Background
MicroRNAs (miRNAs) are endogenous non-coding small RNAs that execute post-transcriptional regulation by binding to the 3’-UTR of target genes [
1‐
4], function as either oncogenes or tumor suppressor genes [
5]. During recent years, more and more studies have reported a functional contribution of specific miRNAs in diverse biological processes [
6‐
8], including deregulation of miRNAs by acting on their targeted genes in the progression and tumorgenesis of human cancers [
5,
9,
10].
Ovarian cancer, one of the most common causes of death in women worldwide, is still a major problem in China over the past few decades [
11‐
13] with high mortality, which is mainly due to the fact that more than 70% of patients are in late-stage, with distant metastases at the time of diagnosis [
2,
9]. It is reported that ovarian cancer is associated with multistep changes in the genome, in particular the expression and function of various microRNAs [
9,
14]. Although a large number of studies have shown a great potential for the use of microRNA in diagnosis, prognosis, and therapy in ovarian cancer [
15,
16], the precise association between microRNAs and migration and invasion of ovarian cancer is still relatively unclear.
MiRNAs are differentially expressed in ovarian cancer [
2,
10], including miR-124 [
2]. MiR-124 was first reported to be highly expressed in neuronal cells [
17], but its tumor-suppressor activity was significantly down-regulated in various cancer tissues [
8,
18‐
21]. Also, It has been reported that miR-124 involves in several malignant processes, including tumor proliferation, Epithelial-mesenchymal transition (EMT), and angiogenesis [
6,
19‐
23]. However, the expression level and the possible role of miR-124 in ovarian cancer remain to be explored.
SphK1 (Sphingosine kinase 1), a master kinase that regulates the balance between ceramide/sphingosine and S1P levels, mediates cellular behaviors and may determine cancer progression, including proliferation, migration, and invasion [
24,
25]. It has been demonstrated that SphK1 is an important enzyme encoded during neoplastic transformation [
25,
26]. In addition, SphK1 plays a critical role in motility and invasion of some cancer cells [
27‐
29]. However, it is unclear whether SphK1 is responsible for malignant transformation of ovarian cancer.
We aimed to elucidate the involvement of miR-124 and SphK1 in migration and invasion of ovarian cancer. Our studies indicated that miR-124 was down-regulated in ovarian cancer cell lines and clinical samples. Interestingly, there is a significant correlation between the expression level of miR-124 and metastasis of ovarian cancer. On the other hand, our data showed that overexpression of miR-124 in ovarian cancer cells suppressed cell motility via SphK1, suggesting that SphK1 was identified as a direct and functional target for miR-124 in ovarian cancer progression. Thus, our findings provide valuable information toward unveiling the mechanisms of human ovarian cancer metastasis, and a novel target of potentially effective clinical therapies in the future.
Methods
Patients and ethics
Eleven malignant ovarian tumor tissues and normal ovarian tissues (as listed in Table
1) were selected from the archives of
the Department of Obstetrics & Gynecology at Ren Ji Hospital, Shanghai JiaoTong University School of Medicine (Shanghai, China). This study was approved by
the Institutional Review Board of Ren Ji Hospital, Shanghai JiaoTong University School of Medicine; and written informed consent was obtained from all patients. All clinical investigations were conducted according to the principles expressed in the Declaration of Helsinki.
Table 1
Clinical characteristics of women with ovarian cancer
1 | 51 | 3 | T1cN0M0 | Ic | + | No | Mucinous papillary adenocarcinoma | — |
2 | 45 | - | T1N1M0 | IIIc | - | No | poorly differentiated carcinoma | Right |
3 | 34 | 1 | T1bN0M0 | Ib | - | No | Mucinous cystadenocarcinoma | Right |
4 | 62 | 2 | T2N0M0 | II | + | Yes | Adenocarcinoma | Left |
5 | 60 | 3 | T1aN0M1 | IV | - | Yes | Serous papillary adenocarcinoma | Right |
6 | 39 | 1 | T1bN0M0 | Ib | - | No | Mucinous cyst adenocarcinoma | Left |
7 | 57 | 3 | T1cN0M0 | Ic | - | Yes | Serous adenocarcinoma | — |
8 | 49 | 3 | T2aN0M1 | IV | + | Yes | Serous adenocarcinoma | Left |
9 | 43 | - | T2aN0M1 | IV | + | No | poorly differentiated carcinoma | Right |
10 | 73 | - | T3cN1M1 | IV | + | Yes | poorly differentiated carcinoma | Right |
11 | 50 | 2 | T3N1M0 | IIIc | - | No | Serous adenocarcinoma | Left |
12 | 47 | - | - | - | - | - | - | Right |
13 | 55 | - | - | - | - | - | - | Right |
Cell lines and cell culture
Human ovarian SKOV3, HO8910pm cell lines with high-metastasis potential [
30], HO8910, ES-2 and A2780 were obtained from Shanghai Institute of Cell Biology, China Academy of Sciences (Shanghai, China). OVCAR3 and OV90 were obtained from ATCC. SKOV3-ip1 and SKOV3-ip2 cells were selected from SKOV3 cell. All cells were cultured in RPMI-1640 medium supplemented with 10% fetal calf serum (GIBCO) in a humidified atmosphere of 5% CO
2 at 37°C [
31].
