Background
While ovarian cancer is the fifth leading cause of death from cancer in women, it is the number one lethal, gynecological malignancy in the United States [
1]. Despite extensive clinical and basic research, only 27% of patients with advanced-stage ovarian cancer survive 5 years after their initial diagnosis. The high mortality of this disease reflects the relative absence of early symptoms and the high percentage (>60%) of patients diagnosed at an advanced stage [
1]. There is an urgent need to understand the mechanisms of ovarian cancer invasion and metastasis to foster the development of targeted therapeutic strategies.
MicroRNAs (miRNAs or miRs) are small non-coding RNA molecules of 20-25 nucleotides that regulate gene expression by targeting one or more messenger RNAs (mRNAs) for translational repression or cleavage. Instead of being translated into protein, mature single-stranded miRNA binds to mRNAs to interfere with the translational process. Nearly one-third of the encoded genes in mammalian cells are regulated by miRNA [
2,
3]. miRNAs have important roles in cellular processes such as development, differentiation, cell cycle, apoptosis, metabolism, and proliferation [
4,
5]. Abnormal miRNA expression has been found in numerous human malignancies using oligonucleotide miRNA microarray and RT-PCR technologies [
6]. About half of the human miRNAs are located in cancer-associated genomic regions that are frequently amplified, deleted, or rearranged in cancer. This suggests miRNAs have the potential to function as either tumor suppressors or oncogenes, and play a major role in cancer tumorigenesis and metastasis [
6].
Several microRNA profiling studies demonstrate aberrant expression of microRNAs in ovarian cancer [
7,
8]. Most of these microRNAs, including miR-199a and miR-125b, were down-regulated in ovarian cancer tissues compared to non-cancer tissues. Other microRNAs such as miR-200a, miR-200c and miR-141 were upregulated [
7,
8]. Human miR-205 is located on chromosome 1 and the effect of cancer on its expression is tissue and type specific. Multiple investigators have reported that miR-205 is up-regulated in lung, kidney and bladder cancers [
9,
10], but down regulated in prostate, esophageal, melanoma, and breast cancers [
11‐
14]. In prostate cancer, miR-205 re-expression induces the tumor suppressor genes IL24 and IL32 by targeting specific sites in their promoter regions [
11]. We found that miR-205 expression was significantly increased and TCF21 (a tumor suppressor gene) significantly decreased in epithelial ovarian carcinomas compared with normal ovary. TCF21 has been predicted using computational methods to be a potential target gene of miR-205. In this investigation, we test the hypothesis that miR-205 regulates TCF21 mediated tumor suppression in ovarian cancer leading to tumor progression.
Methods
Clinical specimens
Thirty (30) ovarian cancer samples and 12 normal ovary controls were collected from women undergoing surgery at University of Kansas Medical Center. All samples were from epithelial ovarian carcinomas, including 21 serous ovarian carcinomas and 9 mucinous ovarian carcinomas (8 stage I, 7 stage II, 7 stage III, 8 stage IV). The average age of the cancer patients was 57.9 years, while the average age of women providing normal ovaries was 58.5 years. The tissues were collected intraoperatively and snap-frozen in liquid nitrogen immediately after collection, then stored at -80 °C for future analysis. Documented, written consent was obtained from patients as approved by the human subjects committee at the time. This study was approved by Institutional Review Board (Human Subjects Committee) of University of Kansas Medical Center. The IRB ID is CR00000581 for Study 12,995.
Quantitative reverse-transcription PCR (qRT-PCR)
Total RNA was extracted using Trizol™ (Life Technologies) according to the manufacturer’s instructions. RNA purity and RNA concentrations were confirmed using NanoDrop™ (NanoDrop Technologies). cDNA was generated from 1 μg of total RNA using Omniscript™ RT kit (Qiagen) or NCode™ miRNA First-Strand cDNA Synthesis Kit (Life Technologies) according to standard procedures. Real-time qPCR to assess mRNA and miRNA expression was performed using SYBR green on the IQ5 Real-Time PCR thermocycler (Bio-Rad). Threshold cycle (Ct) values were calculated according to the iQ5 real-time detection software. Gene-specific primers are listed in Table
1.
