Background
Polycystic ovary syndrome (PCOS) is one of the most common endocrine metabolic disorders affecting about 5% women of reproductive age [
1]. It is characterized by hyperandrogenism, polycystic ovaries and ovulatory dysfunction, but also associated with insulin resistance, cardiovascular risk, obesity, abnormal granulosa cells (GCs) proliferation as well as arrest of follicle growth [
2‐
4]. It has been estimated that genetic and environmental factors play an important role in the pathogenesis of PCOS, but the underlying molecular mechanism is still unclear [
5,
6].
A distinctive feature of PCOS is the accumulation of preantral and antral follicles exceeding by 2–3 fold that of normal ovaries, and this might be due to the arrest of follicle growth typically occurs when follicular diameter reaches 5–8 mm [
7‐
9]. Throughout oocyte development, it has been demonstrated that there is an interdependence between the oocyte and its surrounding GCs, the support of which is essential to provide the oocyte with a suitable microenvironment, such as nutrients and growth regulators [
10‐
12]. Moreover, recent reports confirm that the dysfunction of GCs in PCOS ranging from decreased proliferation and increased apoptosis to hormone production disorders is closely associated with abnormal folliculogenesis [
13].
MicroRNAs (miRNAs) are a class of single-stranded and non-coding RNAs (20–24 nucleotides), which down-regulate the expression of target genes in a post-transcriptional manner by binding to the 3′-untranslated region (UTR) of target mRNA [
14]. Studies have shown that aberrant expressions of miRNAs are associated with the pathological progression of various diseases, including cancer, metabolic diseases and reproductive disorders [
15‐
17]. Furthermore, miRNAs are revealed to be involved in the regulation of proliferation, apoptosis and steroidogenesis in GCs, the dysregulation of which may play an important role in the pathogenesis of PCOS [
18,
19]. Our recent study has demonstrated that miR-200c was dramatically increased in GCs of PCOS [
20]. However, there is little known about the functional role of miR-200b and miR-200c in the development of PCOS. Therefore, the purpose of this study is to explore whether miR-200b and miR-200c are involved in the abnormal proliferation of PCOS GCs and its underlying mechanism.
Methods
Clinical samples
A total of 160 participants (90 PCOS and 70 controls) who underwent intracytoplasmic sperm injection (ICSI) or in vitro fertilization (IVF) at the Center for Reproductive Medicine, Shandong University were included. This research was approved by the Institutional Review Board of Center for Reproductive Medicine of Shandong University and formal written consent was obtained from each patient. PCOS was diagnosed according to the revised Rotterdam consensus, and women with regular menstruation and normal ovarian function served as controls [
21]. The clinical and endocrine parameters of PCOS patients and controls were analyzed and presented in Table
1. GCs were collected from each participant as described previously, and then immediately stored at − 80 °C for further analysis [
22].
Table 1
Clinical and endocrine parameters of PCOS patients and controls
Age (years) | 28.30 ± 3.01 | 28.65 ± 2.42 | NS |
BMI (kg/m2) | 24.40 ± 3.62 | 21.75 ± 2.45 | < 0.001 |
FPG (mmol/L) | 5.41 ± 0.44 | 5.17 ± 0.43 | < 0.001 |
FINS (mIU/L) | 15.31 ± 7.79 | 7.87 ± 1.94 | < 0.001 |
LH (IU/L) | 8.29 ± 3.80 | 4.95 ± 1.43 | < 0.001 |
FSH (U/L) | 5.88 ± 1.05 | 6.48 ± 1.09 | < 0.001 |
T (ng/dL) | 39.02 ± 15.69 | 22.63 ± 7.48 | < 0.001 |
AMH (ng/ml) | 9.28 ± 4.22 | 4.05 ± 1.83 | < 0.001 |
AFC (mmol/l) | 26.10 ± 8.87 | 13.02 ± 3.52 | < 0.001 |
Cell culture
Asteroidogenic human granulosa-like tumor cell line, KGN (a gift from RIKEN BioResource Center, Ibaraki, Japan), maintained the physiological characteristics of ovarian cells [
23]. The cells were grown in DMEM/F12 (HyClone) supplemented with 10% FBS (HyClone) and 1% antibiotics (HyClone), while the human embryonic kidney (HEK) 293 T cell line was cultured in DMEM High Glucose (HyClone) supplemented with 10% FBS and 1% antibiotics. All cells were cultured in a humidified atmosphere containing 5% CO
2 at 37 °C.
