Introduction
Japanese encephalitis virus (JEV) is a mosquito-borne neurotropic virus which belongs to the family flaviviridae. JEV is mostly prevalent in South and Southeast Asia. JEV leads to death of 25% of infected patients whereas 50% of survivors suffer from neuronal damage, loss of memory, and cognitive dysfunction [
1]. JEV causes encephalitis and death in patients. A comparative study between the different parts of the brain depicted that JEV has more affinity to the midbrain and thalamus [
2]. JEV maintains a zoonotic life cycle where pigs are major reservoir hosts and mosquitoes act as vectors [
3]. JEV infects macrophages and PBMCs [
4] and infected macrophages help the virus to cross blood brain barrier [
5]. However JEV also persists latently in T-lymphocytes [
6] and PBMCs [
7]. JEV has been also reported to suppress dendritic cell maturation and causes expansion of Treg cells [
8]. Hence, JEV evades the cellular innate response which facilitates its survival in the host. JEV infects microglial cells and causes microglial activation which leads to neuronal damage due to inflammation [
9]. Microglial cells are resident macrophages in the brain which harbor JEV. A study on mouse microglial cells demonstrated persistence of JEV in microglial cells and suggested that these cells may serve as reservoirs for virus [
10].
MicroRNAs are the small regulatory RNAs which are 19 to 24 nucleotides in length and are reported to regulate the expression of around 60% of human genes [
11]. MicroRNAs (miRNAs) lead to regulation of gene expression by binding to complementary sites present in 3′UTR of target gene via their seed region [
12,
13]. Viruses modulate the expression of cellular microRNAs [
14] which may help the virus to augment its replication [
15] or in evasion of cellular immune response [
16]. Recently, the expression of miR-29b [
17] and miR-155 [
18] has been reported to be modulated upon JEV infection. Viruses like DENV, CHIKV and VSV have been reported to overexpress miR-146a which helps the virus to shut down inflammatory responses of cell [
19,
20,
21]. miR-146a is a well-known anti-inflammatory microRNA which targets TNF receptor-associated factor 6 (TRAF6) and IL-1 receptor associated kinase-1 (IRAK1) and IRAK 2 genes [
20]. These genes encode for various adaptor proteins involved in NF-κB activation. miR-146a has been also reported to target STAT1 gene which acts as a transcription factor for expression of interferon-stimulated genes [
22]. miR-146a is induced by NF-κB activation, where induction of miR-146a targets genes involved in NF-κB activation and forms a regulatory negative feedback loop in monocytes [
23]. miR-146a was found to be overexpressed in Tregs and its deficiency led to disruption of immunological tolerance in mice [
24]. miR-146a overexpression leads to suppression of cellular inflammatory response and decrease in cytokine secretion [
25,
26].
In our study, we found that JEV-induced miR-146a upregulation led to the downregulation of TRAF6 and IRAK1 and IRAK2 genes and suppression of NF-κB activation along with decreased expression of pro-inflammatory cytokines. The initial activation of NF-κB by virus resulted in increased expression of miR-146a, which targeted the adapter molecules involved in NF-κB activation through a negative feedback loop. JEV-mediated miR-146a upregulation downregulated the STAT1 expression and abrogated the Jak-STAT pathway, which led to the decreased expression of interferon-stimulated genes (ISGs). This observation suggested the exploitation of cellular miR-146a by JEV to suppress cellular inflammatory responses in order to create favorable cellular environment for their survival.
Materials and methods
Cell culture
Human microglial cell line CHME3 was obtained as a gift from Dr. Anirban Basu (National Brain Research Centre, Manesar, Haryana). CHME3 cells were grown in Complete Dulbecco Modified Eagle Medium (DMEM) (#12100-046, Gibco, Rockville, MD, USA) with 10% heat-inactivated fetal bovine serum (16000–044; Gibco BRL) and 100 U penicillin and 100 μg/ml streptomycin (#10378016; Gibco-BRL). Porcine stable kidney cells (PS cells) for JEV Plaque Assay and C6/36 cells for JEV propagation were also cultured in Complete Dulbecco Modified Eagle Medium.
