MicroRNA-155-3p promotes hepatocellular carcinoma formation by suppressing FBXW7 expression

Hepatocellular carcinoma tumor tissues and normal liver tissues (para-cancerous tissues) were randomly collected from HCC patients who underwent curative resection with informed consent between 2012 and 2014 at the Department of Hepatobiliary Surgery, Affiliated Hospital of Guilin Medical University. All tissues were collected immediately upon resection of the tumors in the operation theater, transported in liquid nitrogen, and then stored at -80 °C.We set the samples on the slide glass and microscopically recognized the malignantly transformed epithelial lesion by H&E staining, then cored out the epithelial lesion. Study protocols were approved by the Hospital Ethics Committee of Guilin Medical University, and written informed consent was obtained from patients based on the Declaration of Helsinki.

Total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). The miR-155-3p and U6 levels were quantified using qRT-PCR with the TaqMan® Micro-RNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and TaqMan® MicroRNA Assays (Applied Biosystems) according to the manufacturer’s instructions. We assessed the RNA expression according to relative quantification using the 2^-ΔΔCt method to determine the fold change in the expression. The primers used for the expression analysis were as follows: GAPDH-forward, 5′-C TCATGACCACAGTCCATGC-3′: GAPDH-reverse, 5′- TTACTCCTTGGAGGCCATGT-3′: U6-forward, 5′- CTCGCTTCGGCAGCACA -3′: U6 - reverse, 5′- AACGCTTCACGAATTTGCGT 3′. FBXW7 - forward, 5′- GGG AGCACTTTGCTGAAATC-3′: FBXW7 - reverse, 5′- CAGCAGCCACTTCTTGAAAC -3′.

miR-155-3p levels were determined by two-step real time-PCR. Reverse transcription reaction was performed with specific microRNA primers. Real time PCR amplification was carried out with a Rotorgene 3000 machine (Corbett). Relative microRNA concentrations are given as the ratios between the amount of the target gene and the endogenous control U6.

The human HCC cell lines THLE-3, HepG2, Hep3B and SUN475 were obtained from RIKEN BioResource Center (Tsukuba, Japan) and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10 % FBS, 2 mM L-glutamine and 100 U/ml of penicillin and streptomycin in a 6-cm dish. BEL-7405, BEL-7404 and BEL-7402 were obtained from the ATCC (Manassas, VA, USA) and maintained in Mc-Coy’s 5a Medium with 10 % FBS, 2 mM L-glutamine and 100 U/ml of penicillin and streptomycin and in Roswell Park Memorial Institute medium 1640 with 10 % FBS, 2 mM L-glutamine and 100 U/ml of penicillin and streptomycin.

Precursor- miR-155-3p was transfected into BEL-7405 using the BLOCK-iT™ Lentiviral miR RNAi Expression System (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol, as previously described. After transfection, we performed blasticidin selection at a concentration of 2.5 μg/ml for 10 days.

A total of 200nM of microRNA Hairpin Inhibitor and its negative control (Thermo Scientific Dharmacon, Lafayette, CO, USA) were employed to transiently inhibit miR-155-3p and transfected 48 h prior to seeding with Oligofectamine (Invitrogen).

A total of 1.0 × 10⁵ cells were seeded in a layer of 0.4 % noble agar/DMEM/1 % FBS/0.5 μg/ml of puromycin or 0.4 % noble agar/DMEM/5 % FBS over a layer of 0.5 % bactoagar/DMEM/1 % or 5 % FBS in a 6 cm dish. The colonies were stained using 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide solution (Sigma-Aldrich, St. Louis, MO, USA) and counted.

Cells were seeded in 96-well plates in triplicate at densities of 1 × 10³ per well. Cell proliferation was monitored at desired time points using 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) (Promega). In brief, the MTT assay was performed by adding 10 μl MTT (10 mg/ml) for 4 h. Light absorbance of the solution was measured at 570 nm on a microplate reader.

All experiments were conducted in accordance with guidelines authorized by the Animal Research Committee of Guilin Medical University. Six-week-old BALB/c nude mice were injected subcutaneously into their flanks with 2 × 10⁷ BEL-7405 mock or BEL-7405 miR-155-3p cells bilaterally in 200 μl of normal culture medium. All mice were sacrificed on day 28, and the tumor weight was measured.

SDS-PAGE and immunoblotting were carried out as described elsewhere [28]. Briefly, filters were incubated with rabbit polyclonal antibodies against FBXW7, mouse monoclonal antibodies against β-actin (1:2,000 dilution, Abcam, Cambridge, UK).

To investigate the translation of FBXW7, luciferase reporter assay was carried out as described [29]. The wild-type or mutant FBXW7 3’-UTR sequence was inserted downstream of the firefly luciferase reporter gene, which was controlled by the SV40 enhancer for expression in mammalian cells, whereas no oligonucleotides were inserted in the control vector (Genecopoeia, Rockville, MD, USA). Renilla luciferase was used as a tracking indicator for successful transfection. In order to investigate the transcription of FBXW7, luciferase reporter constructs for the promoters of these molecules and a positive control of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were obtained (SwitchGear Genomics, Menlo Park, CA, USA). The luciferase activity was measured using Light- Switch Assay Reagent (SwitchGear Genomics) according to the manufacturer’s instructions. Briefly, 1.0 to 1.5 × 10⁴ cells were seeded in white 96–well plates on day 1 and transfected with reporter constructs on day 2 using FuGENE HD (Promega). The luciferase activity was measured using assay reagent 48 h after transfection.