Table 1
Primers used in Real-time qRT-PCR
TCF21 Forward | CAGATCCTGGCTAACGACAAA | NM_198392 |
TCF21 Reverse | CCACTTCTTTCAGGTCACTCTC |
MMP2 Forward | AAGTGGTCCGTGTGAAGTATG | NM_ 004530 |
MMP2 Reverse | GGTATCAGTGCAGCTGTTGTA |
MMP7 Forward | GAGTGAGCTACAGTGGGAACA | NM_ 002423 |
MMP7 Reverse | CTATGACGCGGGAGTTTAACAT |
MMP9 Forward | TGTACCGCTATGGTTACACTCG | NM_ 004994 |
MMP9 Reverse | GGCAGGGACAGTTGCTTCT |
MMP10 Forward | TTGGTCACTTCAGCTCCTTTC | NM_ 002425 |
MMP10 Reverse | CAACAGCATCTCTTGGCAAATC |
miR-205 Forward | TCCTTCATTCCACCGGAGTCTG | MIMAT0000266 |
miR-205 Reverse | Universal primer from Life Technologies |
Values were normalized to 18 s rRNA or U6 small nuclear (sn) RNA. The relative amount of mRNA or miRNA in each sample was calculated using the 2
-ΔΔCT method [
15] The results were expressed as fold change in the cancer group compared to control group.
Western blot analysis
Protein was extracted from tissue or cells with ice-cold lysis buffer (150 mM NaCl, 1% Igepal Ca- 630, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 50 mM Tris, pH 7.8) containing protease and phosphatase inhibitor cocktails (Sigma). Protein concentration was quantified using the Bradford™ reagent (Bio-Rad). Cleared lysates containing equivalent amounts of total protein (40 μg) were loaded onto a 15% acrylamide gel and electrophoresed in Tris/Glycine/SDS running buffer (Bio- Rad). Proteins were then transferred to polyvinylidene difluoride membranes with Tris/Glycine transfer buffer (Bio- Rad). Membranes were blocked in 2% non-fat milk and incubated overnight at 4 °C with the anti-TCF21 (1:500, Thermo Scientific-Pierce), anti- β-actin (1:500, Abcam). Primary antibodies were visualized using horseradish peroxidase-labeled species-appropriate IgG (1:5000 or 1:10,000; GE Healthcare Life Sciences) and enhanced chemiluminescence (GE Healthcare Life Sciences). Western blot results were captured by ChemiDOC Imaging System™ (Bio-Rad) and quantified by Image Lab Software (Bio-Rad).
TCF21 expression plasmid construction
The TCF 21 gene (NM_198392; 3249 bp; CDS 278-817) was amplified by PCR using specific forward: CCACGACTCTGGGAGTG (18-35), and specific reverse: GGAATCCTGCGTGCCAT (3122-3139) primers. The purified PCR product (3121 bp) was inserted into pcDNA™3.1D/V5-His-TOPO vector according to the manufacturer’s protocol (Life Technologies) and transformed into competent cells. The presence of the insert was confirmed by Hind III and XhoI double restriction enzyme digestion. The fidelity of cloned sequence was confirmed by DNA sequencing.
Cell culture and transfection
The OVCAR-5 and OVCAR-8 cell lines were kindly donated by Dr. Qi Chen [
16]. SKOV-3 was obtained from the American Type Culture Collection. Cells were cultured in DMEM (OVCAR-5) or RPMI medium1640 (OVCAR-8 and SKOV-3) with 10% fetal bovine serum and 1% penicillin/streptomycin (10,000 U) under standard cell culture conditions (37 °C, 5% CO
2). For transfection, cells were seeded at 0.5 × 10
6 cells per well in 6 well plates and cultured for 24 h. The synthetic miR-205 mimic (Qiagen, final concentration 50 nM), miR-205 inhibitor (Qiagen, final concentration 100 nM) and TCF21 plasmid (2.5 μg per well) were co-transfected into OVCAR-5, OVCAR-8 and SKOV-3 cells using Lipofectamine 2000™ (Life Technologies) 10 μl/well. The cells were harvested for RNA and protein isolation after 24 h incubation.
