Background
Enhancer of zeste homolog 2 (Ezh2) is a member of the polycomb group (PcG) protein family involved in suppressing gene expression through remodeling chromatin [
1]. As a histone methyltransferase, Ezh2 catalyzes histone H3 lysine 27 (H3-K27) trimethylation [
2], which is a hallmark of gene silencing [
3]. Ezh2 is an important component of the polycomb repressive complex 2 (PRC2) and is required in maintaining gene silencing. The association of Ezh2 with other PcG proteins is essential to its methyltransferase function, since the pharmacologic disruption of PRC2 inhibits the methylation of H3-K27 [
4]. Ezh2 needs to be recruited by DNA binding proteins, such as YY1 and E2F, to associate with chromatin and exert its function [
5,
6]. In addition, Ezh2 and its associated PcG proteins regulate various biological processes, including X-chromosome inactivation [
7], stem cell self-renewal and exhaustion [
8,
9], skeletal muscle differentiation [
10], actin polymerization [
11] and circadian clock function [
12].
Increasing evidence suggests an essential role of Ezh2 in cancers. Numerous studies indicate that Ezh2 overexpression is a common phenomenon in prostate cancer (PCa) that is associated with a poor clinical outcome of PCa patients [
6,
13‐
15]. Therefore, Ezh2 was proposed to be a bona fide oncogene [
13] and its increase can be used as a marker of prostate tumors with aggressive and metastatic potential. Several studies also suggested the prospect of Ezh2 as a therapeutic target in PCa treatment. Ezh2 knockdown by small interfering RNA (siRNA) decreases prostate cell proliferation [
13] and inhibits the metastatic tumor growth of PC-3 cells in bone tissue [
16]. On the other hand, Ezh2 promotes proliferation and invasion of PCa cells [
17] and ectopically expressed Ezh2 in prostate cells enhances proliferation [
18]. These studies indicate a role of Ezh2 in aggressive PCa and suggest that Ezh2 may be a therapeutic target of PCa treatment [
18]. Taken together, Ezh2 plays an oncogenic role in PCa and elucidating the mechanisms that regulate Ezh2 function may provide fundamental therapeutic insight in treating this cancer.
Previous studies demonstrate Ezh2 can be regulated at the transcriptional or translational level. The tumor suppressor p53 [
19] and transcription factor E2F [
6] can bind to the promoter of the Ezh2 gene to inhibit or transactivate its expression, respectively. In addition, Ezh2 undergoes post-translational modification by Akt, which decreases its methyltransferase activity [
20]. Recently, increasing evidence indicates microRNAs (miRNAs) can regulate gene expression at the post-transcriptional level. Therefore, we wanted to study whether Ezh2 is also regulated by miRNAs.
MicroRNAs are a group of small RNAs with 17-24 nucleotides that regulate gene expression through interfering mRNA translation [
21]. Ample evidence indicates that miRNAs may regulate tumorigenesis by functioning as either oncogenes or tumor suppressors [
22]. Interestingly, different cancers exhibit characteristic miRNA signatures in miRNA expression profiling studies [
23]. However, gaps still exist in understanding the precise mechanisms of miRNA-mediated cancer development and progression. Due to the importance of Ezh2 in PCa progression and its potential as a therapeutic target in PCa therapy, identifying miRNA(s) that regulates Ezh2 expression may lead to the development of novel therapeutic approaches in PCa treatment. A recent study indicated that the genomic loss of miR-101 leads to Ezh2 overexpression in human cancer samples, suggesting the physiological significance of miR-101-regulated Ezh2 function in PCa development [
24]. In the current study, we demonstrate that miR-101 negatively regulates Ezh2 expression in PCa cells and miR-101 expression is affected by androgen stimulation and HIF-1α/HIF-1β induction.
Materials and methods
Antibodies and Reagents
Antibodies against Ezh2 (4905), HIF-1β/ARNT (3718S), Tri-Methyl-Histone H3-Lys 27 (H3K27m3, 9756), and Lamin A/C (2032) were purchased from Cell Signaling Technology (Danvers, MA). HIF-1α antibody was kindly provided by Dr. Constantinos Koumenis (University of Pennsylvania School of Medicine). Histone H3 (C-16, sc-8654) and Androgen Receptor antibodies (N-20, sc-816) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
MicroRNAs, siRNAs, DNA plasmids and transfection
All microRNA mimics (miR-101, miR-26a and a scramble control) were synthesized by Dharmacon, Inc. (Chicago, IL), with the following sequences: miR-101, UACAGUACUGUGAUAACUGAA; miR-26a: UUCAAGUAAUCCAGGAUAGGCU; and scramble control (miR-cont): UCACAACCUCCUAGAAAGAGUAGA. The siRNAs for control (GGG CCA TGG CAC GTA CGG CAA G) and Ezh2 (GGT GAT CAC AGG ATA GGT ATT) were delivered by a lentiviral vector, pLU carrying anti-puromycin cDNA [
25].