Cell transfection
MiR-200b mimics, miR-200b inhibitor, miR-200c mimics, miR-200c inhibitor, mimics control, inhibitor control and specific small-interfering RNA (siRNA) for phosphatase and tensin homolog (PTEN) were designed and synthesized by Boshang (jinan, China). The transfection of miRNAs and siRNA was performed with X-tremeGENE siRNA Transfection Reagent (Roche) according to the manufacturer’s instructions at 100 nM and 50 nM respectively. The transfected cells were incubated at 37 °C and harvested at the indicated time points (24 h or 48 h) for the following assays.
RNA extraction and qRT-PCR
In order to verify the expression of PTEN at mRNA level, total RNA was extracted from cells by using TRIzol Reagent (Invitrogen) and reversely transcribed into cDNA with PrimeScript RT reagent Kit With gDNA Eraser (Takara) according to the manufacturer’s instructions. However, the RNA extracted by miRNeasy Mini Kit (Qiagen) was reversely transcribed into cDNA using MiRNA-X miRNA First-Strand Synthesis Kit (TaKaRa) for microRNA verification. Then, qRT-PCR was performed on a Light Cycler 480 system by using SYBR Premix Ex Taq (Takara) according to the manufacturer’s instructions. U6 and ACTIN were used to normalize the expression of miRNAs and PTEN respectively. The relative expression was calculated using the 2
−△△CT method and the primers were listed in Table
2.
Table 2
Primer sequences for qRT-PCR
microRNA-200b-3p | 5’GCTAATACTGCCTGGTAATGATGA3’ |
microRNA-200c-3p | 5’CTAATACTGCCGGGTAATGATGGA3’ |
U6 | F: 5’GCTTCGGCAGCACATATACTAAAAT3’ |
R: 5’CGCTTCACGAATTTGCGTGTCAT3’ |
PTEN | F: 5’TGGATTCGACTTAGACTTGACCT3’ |
R: 5’GGTGGGTTATGGTCTTCAAAAGG3’ |
ACTIN | F: 5’TTCGAGCAAGAGATGGCCA3’ |
R: 5’CGTACAGGTCTTTGCGGAT3’ |
Western blot
After treatment, total protein was harvested in 1 × SDS loading buffer and equal amounts of protein were separated by sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE). The polyvinylidene fluoride (PVDF) membranes (Millipore, USA) transferred with bands were blocked with 5% milk and then incubated with primary antibodies at 4 °C overnight. After the membranes were incubated with peroxidase-conjugated secondary antibodies (Zhongshan, Beijing, China) for 1 h at room temperature, BIO-RAD ChemiDoc MP Imaging System and Image Lab Sofware were used to detect and analyze immunoreactive bands. The primary antibodies for immunoblotting included anti-PTEN (Proteintech, 60300–1-Ig) and anti-ACTIN (Cell Signaling Technology, 4970 s).
Cell counting kit-8 (CCK-8)
KGN cells transfected with miRNAs or siRNA for 24 h were reseeded in 96-well plates at 4000 cells/well. Then, cell proliferation ability was assessed using the CCK-8 assay (Beyotime, China) according to the manufacturer’s instructions at 0, 24 and 48 h respectively.
Luciferase reporter assay
Wild type (WT) and mutant type (MUT) recombinant reporter plasmids of PTEN were synthesized by GeneCopoeia, Guangzhou, China. These plasmids were co-transfected with miR-200b mimics, miR-200c mimics or mimics control into HEK293T cells using X-tremeGENE siRNA Transfection Reagent. After transfection for 48 h, cultured supernatant was collected and measured by Secrete-Pair™ Dual Luminescence Assay Kit (Genecopoeia) according to the manufacturer’s instructions.
