Introduction
Esophageal squamous cell carcinoma (ESCC) is the second most common cancer in China [
1]. The recurrence rate of ESCC is extremely high after surgical treatment and the prognosis is usually poor [
2,
3]. Metastasis is a strong independent prognostic factor for ESCC [
4,
5]. Therefore, any insight into the mechanisms of ESCC metastasis may provide important clues for the development of clinical diagnostic methods and effective therapeutics [
6].
The enhancer of zeste homolog 2 (EZH2, also called histone lysine methyltransferase) is located at chromosome 7q35 and encodes a member of the Polycomb group proteins [
7], which regulate gene expression via epigenetic modification of chromatin structure including inducing histone acetylation and methylation [
7,
8]. Previous studies showed that EZH2 is overexpressed in a broad range of tumors [
9,
10]. Moreover, increased EZH2 expression could significantly promote tumor cell migration and invasion, and is strongly associated with tumor metastasis and poor clinical prognosis in a variety of human tumors such as breast, prostate, endometrial, gastric, colon, hepatocellular, bladder and oral cancers [
11‐
18]. In the case of human ESCC, He et al. [
19] and Tzao et al. [
20] independently reported that overexpression of EZH2 is associated with tumor metastasis and poor prognosis of the patients. However, the mechanism underlying EZH2 overexpression in ESCC remains unclear.
In recent years, accumulating data indicate that expression of EZH2 is regulated at the posttranscriptional level by a number of microRNAs (miRNAs). It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214 inhibit the expression of EZH2 in nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma, respectively [
21‐
26]. However, the role of miRNAs in the regulation of EZH2 expression in human ESCC has not been documented. Considering that the expression and function of miRNAs may vary in different types of tumors, here we set out to investigate whether these miRNAs (miR-26a, miR-98, miR-101, miR-124, miR-138 and miR214) regulate tumor metastasis via altering EZH2 expression in human ESCC. Through clinical investigation and cellular experiments using ESCC cell line, we demonstrate that decreased expression of miR-98 and miR-214 induce accumulation of EZH2 protein and might thereby promote the metastasis of human ESCC.
Discussion
EZH2 has been identified as a transcriptional repressor and is implicated in the aggressiveness and metastasis of many types of human cancers including ESCC [
19,
20]. In recent years, it was reported that some miRNAs could regulate EZH2 expression at the post-transcriptional level in several types of tumors [
21‐
26]. In the present study, we show that miR-98 and miR-214 expression in ESCC tissue are inversely correlated with the clinical features such as pathological grade, tumor stage and lymph node metastasis. In Eca109 cells, overexpressing miR-98 and miR-214 was found to significantly suppress cell migration and invasion through inhibition of EZH2 expression.
Previous studies showed that the expression of EZH2 is regulated at the transcriptional and posttranscriptional levels [
21‐
27]. Tang et al. [
27] reported that p53 could inhibit the transcription of EZH2 by binding to the promoter of EZH2 in prostate cancer. On the other hand, mounting evidence indicate that some miRNAs could effectively repress the expression of EZH2 in tumors such as breast, prostate, endometrial, gastric, colon, hepatocellular, bladder and oral cancers [
21‐
26]. In the present study, we detected EZH2 protein and mRNA expression in ESCC tumor tissues and matched normal tissues by western blot and qRT-PCR. It was found that the expression level of EZH2 protein was significantly higher in tumor tissues than in matched normal tissues, despite that
EZH2 mRNA expression was comparable between the two groups. These results suggest that EZH2 expression is upregulated in human ESCC mainly at the posttranscriptional level.
MiRNAs are evolutionarily conserved small noncoding RNAs (21–25 nucleotides) that regulate gene expression through modulation of translation efficiency or degradation of mRNAs [
28,
29]. It was reported that miR-26a, miR-98, miR-101, miR-124, miR-138 and miR-214 were involved in the regulation of EZH2 expression in some human tumors such as nasopharyngeal carcinoma, nasopharyngeal carcinoma, glioblastoma, hepatocellular carcinoma, head and neck squamous cell carcinoma, and neuroblastoma [
21‐
26]. In the present study, we compared the expression level of these miRNAs in ESCC tissues and matched normal tissues by qPCR. We found that expression levels of miR-98, miR-101 and miR-214 were significantly lower in tumor than in normal tissues. On the other hand, miR-138 expression was significantly higher in tumor than in normal tissues and miR-26a and miR-124 expression was comparable between the two types of tissues. Using luciferase assay and western blot, we further demonstrated that miR-98, miR-101 and miR-214 could target the 3’-URT of EZH2 and suppress EZH2 expression in ESCC cells. Combining these findings, we propose that miR-98, miR-101 and miR-214 regulate the accumulation of EZH2 protein in ESCC.