To generate a reporter construct, we amplified a 493-base pair (bp) DNA fragment consisting of the last 50 bps of Ezh2 coding region and 443 bps of the 3'-UTR of Ezh2 mRNA from human genomic DNA (P/N: 5-0109, Affymetrix, Inc.). This 3'-UTR region of Ezh2 containing the predicted target sites of miR-101 and miR-26a was then subcloned downstream of Gaussia luciferase (GLuc) that is driven by a phosphoglycerate kinase (PGK) promoter. We also constructed plasmids with mutated target sites of these miRNAs. The recognition of the seed sequence of a miRNA to the 7-8 nucleotides at the 3' end of its target site is essential to miRNA-mediated translational inhibition. Thus, in the predicted target sites of miR-101 and miR-26a in Ezh2 3'-UTR, we replaced these nucleotides recognized by the seed sequences of these two miRNAs with scrambled sequences, respectively. As a result, we generated three control reporter plasmids with the two miR-101 target sites mutated, either individually or combinatorially (
45AGTACTGT
66 to A
CCG C
G G
C, and/or
101GTACTGTA
121 to
C T
G C
A G
AT, mutated nucleotides are in bold), and one control reporter plasmid with the mutated miR-26a target site (
236TACTTGAA
257 to
CTGCA G
CT). To express Ezh2 in PC-3 cells, Ezh2 cDNAs (generously provided by Dr. Sartorelli [
10]) were individually subcloned into a Lentiviral vector, pSL4, which co-expresses the puromycin N-acetyltransferase to render infected cells resistant to puromycin.
Cell culture, transient transfection and Lentiviral production
PWR-1E, LNCaP, DU145 and PC-3 cell lines were obtained from the American Type Culture Collection (Manassas, VA). LNCaP, DU145 and PC-3 cells were maintained in RPMI 1640 supplemented with 1% penicillin/streptomycin and 10% fetal bovine serum. In androgen starvation experiments, LNCaP cells were also cultured in phenol red-free RPMI media containing 1% charcoal-stripped FBS (Invitrogen), and treated with 0, 0.01, 0.1, and 10 nM R1881 (a synthetic non-aromatizable androgen). PC-3 cells were also treated for 0 and 6 h by 100 μM deferoxamine mesylate (DFO, Sigma), dissolved in RPMI culturing media. PWR-1E cells were maintained in keratinocyte-SFM (Invitrogen). Lipofectamine 2000 (Invitrogen) was used in transient transfection of PC-3 cells based on the protocol provided by the manufacturer. SiPort NeoFX lipofectamine (Ambion) was used in transient transfection of LNCaP based on the manufacturer's protocol. The production of Lentivirus followed a previously reported protocol [
26]. Briefly, 293T cells were transfected with either an empty pSL4 vector, pSL4-Ezh2, pLU-cont (control) siRNA, or pLU-Ezh2 siRNA, together with three packaging plasmids (pMDLg/pRRE, pRSV-RSE and pVSV-G) using a transfection protocol of calcium phosphate-DNA precipitation. Medium containing viral particles was collected 48 h after transfection. Lentiviruses in the medium were concentrated by ultracentrifugation at 25,000 rpm, 4°C for 90 min and stored at -80°C. To infect cells, concentrated Lentivirus was added to the cells with the medium containing 8 μg/ml polybrene. The medium was replaced with normal culture medium 6 h post viral addition.
Luciferase reporter assay
Each well of PC-3 cells cultured on a 12-well plate was transfected with 50 ng of a reporter or mutated reporter plasmid, miR-101 or miR-26a mimic (with a final concentration of 100 nM in each well), 100 ng of plasmid expressing secreted alkaline phosphatase (SEAP) driven by a β-actin promoter and other expression plasmids if needed. Aliquots of medium from the transfected wells were collected 48 h posttransfection to measure luciferase activity. Fifty μl of the medium (diluted if necessary) was mixed with 100 μl of substrate solution containing 0.5 μg/ml of coelenterazine (CTZ), 200 mM NaCl, 50 mM Tris·HCl and 0.01% Triton X-100, at pH 8.7. The light emission was measured at a wavelength of 480 nm and normalized with the SEAP expression [
27].