Selection of invasive sublines from SKOV3 cell
To select a highly invasive subpopulation, SKOV3 cells were seeded in a corning 8 μm-pore transwell with Matrigel (BD Biosciences). After 24 hours, cells that had invaded to the other side of the transwell membrane were collected, expanded and then re-seeded into another Matrigel coated transwell. Such selection rounds for highly invasive cells were repeated two times.
Quantitative PCR and immunoblotting
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Single-stranded cDNA was synthesized with the PrimeScript Reagent Kit (Promega, Madison, WI, USA). Real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) on an ABI 7300HT real-time PCR system (Applied Biosystems, Foster City, CA, USA). Expression data were normalized to the internal control (U6) and the relative expression levels were evaluated using the Ct method. Primers for RT–PCR are listed in Table
2. For the protein expression analyses, standard Western blotting was carried out and the antibodies used were SphK1 (H00008877-M01, Abnova, Taiwan) and β-Actin (CP01, Calbiochem, MA, USA).
Table 2
Primers used for constructs and detection of the expression of miR-124.
Sphk1-UTR-F | ACGCTCGAGGAATTGATGGTTAGCGAGGCC | 64.5 | 1155 |
Sphk1-UTR-R | AGGGCGGCCGCTTATTTGGATTTGGTTCGTGGG | 65 |
Sphk1-UTR-Mut-site-F | GACCCCTGGGCCGCGCTGTCCGTAAGTGTCTACTTGCAGGACC | 85 | 6658 |
Sphk1-UTR-Mut-site-R | GGTCCTGCAAGTAGACACTTACGGACAGCGCGGCCCAGGGGTC | 84 |
U6-F | CGCTTCGGCAGCACATATAC | 59.4 | 64 |
U6-R | CAGGGGCCATGCTAATCTT | 57.5 |
MiR-124-F | GATACTCATAAGGCACGCGG | 60.6 | 60 |
MiR-124-R | GTGCAGGGTCCGAGGT | 57.9 |
MiR-124-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATTCT | 87.8 | |
Transfection of miR-124 or siRNA against SphK1
MiR-124 and the negative control were synthesized by Genepharma (Shanghai, China). Three siRNA duplex oligonucleotides fragments against SphK1 gene were synthesized by Ribobio (Guangzhou, China). Oligonucleotides were transfected with Lipofectamine 2000 reagent (Invitrogen, Paisley, Scotland, UK) at a concentration of 100 nM. For proliferation assays, cells were trypsinized 24 h after transfection. For migration, invasion, and western blot assays, cells were collected 48 h after transfection, as described previously.
Monolayer wounding assay
For monolayer wounding assays, cells were plated in BD Falcon 24-well tissue culture plates after transfection and allowed to attach overnight. After serum deprivation for 12 h, confluent monolayers were scratched using a 10-μl pipette tip and washed once with serum-free medium. Twenty-four hours later, migration was assessed microscopically, and quantified using Multi Gauge V3.0 software (Fujifilm, Tokyo, Japan).
In vitro cell migration and invasion assays
Cell migration was determined in Corning transwell insert chambers as described previously [
31]. Cells suspended in 200-μl serum-free 1640 medium were placed into the upper chamber of the insert with or without Matrigel. After 24 h of incubation, cells remaining on the upper membrane were carefully removed. Cells that had migrated through the membrane were fixed with methanol and stained with 0.1% crystal violet (Biotime, China), imaged and counted using an IX71 inverted microscope (Olympus, Tokyo, Japan).
Luciferase assays
HO8910pm and SKOV3-ip cells were plated into 24-well plates until 70% confluence before transfection. 100 ng wild-type or mutant SphK1 3’-UTR psiCHECK-2 plasmid (Promega, Madison, WI) was transiently co-transfected with 60 pmol miR-124 mimics or NC into HO8910pm and SKOV3-ip cells. Cell lysates were harvested 24 h after transfection and then firefly and Renilla luciferase activities were measured by the Dual-Luciferase Reporter Assay System (Promega, Madison, WI) on a Berthold AutoLumat LB9507 rack luminometer. Renilla luciferase activities were normalized to firefly luciferase activities to control for transfection efficiency.
