RNA extraction method. The abundance of m6A was examined by RT-qPCR.
RNA-binding protein immunoprecipitation (RIP)-qPCR
RIP was performed according to the instructions of a Magna RIP™ kit (Millipore). The magnet beads were coated with 5 μg primary antibodies (anti-YTHDF1, anti-YTHDF2, anti-YTHDF3 or anti-IgG; all acquired from Abcam) and incubated at 22℃ for 30 min. The antibody-coated magnet beads were cultured with the cells at 4 °C overnight. Then, the magnet-protein-RNA complexes were washed with RIP washing buffer for six times and then incubated with proteinase K digestion buffer at 55 °C for 30 min. The RNA was extracted using the phenol–chloroform extraction method. Then, the abundance of NSD2 was determined by RT-qPCR.
mRNA stability analysis
The cells were treated with 5 µg/mL actinomycin D (Sigma-Aldrich Chemical Company, St Louis, MO, USA) to suppress the transcription of whole mRNA. After incubation for indicated time, the cells were collected, and the RNA sample was collected for RT-qPCR to examine the transcription level of NSD2.
Statistical analysis
Prism 8.02 (GraphPad, La Jolla, CA, USA) was applied for data analysis. Data from at least three independent experiments were exhibited as the mean ± standard deviation (SD). Differences were analyzed by the t test (two groups) or one- or two-way analysis of variance (ANOVA) (multiple groups) followed by Tukey’s post-hoc test. Correlations between variables were analyzed by Pearson’s correlation analysis. p < 0.05 was set as the cut-off value for significant difference.
Discussion
Kidneys are highly sensitive to metabolic and haemodynamic alterations, so the incidence rate of DN is expected to rise considering the increasing coverage of diabetics [
25]. The DN pathogenesis has been extensively explored with no golden standard for treatment so far. Phenotypic changes of metabolites, cytokines, proteins and transcription factors are accountable for the extracellular matrix accumulation and glomerulosclerosis, namely for the progression of DN [
26]. This study showed that METTL3-mediated NSD2 mRNA stability through m6A RNA methylation can alleviate renal impairment and interstitial fibrosis in DN.
Owing to its potent role in epigenetic regulation, NSD2 has been reported to play important roles in human solid tumors by regulating DNA damage repair and epithelial–mesenchymal transition process [
27]. During tumor growth, reprogrammed glucose metabolism is involved to meet the demand of glycolytic intermediates for macromolecule biosynthesis, during which the NSD2 has been reported to play a role by regulating key glucose metabolism regulators, such as TIGAR, HK2, and G6PD [
28]. More relevantly, NSD2 has been demonstrated to be downregulated in patients with diabetes mellitus, and its upregulation increased insulin secretion and reduced glucose concentration through promoting pancreatic β cell proliferation [
14]. Moreover, NSD2-mediated H3K36 methylation has been reported to play a significant role in adipose tissue development, and NSD2 deletion was suggested to lead to lipodystrophy, which is correlated with hyperlipidemia, insulin resistance, and diabetes [
29]. However, the function of NSD2 in DN has not been investigated before. Importantly, reduced expression of NSD2 was identified in patients with DN, which was correlated with increased SBP and elevated levels of FBG, SCr, Cys-C and 24-h U-protein, namely increased renal impairment.
In vivo, overexpression of NSD2 alleviated the renal impairment and the pathological changes, including glomerular dilatation, glomerulosclerosis, diffuse mesangial proliferation, and fibrosis in mice and reduced the expression of interstitial fibrosis-related markers in tissues.
In vitro, NSD2 overexpression also suppressed HG-induced mesangial cell (SV40-MES-13) proliferation and the expression of interstitial fibrosis-related markers as well. Collectively, these results indicated that NSD2 can mitigate renal fibrosis and impairment in DN. Interestingly, the glucagon treatment partially counteracted the functions of NSD2, indicating that the protective functions of NSD2 against DN is partially attributed to its regulation on glucose suppression.
The discovery of dynamic mRNA methylation has unveiled a new mode of post-transcriptional gene regulation in eukaryotes. Intriguingly, reduced m6A modification level, along with decreased levels of m6A-related methylases METTL3 and METTL14 were identified in HG conditions [
19]. METTL3 is downregulated under the inflammatory and oxidative stress conditions and it regulates β-cell function to induce insulin secretion [
21,
22]. METTL3 has been reported to be downregulated in the peripheral blood samples of diabetic patients [
20]. In this study, METTL3 was identified to be significantly reduced in the serum samples of patients with DN and m6A level was reduced HG-treated SV40-MES-13 cells, while overexpression of METTL3 enhanced the NSD2 mRNA level in HG-treated cells. These results suggested that METTL3 possibly enhances NSD2 mRNA stability and expression through m6A modification. In general, METTL3 promotes m6A deposition on critical transcripts, and the subsequent mRNA translation or degradation is determined by the m6A “reader” proteins [
30]. We therefore, examined the expression of several m6A “readers” YTHDFs on NSD2 mRNA, and YTHDF1 expression was found to be elevated upon METTL3 overexpression. YTHDF1 functions in promoting mRNA translation [
31]. In this paper, YTHDF1 downregulation blocked the METTL3-induced NSD2 mRNA stability and NSD2 upregulation. The subsequent experiments showed that METTL3 overexpression reduced SV40-MES-13 cell proliferation and interstitial fibrosis both
in vitro and
in vivo, but the protective roles of METTL3 was blocked upon NSD2 silencing.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.