MHBSt¹⁶⁷ induced autophagy promote cell proliferation and EMT by activating the immune response in L02 cells

Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), Lipofectamine^™ 3000 transfection reagent, TRIzol reagent, LysoTracker Red and the high capacity cDNA reverse transcription kit were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Rapa and 3-MA were obtained from Sigma-Aldrich Co. (St Louis, MO, USA). CQ and BAY-11-7082 were obtained from Selleck (Houston, Texas, USA). Mouse anti-human monoclonal antibodies against PreS2/S, β-actin, and histone 3 were purchased from Abcam (C ambridge, UK). Anti-human monoclonal antibodies against LC3, Beclin-1, SQSTM/P62, NF-κB, p-NF-κB/p65, IκB, p-IκB, Vimentin, E-cadherin and Protein Disulfide Isomerase (PDI) were purchased from Cell Signaling Technology (Boston, MA, USA). The Immobilon Western Chemiluminescent HRP substrate was purchased from EMD Millipore (Billerica, MA, USA). The cell counting kit-8 was purchased from Beyotime (Shanghai, China). Alexa Fluor 488-conjugated goat anti-mouse IgG (H + L), Alexa Fluor 594-conjugated goat anti-rabbit IgG (H + L), DyLight 405-labeled goat anti-mouse IgG (H + L) and Alexa Fluor 488-conjugated goat anti-rabbit IgG (H + L) were purchased from ZSGB-BIO (Beijing, China). Propidium Iodide (PI)/RNase staining buffer was purchased from BD Biosciences (Franklin, NJ, USA).

To construct the pcDNA3.1-MHBSt¹⁶⁷ and pcDNA3.1-MHBS plasmids, the genes were amplified from the Phy106 + wta plasmid (HBV adr genome). The primers were as follows: MHBSt¹⁶⁷ and MHBS forward primer, 5’GAATTCATGCAGTGGAACTCCACAAC3’; MHBSt¹⁶⁷ reverse primer, 5’CTGCAGCTATCCTGGAAGTAGAGGACAAAC3’, and MHBS reverse primer, 5’CTGCAGTTAAATGTATACCCAAAGAAAATTGG3’. These two ligated vectors were confirmed by DNA sequence analysis. The primers for IFNα, IFNβ and IL-1α were purchased form QIAGEN (Dusseldorf, Germany). The GFP-LC3 and mRFP-GFP-LC3 plasmids were purchased from Addgene.

The human hepatocyte cell line L02 was obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China) and cultured in DMEM with 10% FBS and 1% penicillin–streptomycin (10,000 U/mL penicillin and 10 mg/mL streptomycin) at 37 °C in an incubator containing 5% CO₂ and moderate amount of water vapor. Change the medium every two days, and cell passage or subsequent experiments was performed when they grew to 80% density.

After being harvest, cells were washed with ice-cold PBS (Phosphate Buffer Saline) for twice in plates, and TRIzol reagent was added into plates to extract total RNA according to the manufacturer’s instructions. RNA concentration and purity were measured using a UV spectrophotometer (Eppendorf, Hamburg, Germany). Synthesize cDNA was performed by using the high capacity cDNA reverse transcription kit according to the manufacturer’s instructions. Then, PCR was followed. The primers used for PCR were the same as those used to construct the pcDNA3.1-MHBSt¹⁶⁷ and pcDNA3.1-MHBS plasmids.

After being harvest, cells were washed with ice-cold PBS for twice and total protein was extract by RIPA lysis buffer according standard procedure. The protein concentration was determined by bicinchoninic acid analysis according to the manufacturer’s instructions. Homogenized protein extract and were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto nitrocellulose membranes. Blocking the membranes with 5% skim milk for 2 h and then incubated with primary antibodies diluted at a ratio of 1:1,000 with 3% skim milk overnight at 4 °C. Washing the membranes with Tris-buffered saline with Tween-20 for 3 times to remove the unbound primary reactance, and then the membranes were incubated with HRP-conjugated secondary antibodies at room temperature for 2 h. An enhanced chemiluminescent kit was used to visualize the immunoreactive proteins according to the manufacturer’s protocol.

CCK-8 assays were performed according to the manufacturer’s instructions. Briefly, L02 cells were seeded in 96-well plates at 2 × 10⁴ cells/well and transfected with the MHBS and MHBSt¹⁶⁷ expression plasmids. Before harvest, CCK-8 solution was added into each well and incubated for 2 h at 37 °C. Finally, the absorbance of the lysates was measured at 570 nm using a microplate reader.