MiR-98 belongs to the mature let-7 family of miRNAs [
30] and was initially found to be down-regulated in leukemia cell lines [
31]. Subsequent studies showed that the expression of miR-98 were also significantly decreased in solid tumors such as nasopharyngeal carcinoma, head and neck squamous cell carcinoma [
22,
32]. Therefore, miR-98 is wildly regarded as a tumor suppressor gene. On the other hand, the expression and function of miR-214 appears to be cell type- and disease-specific. It was reported that miR-214 was down-regulated in breast and cervical cancer and acted as a tumor suppressor gene in these tumors since its overexpression inhibits cell proliferation and invasion [
26,
33]. By contrast, other studies showed that miR-214 was over-expressed in pancreatic and ovarian cancers and its overexpression promotes cell survival and chemotherapy resistance [
34,
35]. In the present study, we found that miR-98 and miR-214 expression were both inversely correlated with EZH2 protein expression in human ESCC, and that down-regulation of miR-98 and miR-214 expression was significantly correlated with pathological grading, tumor stage and lymph node metastasis. Moreover, overexpression of miR-98 or miR-214 could significantly inhibit ESCC cell migration and invasion, which was reversed by over-expressing EZH2. These findings suggest that miR-98 and miR-214 may play an important role in inhibiting the metastasis of ESCCs by targeting EZH2.
MiR-101 was reported to be down-regulated in human colon cancer, nasopharyngeal carcinoma, neuroblastoma and prostate cancer, and could repress the proliferation, invasion and metastasis of tumor cells [
22,
23,
36,
37]. In the present study, we found that miR-101 expression was down-regulated in primary ESCC tumor tissues and was significantly correlated with the tumor stage and lymph node metastasis. Although in Eca109 cells, over expression of miR-101 was found to suppress EZH2 expression, we did not detect significant correlation between the expression of miR-101 and EZH2 in clinical samples of ESSC tumor tissues and we found that miR-101-induced inhibition of Eca109 migration and invasion was not reversed by overexpressing EZH2. The discrepancies might be attributable to the regulation of EZH2 expression by multiple miRNAs, amongst which miR-101 only plays a minor role. Further studies are needed to test whether miR-101 might inhibit ESCC metastasis via an EZH2-independent signal pathway.
In summary, we have demonstrated that the expression of miR-98 and miR-214 was significantly lower in ESCC tissues than in matched normal tissues and that down-regulation of miR-98 and miR-214 was correlated with the up-regulated EZH2 protein expression, poor pathological grade, advanced tumor stage and lymph node metastasis in ESCC. In Eca109 cells, miR-98 and miR-214 overexpression significantly inhibited cell migration and invasion by repressing EZH2 protein expression. We propose that miR-98 and miR-214 are tumor suppressor genes in ESCC. It would be interesting to test whether these miRNAs act synergistically to regulate ESCC cell migration and invasion. Further experiments in animal models are warranted to establish the role of these miRNAs and EZH2 in regulating ESCC metastasis.
Material and method
ESCC specimens
A total of forty primary ESCC patients that underwent esophagectomy were enrolled in this study. Tumor specimens and paired normal esophageal tissue specimens taken from a site distant from the cancerous lesion were obtained from the consenting patients, as approved by the Medical Ethics Committee of Changhai Hospital. None of the patients received radiotherapy or chemotherapy before surgery. Clinical and pathological data including age, gender, pathological grading, tumor location, tumor stage and lymph node metastasis were acquired from the medical records.
Cell culture
Human ESCC cell line Eca109 was purchased from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). Cells were maintained in RPMI1640 (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen), 100 U/ml penicillin and 100 μg/ml streptomycin, within a humidified atmosphere containing 5% CO2 at 37°C.
Cell transfection
Cells were cultured to 1 × 106/ well in 6-well cell culture plate and were then transfected with 50 pmol of miRNA double-stranded mimics (or control miRNA) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol Transfection efficiency was optimized using 6-carboxyfluorescein-labeled microRNA at approximately 80% in Eca109 cells.
The sequences of miR-98 were:
Sense: 5′- UGAGGUAGUAAGUUGUAUUGUU −3′,
Anti-sense: 5′- AACAAUACAACUUACUACCUCA −3′,
The sequences of miR-101 were:
Sense: 5′- UACAGUACUGUGAUAACUGAA −3′,
Anti-sense: 5′- UUCAGUUAUCACAGUACUGUA −3′,
The sequences of miR-214 were:
Sense: 5′- ACAGCAGGCACAGACAGGCAGU −3′,
Anti-sense: 5′- ACUGCCUGUCUGUGCCUGCUGU −3′,
A scrambled microRNA with no homology to any known human microRNA was used as negative control:
Sense: 5′-GUUGAACUGUUAAGAACCACUGG-3′,
Anti-sense: 5′-CCAGUGGUUCUUAACAGUUCAAC-3′,
All microRNA mimics were synthesized by Genephama Biotech (Shanghai, China).
Quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Total RNA was extracted from 100 mg tissues or 1 × 105 cells using the RNeasy RNA Mini Kit (Qiagen). First strand cDNA was synthesized using POWERSCRIPT reverse transcriptase (Clontech). The following gene-specific primer pairs were used for quantitative PCR:
EZH2: Forward, 5′- TTACTTGTGGAGCCGCTGAC -3′;
Reverse, 5′- TCAGATGGTGCCAGCAATAG-3′.
GAPDH: Forward, 5′- GCTGAGTATGTCGTGGAGTC -3′;
Reverse, 5′- AGTTGGTGGTGCAGGATGC -3′.
PCR was performed using a Fast Start Master SYBR Green Kit (Roche) on a LightCycler (Roche). The expression level of target gene mRNA was analyzed using RealQuant software (Roche) and normalized to that of GAPDH mRNA.
Cell lysis and western blot
Cellular proteins were prepared using cell lysis buffer (50 mM Tris–HCl, pH 8.0, 1% NP-40, 2 mM EDTA, 10 mM NaCl, 2 mg/ml aprotinin, 5 mg/ml leupeptin, 2 mg/ml pepstatin, 1 mM DTT, 0.1% SDS and 1 mM phenylmethylsulfonyl fluoride). Equal amounts of protein (50 μg) were separated by 10% SDS PAGE and then transferred to nitrocellulose membranes (NY, USA) by electroblotting. The membranes were blocked with 5% BSA in TBST (10 mM Tris–HCl, pH 8.0, 150 mM NaCl, and 0.05% Tween 20) for 1 hr, and then incubated with mouse anti-human EZH2 antibody (Santa Cruz) overnight at 4°C before subsequent incubation with horseradish peroxidase-conjugated goat anti-mouse antibody (BD) for 1 hr at 37°C. Protein was visualized using enhanced chemiluminescence reagent (Santa Cruz). The expression level of EZH2 protein was analyzed using LabWork 4.0 program (UVP) and normalized to that of β-actin protein.
Luciferase reporter assay
The full-length 3′-UTR of EZH2 mRNA was amplified by PCR (Forward: 5′-CTAGTCATCTGCTACCTCCTCC-3′; Reverse: 5′-AGCTTACAAGTTCAAGTATTCTTTATTC-3′). Mutant EZH2 3′-UTR, which carried a substitution of four nucleotides (AGGU to UCCA for miR-98, UACU to AUGA for miR-101, and CAGC to GUCG for miR-214) within the core binding sites of EZH2 3′-UTR, was obtained using overlapping extension PCR. Normal (or mutant) EZH2 3′-UTR was cloned into the SacI-HindIII site of the pMIR-REPORT luciferase vector (Biosystems) and named as Luc-EZH2 (or Luc-EZH2-mut). Then, 1 × 106 cells were cotransfected with 50 pmol of miRNAs (or control miRNA), 1 μg of Luc-EZH2 (or matched Luc-EZH2-mut) plasmid, and 1 μg of pMIR-REPORT β-Gal vector using Lipofectamine 2000. The Luciferase activity was examined at 48 hr posttransfection using the luciferase assay kit (Clontech) and normalized to β-galactosidase activity.
Transwell assay
Cell migration and invasion were determined using a transwell (Costar) with a pore size of 0.8 μm. 1 × 103 cells were seeded in serum-free medium in the upper chamber (normal chamber for migration assay and matrigel-coated chamber for invasion assay). The lower chamber was filled with medium containing 10% FBS. After incubating for 8 hr at 37°C, cells in the upper chamber were carefully removed with a cotton swab and the cells that had traversed to reverse face of the membrane were fixed in methanol, stained with Giemsa, and counted.
Statistical analysis
Statistical significance was tested using SPSS15.0 software. For comparison of clinical features (except for pathological grading) between high and low miRNA expression groups, chi-square test was performed. The correlation between the expression of miRNA and pathological grade was analyzed by Cochran-Mantel-Haenszel Statistics. The correlation between the expression of miRNA and EZH2 was analyzed using Pearson’s correlation analysis. Other data are presented as mean ± SEM, using student t tests for 2-group comparison. A P value less than 0.05 is considered as statistically significant.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
SDH and ZYZ designed research and analyzed data. YY, HZC, BLL, DJG, CWZ and SGW carried out molecular biology studies. YY and HZC wrote the paper. All authors read and approved the final manuscript.