Cells were resuspended in Triton Extraction Buffer (phosphate buffered saline, containing 0.5% Triton X-100, 2 mM phenylmethylsulfonyl fluoride, 0.02% NaN3), lysed on ice with gentle shaking for 10 min, and centrifuged at 2,000 rpm for 10 min in 4°C. The cell pellet was washed with the Triton Extraction Buffer and centrifuged as above. To extract the histones, the cell pellet was resuspended in 0.2 N HCl and incubated overnight at 4°C with gentle shaking. After centrifuging at 2,000 rpm for 10 min in 4°C, the supernatant containing histone extract was transferred to a new tube and analyzed by Western blot.
Clonogenic assay
PC-3 cells were transfected with control miRNA (miR-cont) or miR-101 mimics using Lipofectamine 2000 (Invitrogen). Forty-eight hours post-transfection, cells were plated at various densities (125, 250, 500, 1000 and 2000) in 6-cm cell culture dishes. After 7-10 days, the cells were fixed with 10% formalin and stained with 0.1% crystal violet. Colonies with 50-cells or greater were counted on each dish.
Androgen Starvation and Bicalutamide treatment
LNCaP cells were seeded and cultured in complete medium for 48 h. The medium was replaced by phenol red-free RPMI media containing 1% charcoal-stripped FBS (Invitrogen). Cells were allowed to adapt to this androgen deprivation condition for an additional 24 h before treating with 0, 0.01, 0.1, 1.0, and 10 nM R1881. For the treatment of inhibiting androgen receptor, LNCaP cells in the androgen deprivation condition were pre-treated with 5 μM of bicalutamide (B9061, Sigma) before R1881 addition.
WST-1 cell proliferation assay
LNCaP, DU-145 and PC-3 cells were assayed differently. LNCaP cells were plated at a density of 6000 cells/well in 96-well plates and transfected with the control miRNA (miR-cont) or miR-101 mimics using siPort NeoFX lipofectamine (Ambion). At each time point, cell proliferation in triplicates was measured using WST-1 (Roche) following the manufacturer's protocol. DU-145 and PC-3 cells were transfected with miR-cont or miR-101 mimics using Lipofectamine 2000 (Invitrogen) in 6-well plates. Forty-eight hours post-transfection, cells were seeded in triplicate at a density of 2000 cells/ml in 96-well plates. Cell proliferation at each time point was determined as described above.
Real-Time RT-PCR analysis
Total RNA from cells was extracted using TRIzol reagent (Invitrogen). Levels of mature forms of miR-101 or miR-26a in cells were determined by TaqMan MicroRNA Assays (Applied Biosystems), and data were normalized to U6 expression (Applied Biosystems). To determine the levels of Ezh2 mRNA in cells, 2 μg of RNA was incubated with 0.5 μg/μl of oligo dT primer (Promega) at 70°C for 5 min. The following reverse transcriptase mix was then added and incubated at 42°C for 1 h: 5 μl of 5× MMLV buffer, 5 μl of 10 mM dNTP, 0.6 μl of RNasin, 1 μl of MMLV reverse transcriptase, 13.4 μl of nuclease-free water. Quantitative PCR analysis using Taqman Gene Expression Assays was then performed for Ezh2 expression, and data were normalized to GAPDH expression (Applied Biosystems). All analyses were performed using the ABI7000 sequence detection system. The ΔΔC
T method [
28] was used to calculate relative expression.
Matrigel invasion assay
One hundred μl of Matrigel (BD Biosciences, diluted to 1 mg/ml in serum free-cold cell culture media) was added into an upper chamber of a 24-well transwell plate and incubated at 37°C for 4 h until the Matrigel solidified. Cells to be tested were starved in FBS-free medium for 18-24 h, then harvested by trypsinization and washed 3 times with medium containing 1% FBS and resuspended in the same medium at a density of 1 × 106 cells/ml. The polymerized Matrigel was gently washed with warmed serum-free culture media. One hundred μl of the cell suspension was added on top of the Matrigel, while 650 μl of complete medium with 10% FBS was added to each bottom chamber. The assembled chamber was incubated at 37°C in a cell culture incubator for 48 h. The medium in the top and bottom chambers was carefully aspirated, followed by washes with PBS. The cell invasion was quantified by counting the cells stained by crystal violet.