FBXW7 lentiviruse (Sigma-Aldrich) was transfected into BEL-7405-miR-155-3p cells in 48-well plates according to the manufacturer’s instructions. The multiplicity of infection (MOI, number of transducing lentiviral particles per cell) was 5. We performed puromycin selection at a concentration of o.5 μg/ml for 10 days.

One siRNA lentiviruse against FBXW7 (Sigma-Aldrich) and non-targeting siRNA (Sigma-Aldrich) were transfected into HepG2-Anti-miR-155-3p cells in 48-well plates according to the manufacturer’s instructions. The multiplicity of infection (MOI, number of transducing lentiviral particles per cell) was 5. We performed puromycin selection at a concentration of 0.5 μg/ml for 10 days.

Formalin-fixed, paraffin-embedded tissues were used to detect the FBXW7 expression. The sections were incubated with anti-FBXW7 rabbit polyclonal antibodies (Abcam, Cambridge, UK) at 1:300 dilution. A semi-quantitative scoring system was used to evaluate the intensity of staining: low (proportion: 0 to 50 %, intensity: no staining to weak) and high (proportion: more than 50 %, intensity: intermediate to strong).

RNeasy Lipid Tissue Mini kit (Qiagen) was used to isolate total RNA from the different cells according to the manufacturer’s protocol and RNA were stored in liquid N2 at -80 °C until further processing. The quantity and quality of RNA were assessed using a NanoDrop ND-1000 spectrophotometer and an Agilent Bioanalyzer and samples with an RNA Integrity number (RIN) > 7 were only used for further analysis. For microarray hybridizations, 100 ng of total RNA was amplified and labeled using the MessageAmp Premier Kit (Ambion). Equal amounts of labeled cRNA were hybridized to the Affymetrix Genome 2.0 microarray (Affymetrix) according to the manufacturer’s protocol. Partek Genomics Suite 6.4 (Partek Inc., St. Louis, MO) was used to perform data analysis. Robust multi-chip analysis (RMA) normalization was done on the entire data set. Multi-way ANOVA and fold change were performed to select target genes that were differentially expressed between the different comparisons. Top differentially expressed genes were selected with p value cut-off of 0.05 based on ANOVA test and fold change cut-off of ≥ 2. Gene Ontology Enrichment analysis on the gene lists were performed with chi-square test and limited to functional groups with more than two genes. Hierarchical Clustering was performed on differentially expressed genes based on Average Linkage with Pearson’s Dissimilarity. Additionally, the gene lists were analyzed using the GeneGo software for obtaining pathway maps, biological networks and diseases relevant to the list.

The data are presented as the mean ± SEM. The unpaired two-tailed Student’s t-test, Mann-Whitney’s Utest and Chi-square test were used for comparisons, with a p value of < 0.05 considered to be significant (*).

In order to investigate whether the miR-155-3p expression is correlated with the HCC tumorigenesis, we examined miR-155-3p expression levels in a panel of 45 human HCC tissues (Fig. 1a). We found that the level of miR-155-3p was elevated in most of the malignant HCC tissues by 1.5 to 6 fold as expected (Fig. 1b). To investigate the clinical value of elevated miR-155-3p expression in HCC, we assessed the association between miR-155-3p expression levels and clinical significance in HCC tissues samples. MiR-155-3p expression levels are significantly elevated in patients of stage III-IV in compared with the stage I-II (Fig. 1c). To determine the prognostic impact of miR-155-3p expression in HCC, we categorized HCC patients into two groups based on miR-155-3p expression levels. Patients with tumors displaying high miR-155-3p expression levels had significantly shorter percent survival compared with those with low miR-155-3p (Fig. 2).

Then we examined miR-155-3p expression levels in a panel of 7 widely used human HCC cell lines in comparison to levels in non-malignant cell lines THLE-3(Fig. 3a). Correspondingly, miR-155-3p expression levels are consistently elevated in HCC cell lines. Since miR-155-3p is overexpressed in human HCC tissues and cancer cell lines, we considered whether miR-155-3p functions as an oncomir. We established BEL-7405 cells overexpressing miR-155-3p by introducing precursor-miR-155-3p using lentivirus vectors because the miR-155-3p expression level in BEL-7405 cell was the lowest among the several HCC cell lines analyzed and lentivirus vectors can be efficiently transfected into this cell line. The presence of a mature-miR-155-3p expression was confirmed by using qRT-PCR (Fig. 3b).