Statistical analysis
Data were expressed as the mean ± SD of at least three independent experiments. Group differences were compared using one-way ANOVA or two-tailed Student’s T-test from SPSS version 19.0 software (SPSS, Chicago, IL, USA). p value <0.05 was considered to be statistically significant.
Discussion
In the present study, we found that miR-124 was down-regulated in ovarian cancer cell lines and tumor tissues compared with normal ovarian surface epithelial cells and normal ovarian tissues. Furthermore, we showed that miR-124 inhibited EOC cell migration and invasion, which may be involved in the development of ovarian cancer metastasis. We also demonstrated that SphK1 is a direct target of miR-124 in EOC. Therefore, we now reasonably speculate that low expression of miR-124 contributes to SphK1-mediated migration in EOC cells.
Increasing evidence suggests to us that miRNAs are frequently dysregulated in various cancers, including ovarian cancer [
3,
5]. In this study, we observed that the expression level of miR-124 was low in ovarian cancer tissues, and even lower in the metastatic ovarian tissues. The abnormal expression of miRNAs in ovarian cancer has been previously evaluated [
6,
14,
32]. In agreement with our results, Iorio et al. [
2] have demonstrated that miR-124a is down-regulated in ovarian cancer tissues compared with normal ovarian samples. However, the role of miR-124 in ovarian cancer has not been reported in ovarian cancer [
14,
33]. Additionally, the directionality of expression of miR-124 (down-regulated) and SphK1 (up-regulated) that we observed appeared to be definitive in the two high-metastasis potential ovarian cancer cell lines, SKOV3-ip and HO8910pm. Also, clinical ovarian cancer samples were used to confirm the relationship between the endogenous expression levels of SphK1 and miR-124. In essence, this provided the possibility that the loss of miR-124 may lead to SphK1-mediated migration and invasion in ovarian cancer.
Invasion and metastasis are two leading attributes of malignant cancer [
34] that result in high mortality in EOC. Our findings emphasize that the miRNA-induced down-regulation of genes may lead to the inhibition of migration and invasion of ovarian cancer cells, in agreement with several previous reports [
20,
21,
35]. Although it has been reported that miR-124 is functionally involved in gynecological cancer [
36], to the best of our knowledge, there are no published data on the role of miR-124 regarding migration and invasion in EOC. In this context, our study indicates that miR-124, by targeting SphK1, inhibits migration and invasion of ovarian cancer cells, suggesting that miR-124 plays a key role as a tumor suppressor in the motility of ovarian cancer cells; and that reduced expression of SphK1 contributes to distant metastases in EOC.
It is important to note that one microRNA can exert different functions by targeting multiple mRNAs[
37]; that is, other genes regulated by miR-124 may also lead to ovarian carcinogenesis. Overexpression of miR-124 inhibits aggressiveness of hepatocellular carcinoma cell by targeting ROCK2 and EZH2[
21]. Additionally, Fowler et al. reported that IQGAP1, laminin c1 and integrin b1 (which are not the only 3 targets of miR-124) are also associated with migration and invasion in clinical glioblastoma specimens, compared with normal brain tissue [
38]. In addition, We confirmed through luciferase reporter gene assays that miR-124 directly targets SphK1 by binding the 3’-UTR of SphK1 mRNA, which is consistent with Xia et al. [
23]. MiR-124 blocks migration and invasion of ovarian cancer cells by targeting SphK1, which would constitute a promising target for rational cancer therapy. Also, our results provided another mechanism for modulating the protein expression of SphK1 in ovarian cancer cells. Thus, it is possible that miR-124 could attenuate EOC invasion partly through inhibition of the SphK1pathway.
Conclusions
In conclusion, our current study provides novel evidence that ectopic expression of miR-124 significantly suppresses migration and invasion of ovarian cancer cells and down-regulates SphK1, which is a direct functional target of miR-124. The loss of miR-124 may then contribute to the migration and invasion of EOC cells. The newly identified miR-124/SphK1 link provides novel insight into the metastasis of EOC, especially with respect to invasion and metastasis in vitro; and represents a new potential therapeutic target for the treatment of EOC.
Competing interests
The authors declare no competing interests.
Authors’ contributions
HZ and QW performed the experiments, prepared the data and drafted the manuscript. QZ and WD are co-mentors, provided input of studies and edited the manuscript. All authors read and approved the final manuscript.