PI/RNase staining buffer was used to analyze the cell cycle as previously reported. After L02 cells were transfected with pcDNA3.1-MHBSt¹⁶⁷ and pcDNA3.1-MHBS plasmids for 48 h, the cells were washed with cold PBS, harvested, fixed with 70% ethanol at − 20 °C for 1 h, and centrifuged at 1000 g for 10 min at 4 °C. The cells were then washed with cold PBS and resuspended in PI/RNase staining buffer for 15 min in the dark, followed by FCM analysis.

Colony formation assay is an important method to detect cell proliferation ability. In 6-well plate, when a single cell proliferates for more than 50 cells (about 7–14 d), they become a clone with a size between 0.3 and 1.0 mm. The proliferation ability of L02 cells was monitored by plate cloning assay. Cell suspensions (2000 cells/ well) were prepared and seeded in 6-well plate, which were then transfected with Vector, MHBS and MHBSt¹⁶⁷ for 7–14 d. The visible cell colonies were fixed with 4% paraformaldehyde and stained with crystal violet solution for 15 min. Typical colony images were recorded with camera and Microscopic imaging system, and the number of cell colonies was counted.

Cells were transfected with MHBSt¹⁶⁷ and MHBS expression plasmids using Lipofectamine 3000. Forty-eight hours after transfection, LysoTracker Red was added to the medium and incubated for 2 h at 37 °C. The cells were washed with PBS, and then fixed in 4% paraformaldehyde, and permeabilized with 1% Triton X-100. The cells were washed with PBS three times. For immunofluorescence analysis, the cells were blocked with FBS for 30 min and incubated with the appropriate primary antibodies and fluorescently labeled secondary antibodies, followed by fluorescently-labeled secondary antibodies. Then, DAPI (Sigma) was included in the final wash at a final concentration of 0.1 μg/mL to stain the nuclei. The images were visualized with confocal microscopy. The resulting images were deconvolved with Delta vision software.

A premature stop at codon 167 in MHBs was introduced to create the protein MHBSt¹⁶⁷ (Fig. 1A). DNA sequencing results indicated that the recombinant plasmid contained the HBV DNA fragment encoding the truncated middle surface protein that was in‑frame without any base mutations. MHBSt¹⁶⁷ mRNA expression in L02 cells was successfully detected by reverse transcription polymerase chain reaction (RT‑PCR) (Additional file 1: Fig. S1A). Different amounts of MHBS and MHBSt¹⁶⁷ plasmids were transfected into cells to ensure consistent levels of protein expression, and 1 (pcDNA3.1-MHBS):3 (pcDNA3.1-MHBSt¹⁶⁷) was the best ratio (Additional file 1: Fig. S1B). CCK-8 assays, clone formation assay and high-content screening (HCS) assays were used to examine MHBSt¹⁶⁷-induced cell proliferation. The results revealed that L02 cells transfected with MHBSt¹⁶⁷ showed 50.43 ± 7.85% higher viability than cells transfected with MHBS, and Hep3B, LM3, Huh7, and HepG2 cells have the similar phenotypes as in L02 cells, the cell number per clone in L02 cells transfected with MHBSt¹⁶⁷ is 30% larger than in cells transfected with MHBS (P < 0.05, Fig. 1B–D, Additional file 1: Fig. S1C–F). The flow cytometry (FCM) results showed that the proportion of cells in the G2/M phase was increased 75.93%, while the proportion of cells in the S phase was decreased 29.55% in cells transfected with MHBSt¹⁶⁷ compared with those transfected with MHBS (P < 0.05, Fig. 1E, Additional file 1: Fig. S1G). In human cancer, the activation of the EMT process is related to advanced disease [20], which was demonstrated by the transition of epithelial biomarkers (E-cadherin) to mesenchymal biomarkers (Vimentin). Therefore, the effect of MHBSt¹⁶⁷ on the EMT process in L02 cells was investigated by immunoblotting and immunofluorescence. The immunofluorescence showed increased Vimentin expression levels and decreased E-cadherin expression levels in cells transfected with MHBSt¹⁶⁷and the immunoblotting results showed that cells transfected with MHBSt¹⁶⁷ showed 80.81 ± 2.60% upregulated Vimentin expression levels and 80.20 ± 1.57% downregulated E-cadherin expression levels than cells transfected with MHBS, and Hep3B, LM3, Huh7, and HepG2 cells have the similar phenotypes as in L02 cells (P < 0.05, Fig. 1F–H, Additional file 1: Fig. S1H). To explore the pathway that MHBSt changing cell cycle and promoting cell proliferation, MHBSt¹⁶⁷ expression in medium supernatant and cellular extracts were detected and co-location of MHBSt¹⁶⁷ and ER marker protein was detected. The results showed that MHBSt¹⁶⁷ was only detected in cellular extracts, and MHBS was detected both in cell culture supernatants and cellular extracts (Fig. 1I and Additional file 1: Fig. S1I). Protein Disulfide Isomerase (PDI) catalyzes internal disulfide bond exchange and promote formation of correct disulfide bonds and is a marker of ER. PDsRed-ER is a mammalian expression vector used to label the endoplasmic reticulum of living cells. Immunofluorescence showed threefold higher co-location of MHBSt¹⁶⁷ and Protein Disulfide Isomerase (PDI) and 3.5-fold higher co-location of MHBSt¹⁶⁷ and DsRed-ER in cells transfected with MHBSt¹⁶⁷ than in cells transfected with MHBS (Fig. 1J, K).