Statistical analysis
All statistical analyses were performed using SPSS 21.0 (SPSS, Chicago, IL, USA), and data were presented as mean ± standard deviation (SD). Kolmogorov–Smirnov was used to assess whether the data were of normal distribution. Normally distributed variables were analyzed by Student’s t-test to determine statistical significance, while nonparametric data were assessed using the Mann-Whitney U test. Logistic regression was used to adjust age and BMI to avoid their potential effects on the expression of miR-200b. P < 0.05 was considered statistically significant (*P < 0.05; **P < 0.01; ***P < 0.001).
Discussion
The aim of this study was to explore whether miR-200b and miR-200c were involved in the abnormal proliferation of PCOS GCs and its underlying mechanism. And our results demonstrated that the expression of miR-200b was significantly increased in PCOS patients, and over-expression of miR-200b and miR-200c inhibited the proliferation of KGN cells. In addition, PTEN was a direct target of miR-200b and miR-200c in KGN cells, knockdown of which revealed similar proliferation-inhibiting effect as observed when miR-200b and miR-200c were over-expression.
Increased expression of miR-200b was observed in PCOS GCs, and the previous study showed that the expression of miR-200c was also up-regulated, both of which contributed a lot to insulin resistance, one of the typical characteristics of PCOS [
20,
24,
25]. In addition, miR-200b and miR-200c were closely related to proliferation. Li Y et al. reported that miR-200b inhibited the proliferation of osteosarcoma cells via targeting ZEB1, while another study indicated that over-expression of miR-200c significantly suppressed cells proliferation in lung cancer [
26,
27]. However, a large number of studies about miR-200b and miR-200c were mainly focused on cancer, while it was relatively limited in PCOS. This was the first time to confirm that miR-200b and miR-200c were involved in inhibiting the proliferation of KGN cells, suggesting that both miR-200b and miR-200c play crucial roles in the abnormal proliferation of GCs, which might lead to PCOS.
It has been reported that PTEN was a direct target of miR-200b and miR-200c in endometrial cancer and nasopharyngeal carcinoma [
28,
29]. In addition, a growing number of studies indicated that PTEN played an important role in the abnormal proliferation of PCOS GCs [
30,
31]. In consistent with the above results, our research further proved that PTEN was a direct target of miR-200b and miR-200c in KGN cells, and down-regulation of PTEN suppressed KGN cells proliferation. These findings, along with our previous observation of dramatically decreased expression of PTEN in PCOS GCs, suggest that PTEN might be responsible for the decreased proliferation potential of GCs in PCOS, and leads them prone to apoptosis, followed by follicular atresia [
32,
33]. However, Andreas E et al., who investigated the role of miR-17-92 cluster in bovine GCs, demonstrated that down-regulation of PTEN promoted the proliferation of GCs [
34]. The differences were likely due to different sources of cells. The GCs studied above were isolated from bovine small follicles (3–5 mm), while KGN cells used in our study were a steroidogenic human granulosa-like tumor cell line maintaining similar physiological characteristics to that of human immature GCs [
23]. In addition, as far as we know, the regulation process of GCs proliferation was complex and closely related to various factors [
35].
This is a pioneering study to elucidate the functions of miR-200b, miR-200c and PTEN in PCOS GCs and their relationships. In the meantime, there are two potential limitations in our study. On the one hand, a large number of PCOS patients are required to further verify the expressions of miR-200b, miR-200c and PTEN. On the other hand, it would be more conclusive and convincing if PTEN reintroduction could reverse the proliferation-suppressive roles of miR-200b and miR-200c. Therefore, we plan to continue this experiment in the following work.
Conclusions
In conclusion, we found that the expression of miR-200b was significantly increased in PCOS patients. In addition, over-expression of miR-200b and miR-200c inhibited the proliferation of KGN cells by targeting PTEN. These results provide new evidence for GCs dysregulation proliferation observed in PCOS. However, further studies are needed to investigate the underlying molecular mechanisms.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.