Construction of reporter gene and luciferase reporter assay
The TCF21 segment containing target site (2593-2600) of miR-205 or mutant TCF21 segment were PCR amplified using Hotstar HiFidelity™ Polymerase kit (Qiagen). Purified PCR products were digested with NheI and XbaI and directionally inserted downstream of the firefly luciferase reporter gene in the pmirGLO Dual-Luciferase™ miRNA target expression vector (Promega). The construct insert was sequenced and verified. Ovarian cancer cells were seeded at 0.5 × 105 cells per well in 24 well plates. miRNA-205 mimic (50 nM) (Qiagen), TCF21 reporter vector or mutant vector (0.25 μg), and the internal control pRL reporter vector (0.002 μg) were transfected into ovarian cancer cell lines using Lipofectamine 2000™ (Life Technologies). The cells were collected after 24 h incubation. The luciferase activity was measured using Dual-Luciferase Assay (Promega) and normalized with Renilla™ luciferase.
In vitro invasion assay
OVCAR-5, OVCAR-8 and SKOV-3 cells were seeded in 6 well plates at 0.5 × 106 cells per well with DMEM or RPMI medium1640 and 10% FBS for 24 h. Synthetic miR-205 mimic, miR-205 inhibitor or TCF21 expression plasmid were transfected into the cells with Lipofectamine 2000™ (Life Technologies). After 24 h, cells were harvested by trypsinization and counted. The invasive potential of the OVCAR-5, OVCAR-8 and SKOV-3 cells was evaluated using matrigel invasion chambers from BD Biosciences. The synthetic miR-205 mimic, miR-205 inhibitor, or TCF21 expression plasmid transfected cells in 500 μl of serum-free culture medium were placed on the matrigel-coated upper cell insert chambers (24-well inserts; pore size, 8 mm). Next, 750 μl medium containing 10% fetal bovine serum was placed in the lower chambers to serve as a chemoattractant. After 72 h of incubation at 37 °C and 5% CO2, cells that migrated through the matrigel onto the lower surface of the insert chambers were fixed and stained with 0.5% crystal violet (Sigma). The lower surface of the insert chambers was photographed with the ×10 objective using an inverted microscope (NIKON 80i). The numbers of cells were counted using image software.
Statistical analysis
Statistical comparisons were performed using Student’s t test. P values below 0.05 were considered statistically significant. Data are presented as mean ± S.E.M.
Discussion
miRNAs regulate diverse molecular pathways and can function as tumor suppressors and/or oncogenes by targeting specific mRNAs. Recent evidence suggested that miRNAs expression profiles differ among cancer types such as esophageal cancer [
13], lung cancer [
17], breast cancer [
18], prostate cancer [
19], colon cancer [
20], pancreatic cancer [
21], and ovarian cancer [
22,
23]. Other studies showed that over-expression or repression of miRNAs is tissue-specific and may possess opposing functions in different types of cancer. For example, miR-205 inhibited cancer cell proliferation and invasion in prostate, esophageal, melanoma, and breast cancer [
11‐
14,
24‐
27], but promoted tumorigenesis in lung and cervical cancer [
28,
29]. In the present study, we found that miR-205 expression was up-regulated in all stages (I – IV) of ovarian cancer tissue and ovarian cancer cell lines compared to normal ovary. miR-205 expression levels were associated with ovarian cancer stages, and increased significantly in stage III and stage IV ovarian cancer compared with stage I and II ovarian cancer. The increases of miR-205 in ovarian cancer cells: OVCAR-5, OVCAR-8 and SKOV-3 enhanced their invasive behavior. These findings are consistent with miR-205 being a tumor oncogene in ovarian cancer with important roles in tumor invasion and metastasis.