To explore whether autophagy was induced by MHBSt¹⁶⁷, autophagy-related proteins were measured by immunoblotting. The results showed that the expression of MHBSt¹⁶⁷ led to 36.01 ± 2.51% increased expression of LC3B-II and 45.00 ± 2.36% increased expression of beclin1 compared to the vector expressing cells. However, the expression of p62 protein, which is an autophagy receptor, has no change in MHBSt¹⁶⁷ expressing cells. The autophagy activator rapamycin (Rapa) and autophagy inhibitor chloroquine (CQ) were used to analyze whether complete autophagic flux was induced by MHBSt¹⁶⁷. After Rapa treatment, the expression of LC3B-II was slightly increased and p62 protein level was slightly decreased. However, rapamycin treatment leaded to 35.86 ± 2.33% decreased expression of Beclin1 in MHBSt¹⁶⁷expressing cells. After CQ treatment, however, LC3B-II expression was significantly increased, as was p62 protein expression (P < 0.05, Fig. 2A). These results showed that MHBSt¹⁶⁷ could induce complete autophagic flux. To verify this conclusion, exogenous GFP-LC3 and GFP-RFP-LC3 expression plasmids and LysoTracker Red were used to analyze the autophagy level by confocal microscopy. There was distinct accumulation of GFP puncta at 48 h after being co-transfected with exogenous GFP-LC3 and MHBSt¹⁶⁷, and the number of GFP puncta was greater than those in cells co-transfected with exogenous GFP-LC3 and MHBS (Fig. 2B). These results indicated that MHBSt¹⁶⁷ could induce enhanced autophagosome formation. LysoTracker Red is a specific lysosomal probe that can label lysosomes and fluoresce red. Cells were incubated with LysoTracker Red for 30 min before being harvested, and then the cells were immunofluorescently stained with PreS2. The results showed that more red fluorescence and green fluorescence co-localized in MHBSt¹⁶⁷-expressing cells (Fig. 2C), indicating that autophagosomes and lysosomes were fused to produce autolysosome. The GFP-RFP-LC3 expression plasmid was used to mark and track LC3; in this system, green fluorescence will decrease or disappear in functional autolysosome. The GFP-RFP-LC3 expression plasmid was co-transfected with MHBSt¹⁶⁷, and cells were immunofluorescently stained with PreS2. Statistical analysis showed that the ratio of fluorescence intensity (GFP/RFP) was lower in MHBSt¹⁶⁷ expressed cells than in MHBS expressed cells, which indicate that more functional autolysosomes were formed in MHBSt¹⁶⁷ expressing cells than in MHBS expressing cells (Fig. 2D). These results showed that MHBSt¹⁶⁷ could induce much higher autophagy levels than MHBS.

Autophagy has been increasingly shown to play a role in HCC. To explore whether MHBSt¹⁶⁷-induced autophagy contributes to HCC, the autophagy activator Rapa and the autophagy inhibitor 3-methyl adenine (3-MA) were used. The results showed that Rapa treatment leaded to 16.33 ± 4.32% increased expressed level of LC3B-II and 12.58 ± 3.71% decreased expressed level of p62, while 3-MA treatment leaded to 86.69 ± 0.46% decreased expressed level of LC3B-II and 137.04 ± 4.87% increased expressed level of p62 in MHBSt¹⁶⁷-expressing cells (P < 0.05, Fig. 3A). The CCK-8 assay showed that the increase in cell proliferation induced by MHBSt¹⁶⁷ was scarcely changed by Rapa treatment, while cell proliferation was abolished by 3-MA treatment (P < 0.05, Fig. 3B). An HCS assay confirmed that the autophagy inhibitor abolished the increase in cell proliferation (Fig. 3C). The cell cycle was analyzed by FCM, and the results showed that the increase in the proportion of G2/M-phase cells after transfection with MHBSt¹⁶⁷ was abolished by 3-MA treatment (Fig. 3D, E, F), suggesting that MHBSt¹⁶⁷-induced autophagy accelerated cell cycle progression from S phase to G2/M phase.