Migration Assay
LNCaP cells were transfected by miR-cont or miR-101 mimics. After 72 h, the cells were resuspended in RPMI with 1% FBS at a density of 1 × 105 cells/ml. Five hundred μl of the cell suspension was added to the upper chamber (Becton Dickinson, 35-3097, 8 μm pore size), while 750 μl of RPMI with 5% FBS was added to the lower chamber. The chambers were incubated at 37°C in a cell culture incubator for 24 h. Cell migration was quantified by counting the cells stained by crystal violet.
Wound healing assay
LNCaP cells transfected by miR-cont or miR-101 mimics were seeded in a 6 well plate and cultured for 72 h to obtain 80% monolayer confluency. A wound was created by scraping the cells using a plastic pipette tip, and the medium was replaced with fresh medium. Images were captured immediately (day 0) and every day for 5 days. Cell migration was qualitatively assessed by the size of the wounds at the end of the experiment.
Discussion
Prostate tumorigenesis is accompanied by deregulated gene expression. It has been well established that aberrant DNA methylation and histone modifications contribute to these processes. Recently, changes of miRNA profile in cancer cells and their roles in tumorigenesis have been increasingly appreciated. Since the major biological function of miRNAs is mediating gene expression, we investigated how essential genes in prostate tumorigenesis are regulated by different miRNAs, and whether the miRNA-mediated gene expression is important in PCa development. Multiple studies indicated that Ezh2 is potentially a prognostic marker and therapeutic target of PCa [
15,
18,
49]. Therefore, our initial study investigated whether Ezh2 expression is regulated by miRNAs in prostate tumorigenesis.
In this report, we demonstrated that the 3'-UTR of Ezh2 contains the target sites of both miR-101 and miR-26a and these sites are conserved among different species. However, while ectopic expression of miR-101 decreased the endogenous Ezh2 in all three tested cell lines, miR-26a only inhibited Ezh2 in DU-145 cells, but not in PC-3 and LNCaP cells. The mechanism underlying this observation is still unclear and advanced understanding of the dynamic regulation of miRNAs may provide an explanation of this phenomenon. Currently, several algorithms are available to predict potential miRNA target sites in a given mRNA sequence. Most of them employ a scoring system that identifies highly complementary sites using dynamic programming alignment and rewards complementarity at the 5' end of the microRNA. However, these algorithms cannot predict whether a potential target site is blocked by a secondary structure or RNA binding protein(s), which makes it inaccessible [
50]. A recent report also indicates that single nucleotide polymorphisms inside microRNA target sites affect miRNA-mediated gene inhibition and consequently influence tumor susceptibility [
40]. Therefore, the presence of a miRNA target site in a mRNA does not assure that the gene is regulated by this miRNA. On the other hand, a handful of evidence suggests that genes regulated by certain miRNAs may not contain canonical target sites predicted by most algorithms [
51‐
53]. Since our DNA sequencing analysis did not detect any mutation at the potential miR-26a target site in Ezh2 3'-UTR of PC-3 cells, we predict that lack of inhibition of miR-26a to the endogenous Ezh2 expression may be due to the interference of RNA binding proteins in PC-3 and LNCaP cells. When the 493-bp DNA fragment containing 443-bp of Ezh2 3'-UTR was subcloned into the reporter construct, these potential RNA binding proteins that interfere with the miRNA binding may have been saturated due to the robust expression of the reporter plasmid. This may explain the responsiveness of the reporter construct to the ectopic miR-26a in all three cell lines. Since the composition of the cellular proteins and microenvironment can be cell type specific, the response of endogenous Ezh2 expression to miR-26a may also change. Therefore, miR-26a could downregulate Ezh2 in DU145 cells, but not in PC-3 and LNCaP cells (Fig.
3G). In addition, miR-26a was also reported to negatively regulate Ezh2 expression in myoblasts and lymphoma cells [
33,
34].
MicroRNAs have been implicated in fine tuning the expression of target genes to physiologically relevant levels [
54,
55]. Therefore, consistent with previous reports on miRNAs' modulation of other gene expression, ectopically expressed miR-101 did not dramatically dampen the expression of endogenous Ezh2, although it exhibited much more pronounced inhibition to the luciferase reporter construct. Certainly, miR-101 must not be the only regulator of Ezh2 expression and it very likely collaborates with other miRNAs or transcription factors to adjust Ezh2 expression under different physiological conditions. However, it is reasonable to predict that downregulated miR-101 contributes to the increased expression of Ezh2 observed in PCa cells relative to the levels seen in normal prostate cells.