To corroborate this assumption, we tested whether overexpression of miR-155-3P in BEL-7405 cells promotes cell growth and colony formation ability by using MTT and colony formation assay. Overexpression of miR-155-3p strongly stimulates cell proliferation compared to control cells indicating that miR-155-3p is potentially oncogenic (Fig. 3c). In addition, it significantly promoted colony formation (Fig. 3d and e). The miR-155-3p mediated tumorigenic effects were confirmed in an in vivo model. A significant increase in tumor weight was observed in the BEL-7405 cells with miR-155-3p overexpression compared with that noted in the controls in the nude mice subcutaneous tumor model (Fig. 4a). A dramatic increase in tumor growth was observed in BEL-7405-miR-155-3p compared with the BEL-7405-vector (Fig. 4b). These findings demonstrate that miR-155-3p can promote HCC cell proliferation in vitro and in vivo.

Since the miR-155-3p expression level of HepG2 was highest among the several HCC cell lines analyzed, we suppress miR-155-3p expression in HepG2 cells by introducing Anti- miR-155-3p using lentivirus vectors and lentivirus vectors can be efficiently transfected into this cell line. The presence of a mature-miR-155-3p expression was confirmed by qRT-PCR (Fig. 5a).

Then we tested whether downregulation of miR-155-3p in HepG2 cells reduces cell growth and colony formation ability. Downregulation of miR-155-3p can strongly inhibit cell proliferation (Fig. 5b) and significantly restrains colony formation compared to control cells (Fig. 5c and d). The miR-155-3p mediated tumorigenic effects were confirmed in an in vivo model (Fig. 6a). A significant reduces in tumor weight was observed in the miR-155-3p downregulated HepG2 cells compared with that noted in the controls in the nude mice subcutaneous tumor model (Fig. 6b). These findings demonstrate that miR-155-3p induces a more aggressive phenotype of HCC.

To better characterize the mechanisms by which miR-155-3p engaged in HCC development and progression, microarray assay was performed in cell line BEL-7405-miR-155-3p and its control cells with the empty plasmid. Microarray results indicated that a list of genes expression significantly changed after overexpression of miR-155-3p (Fig. 7a). Furthermore, gene set enrichment analysis indicated that FBXW7 gene signature was significantly enriched in miR-155-3p overexpression cells (Fig. 7b). These results suggested that miR-155-3p regulates HCC cells proliferation may be mediated by FBXW7.

To confirm that FBXW7 is a target of miR-155-3p in BEL-7405 and HepG2 cells, the mRNA and protein levels of FBXW7 were analyzed by qRT-PCR and western blot in overexpressed miR-155-3p BEL-7405 cells and inhibited miR-155-3p HepG2 cells. We found that FBXW7 was downregulated in the miR-155-3p overexpressed cells both in mRNA and protein levels (Fig. 8a and b), whereas FBXW7 was increased by the miR-155-3p specific inhibitor compared with that observed in the control cells (Fig. 8d and e). The FBXW7 protein expression was also confirmed by immunohistochemical analysis in vivo tumor tissues (Fig. 8c and f).

We next performed a luciferase reporter assay to assess whether miR-155-3p inhibits the translation of FBXW7. One potential binding site for miR-155-3p was found in the 3’-UTR region of FBXW7 mRNA and FBXW7 3’-UTR possessing a mutation in the putative miR-155-3p binding site (Fig. 9a and b). The detection of a luciferase activity revealed that miR-155-3p significantly suppressed the activity of luciferase combined with wild-type FBXW7 3’-UTR in the BEL-7405 miR-155-3p cells (Fig. 9c) and increase FBXW7 3’-UTR in the HepG2 miR-155-3p cells, whereas no differences were observed following treatment with the control luciferase and FBXW7 3’-UTR possessing a mutation in the putative miR-155-3p binding site (Fig. 9d). These results suggest that miR-155-3p may directly bind to FBXW7 mRNA and regulates the FBXW7 expression via translational inhibition.

In order to investigate whether FBXW7 is responsible for the enhanced clone formation and proliferation ability of BEL-7405 cells, BEL-7405-miR-155-3p cells were transfected with FBXW7 or empty plasmid and FBXW7 expression were analyzed by Western blotting (Fig. 10a). The treated cells were evaluated for tumorigenesis using a MTT assay (Fig. 10b) and colony formation assay (Fig. 10c). Overexpression of FBXW7 strongly inhibited cell proliferation compared to control cells, and decreased colony formation was clearly observed in the cells with FBXW7 overexpression, whereas transfected with empty vector did not affect colony formation.

The expression of FBXW7 in HepG2-Anti-miR-155-3p cells was suppressed by siRNA and FBXW7 protein levels were analyzed by Western blot (Fig. 11a). The treated cells were evaluated for proliferation property using a MTT assay (Fig. 11b) and colony formation assay (Fig. 11c). Interference of FBXW7 expression strongly enhanced cell proliferation compared to control cells. Increased colony formation was clearly observed in the cells with FBXW7 suppression, whereas treatment with nonspecific siRNA did not affect colony formation. These results suggest that inhibition of FBXW7 expression induced by miR-155-3p is responsible for clone formation and proliferation ability in HCC cells.