NF-κB is now well accepted as a central mediator that regulates immune and inflammatory responses. The translocation of phosphorylated NF-κB/p65 (p-NF-κB/p65) from the cytoplasm to the nucleus represents the activation of NF-κB. To investigate whether MHBSt¹⁶⁷ induces the host immune response, NF-κB activation was measured in MHBSt¹⁶⁷ expressing cells. The immunoblotting results showed that p-NF-κB/p65 was 51.43 ± 3.59% increase in the total protein and 81.10 ± 9.00% increase in nuclear protein in MHBSt¹⁶⁷ expressing cells, and it was 55.33 ± 4.29% decreased in the cytoplasmic fraction (P < 0.05, Fig. 4A). In addition, the expression level of p-IκB, a NF-κB inhibited element, was 44.52 ± 4.45% decreased. The immunofluorescence results showed that p-NF-κB/p65 was mainly located in the cytoplasm in cells expressing MHBS, while it exhibited less expression in the cytoplasm but much more expression in the nucleus in cells expressing MHBSt¹⁶⁷; thus, p-NF-κB/p65 was transferred from the cytoplasm to the nucleus in MHBSt¹⁶⁷-expressing cells, which indicated that NF-κB was activated (Fig. 4B). The RT-PCR results showed that the expression of IFN-α, IFN-β and IL-1α in cells expressing MHBSt¹⁶⁷ was upregulated compared to that of MHBS-expressing cells, which means the innate immunity was activated by MHBSt¹⁶⁷ (P < 0.01, Fig. 4C).

To explore the effect of MHBSt¹⁶⁷-induced NF-κB activation on HCC development, the NF-κB pathway inhibitor BAY-11–7082 was used in L02 cells expressing MHBSt¹⁶⁷. The results showed that the intranuclear protein level of p-NF-κB/p65 was significantly increased in L02 cells expressing MHBSt¹⁶⁷, while it paralleled level in L02 cells expressing wild-type MHBS in the presence of BAY-11-7082 (P < 0.05, Fig. 5A). Cell proliferation and the cell cycle were measured after L02 cells were transfected with MHBS and MHBSt¹⁶⁷ expression plasmids and treated with BAY-11-7082. The results showed that the enhanced cell proliferation induced by MHBSt¹⁶⁷ was abolished by BAY-11-7082 treatment (P < 0.05, Fig. 5B). The cell cycle was analyzed by FCM, and the results showed that the MHBSt¹⁶⁷-induced increase in the proportion of G2/M-phase cells was abolished by BAY-11-7082 treatment (Fig. 5C, D, E), which suggests that MHBSt¹⁶⁷-induced NF-κB activation accelerates cell cycle progression from S phase to G2/M phase.

To explore the relationship between autophagy and the immune response induced by MHBSt¹⁶⁷, the autophagy activator Rapa and the autophagy inhibitor 3-MA were used. The results showed that the protein level of p-NF-κB/p65 was hardly changed by Rapa treatment in MHBSt¹⁶⁷ expressed cells, while it was significantly decreased by 3-MA treatment in the total protein, cytosolic protein and nuclear protein fractions (P < 0.05, Fig. 6A). The protein level of p-IκB was slightly increased by Rapa treatment and was significantly increased by 3-MA treatment. Immunofluorescence results showed that the nuclear level of p-NF-κB/p65 protein was scarcely changed by Rapa treatment, and it was significantly decreased by 3-MA treatment in cells expressing MHBSt¹⁶⁷ (Fig. 6B–E), which indicated that the MHBSt¹⁶⁷-induced activation of NF-κB was significantly inhibited by 3-MA treatment. To confirm the truncated MHBS protein induced NF-KB activation through autophagy, we used the ATG5-specific siRNA to inhibit autophagy specifically, and then investigate whether NF-κB was inhibited to verify our hypothesis. The result showed that NF-κB activation induced by MHBSt¹⁶⁷ was abolished by siATG5 treatment (Additional file 2: Fig. S2A, B).