We observed ectopic miR-101 inhibited Ezh2 expression and led to markedly decreased invasiveness of all three tested cell lines. Importantly, our results of the negative regulation of Ezh2 by miR-101 are consistent with a recent report from the Chinnaiyan group showing that the genomic loss of miR-101 causes Ezh2 upregulation in PCa [
24]. At least in PC-3 cells, this phenomenon was due to the concomitantly reduced Ezh2 expression, since ectopically expressed Ezh2 restored the invasiveness (Fig.
4E). Consistently, we also observed the inhibitory effects of miR-101 on the invasiveness of DU145 cells and migrating ability of LNCaP cells (Fig.
5B and
5F). However, miR-101 exhibited differential effects on the proliferation of PC-3, DU-145 and LNCaP cells (Fig.
4B,
5A and
5D). While ectopic miR-101 caused growth defects of DU-145 cells and did not affect that of PC-3 cells, it surprisingly promoted LNCaP cell proliferation with concurrent morphological changes that were not observed in PC-3 and DU-145 cells. These results indicate that the ectopic miR-101 has differential effects in different prostate cell lines. The mechanisms underlying these phenotypic discrepancies need further investigation. It is also noteworthy that PC-3 cells are more aggressive than DU-145 and LNCaP cells, and PC-3 and DU145 are both androgen independent and AR negative. LNCaP cells are androgen dependent and have the lowest malignancy among these three cell lines. Thus, the effects of miR-101 introduction on cell proliferation may rely on the aggressiveness and AR status of the cells.
LNCaP cells with ectopic miR-101 exhibited a morphological change. In a time-lapse video microscopy study, we observed that these cells formed cytoplasmic extensions, reminiscent of filopodia, which was not shown in the cells expressing miR-cont (data not shown). When we further investigated whether this morphological change affected cell migration, we detected the decreased migrating rates in miR-101 transfected LNCaP cells compared to the cells with miR-cont (Fig.
5E-F). It is unclear whether Ezh2 regulates these alterations. We predict that other miR-101 regulated genes involved in cell migration may play a role in this morphological change of LNCaP cells.
We did not detect any significant difference of Ezh2 mRNA levels among PWR-1E, LNCaP, DU-145 and PC-3 cell lines, which is consistent with a previous study [
13]. These results suggest that at least in these cell lines Ezh2 overexpression in PCa is likely regulated at posttranscriptional levels, but not at transcription.
The effects of HIF-1β and AR on miR-101 indicate that the expression of miRNAs respond to the physiological and environmental changes. The DFO-induced expression of HIF-1α and HIF-1β led to decreased miR-101 expression, suggesting that miR-101 is a component in hypoxia-regulated signaling pathways. We also observed the upregulation of miR-101 in LNCaP cells treated by 10 nM of R1881, which was attenuated by an AR antagonist, bicalutamide. It is noteworthy that bicalutamide alone did not significantly decrease miR-101 levels (Fig.
6C), suggesting that without androgen stimulation AR does not have any detectable effect on miR-101 expression. However, in our further studies, although R1881 at 0.01 and 0.1 nM showed similar effects to that at 10 nM, the 1 nM of R1881 did not show any stimulation to miR-101 expression in multiple experiments (Fig.
6F). Meanwhile, at 0.01 nM of R1881 with increased miR-101 expression, cell proliferation was unexpectedly enhanced (Fig.
6E and
6F). The mechanisms to interpret these unexpected changes are unclear. We predict that differential activation of androgen-stimulated signaling pathways may contribute to them. Especially at 1 nM of R1881, certain proteins or pathways that need to be identified may have been altered, which causes the bypass of AR's regulation to miR-101 and consequently leads to the observation inconsistent with these at other R1881 levels. Multiple previous studies also demonstrated the differential effects of androgen on prostate cell proliferation [
47,
48].
We also noticed that at certain concentrations (0.1 and 1.0 nM) of R1881, the expression levels of miR-101 and Ezh2 (Fig.
6F and
6G) did not show a correlation as we observed in Fig.
6C. We predict that other R1881/androgen receptor-regulated pathways may play a role in mediating Ezh2 expression at these conditions.
Overall, the regulation of HIF-1α/HIF-1β and androgen receptor suggests a role of miR-101 in tumor progression and normal prostate development. Further investigation is needed to delineate the mechanisms underlying the altered expression of miR-101 during prostate cancer hypoxia and prostate cell differentiation.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
PC and GS initiated the project and designed the study. PC performed the experiments. MW and WH assisted with the Matrigel Invasion Assay and some other experiments. ZD, SDC, JX and ML participated in the design of the study. All authors helped in discussing, reading, and proofreading the final manuscript.