The TCF21 gene is located on chromosome 6q23 and encodes a basic, helix–loop–helix transcription factor that is essential for epithelial cell differentiation [
30,
31]. TCF21 is expressed in numerous tissues including lung, gut, gonad, urinary tract, spleen and kidney [
30]. Epigenetic-induced loss of TCF21 expression is a common event in human malignancies [
32‐
34]. TCF21 is silenced in squamous cell carcinomas, non-small-cell lung cancer cells, and clear cell renal cell carcinoma [
31,
35]. TCF21 acts as a tumor suppressor gene and a decrease in TCF21 resulted in increased undifferentiated mesenchymal cells, which in turn increased cancer cell migration [
36]. Tumors lacking TCF21 expression were two to three times larger and more vascular than TCF21
-positive tumors [
31]. One explanation for this behavior is that the loss of TCF21 decreases the activation of the known metastatic suppressor, KISS1, causing an increase in the metastatic potential of the tumor [
21,
33,
37]. TCF21 expression is downregulated in metastatic melanoma by hypermethylation of a promoter, and overexpression of TCF21 inhibits the motility of melanoma cells via KISS1 [
2,
33]. The present findings strongly support a role for TCF21 in cell invasion properties of ovarian epithelial cancers. We demonstrated that TCF21 expression was downregulated in stage I to stage IV ovarian cancer tissue and ovarian cancer cell lines. Decreased TCF21 expression levels were related to ovarian cancer stages. There were significantly decreased TCF21 expression in stage III and stage IV ovarian cancer compared with stage I and II ovarian cancer. Forced expression of TCF21 in OVCAR-5, OVCAR-8 and SKOV-3 cells decreased their invasive properties. These results are consistent with the function of TCF21 as a tumor suppressor by inhibiting invasion in ovarian cancers.
Two prior studies concluded that TCF21 is targeted by miR-21 and miR-224 [
38,
39]. In this study, we provide evidence that TCF21 is also modulated by miR-205. We identified an inverse relationship of increased miR-205 expression and decreased TCF21 expression in ovarian cancer tissue which was more prominent in the advanced stages of the disease. We further confirmed our hypothesis in three ovarian cancer cell lines: OVCAR-5, OVCAR-8 and SKOV-3. Increasing miR-205 in ovarian cancer cells caused a significant reduction in TCF21 activity as measured using a luciferase reporter construct containing the miR-205 target site. Real time qRT-PCR and Western blot analysis confirmed that miR-205 in ovarian cancer cells down-regulated TCF21 expression. This was further supported by the findings that decreased miR-205 expression with miR-205 inhibitor up-regulated TCF21 mRNA expression. In order to understand the impact of miR-205 on TCF21-induced inhibition of cell invasion, we co-transfected miR-205 mimic into ovarian cancer cells along with the TCF21 expression vector, and then measured invasion properties using Transwell invasion assay. We found that TCF21 alone inhibited the invasiveness of ovarian cancer cells. However, the transfection of miR-205 mimic into ovarian cancer cells diminished TCF21-mediated inhibition of cell invasion. Taken together, these findings indicate that miR-205 directly targets TCF21, and promotes cell invasion by repressing TCF21 expression in human ovarian epithelial carcinomas.
To better understand how the regulation of TCF21 by miR-205 affects invasion we investigated MMP expression. MMPs are expressed in nearly all tissue types and constitute a key group of proteinases for the regulation of cell-matrix composition. Their dysregulation is implicated in numerous pathological processes including embryogenesis, wound healing, inflammation, arthritis, cardiovascular diseases, and pulmonary diseases [
40,
41]. MMPs are increased in the advanced stages of several cancers, and may be related to tumor progression and metastasis [
42‐
44]. In women with ovarian cancer, elevated MMPs are an indication of tumor cell malignancy, and may be important for epithelial transformation and ovarian tumorigenesis [
44]. We determined that the expression of MMPs was significantly increased in ovarian cancer tissue compared with normal ovarian tissues. We found that TCF21 decreased MMP-2 and MMP-10 expression in OVCAR-5, OVCAR-8 and SKOV-3 cells, and decreased MMP-9 expression in SKOV-3 cells. Furthermore, co-transfection of TCF21 expression plasmid with miR-205 blocked the effects of TCF21 on MMPs. These findings suggest that TCF21 may decrease ovarian cancer cell invasion properties by inhibiting the expression of specific MMPs. miR-205 targets TCF21 and regulates TCF21 mediated MMP expression in ovarian cancer cell invasion.
Acknowledgements
We thank Prof. Dr. Qi Chen for providing the ovarian cancer cell line OVCAR-5 and OVCAR-8. We thank the KUMC Imaging Core Facility for In vitro Invasion Assay analysis. This work was supported by Obstetrics and Gynecology Department, Medical School of Kansas University.