JEV propagation and infection
JEV strains (JaOArS982 and P20778 Vellore strain) were given as a gift by Dr. Anirban Basu, NBRC which was further propagated in mosquito cell line C6/36 (Aedes albopictus). The 2 × 105 cells were seeded in 75-cm2 flask and infected with JEV at MOI 0.1 in incomplete DMEM (without FBS and antibiotic) medium. The incomplete DMEM media was replaced by complete DMEM media 3 h post infection, and cells were incubated for 8 days in humidified 5% CO2 incubator at 28°C. The supernatant was collected, and the virus was precipitated using PEG virus precipitation kit (#ab102538; Abcam, Cambridge, MA, USA). Virus titer was determined by using plaque assay. For plaque assay, 2 × 105 PS cells were seeded in six-well plates and different dilutions of virus (10−3 to 10−9) were used for infection. Three hours post infection, cells were washed with PBS and agarose overlay medium (2X incomplete DMEM, 5% FBS, 2% low melting agarose, and 1% penicillin-streptomycin) was added on cells and kept at 37°C incubator for 72 h. Later, the cells were fixed by 10% formaldehyde and the overlay was removed. The cells were stained with crystal violet stain, and plaques were counted to determine the virus titer. For infection experiments, 5 × 105 CHME3 cells were seeded in 25 cm2 flask and infected by JEV at MOI 5 in incomplete DMEM. Three hours post infection, the media was replaced by complete DMEM and cells were harvested at 24 h post infection.
miR-146a overexpression
CHME3 cells were seeded in six-well dishes, and 100 pmol of miR-146a seed sequence mimic (Bioserve, Hyderabad, India) was transfected by using Lipofectamine 2000 (#11668-019; Invitrogen, Carlsbad, CA, USA) according to manufacturer’s protocol. Scrambled seed sequence of miR-146a and mock Lipofectamine treatment were used as control. The sequence of miR-146a oligo and scramble has been mentioned in Table
1. The overexpression of miR-146a was confirmed by real-time PCR using TaqMan probe. The cells were harvested after 48 h post transfection for RNA isolation and Western blotting.
Table 1
Sequence of RNA oligos used
miR-146a mimic | UGAGAACUGAAUUCCAUGGGUU |
Scramble | GGAUGUAUGCUGCUGCUAAUAA |
Anti-miR-146a (miR inhibitor) overexpression
CHME3 cells were transfected with 100 pmol of anti-miR-146a (#AM 10722, Ambion) along with 100 pmol Cy3-labeled scrambled anti-miR (#AM17011; Ambion) as negative control by using Lipofectamine transfection reagent. Cy3-labeled control enables to determine transfection efficiency into cells. Knockdown of miR-146a was confirmed by real-time PCR using Taqman probe. Cells were harvested 48 h post transfection.
RNA isolation and real-time PCR
Qiagen miRNeasy kit (#217004; Qiagen, Venlo, Netherlands) was used for miRNA isolation from harvested cells. Complementary DNA (cDNA) synthesis was done by using multiscribe TaqMan reverse transcriptase (#4366596; Applied Biosystems, Waltham, MA, USA) with miR-146a specific primers. Real-time analysis of miR-146a level was done by real-time PCR (ABI VII A7 RT-PCR) by using miR-146a-specific TaqMan probe and universal PCR master mix (#4324018; Applied Biosystems). The expression of miR-146a was normalized by endogenous control RNU24 expression.
For estimation of IL-6, IFIT-1, and IFIT-2 transcript levels and viral RNA, total RNA was extracted by using RNeasy mini kit (Qiagen, Cat No. 74106) according to manufacturer’s protocol. Quantification of RNA was done, and cDNA was prepared by using superscript II (Invitrogen, Cat No. 11904-018) according to manufacturer’s protocol. List of primers used in this study is given in Table
2.
Table 2
List of primers used for real-time PCR
IL-6 | Forward: 5′ ACTCACCTCTTCAGAACGAATTG 3′ |
Reverse: 5′CCATCTTTGGAAGGTTCAGGTTG 3′ |
TNF-α | Forward: 5′ CCTCTCTAATCAGCCCTCTG 3′ |
Reverse: 5′GAGGACCTGGGAGTAGATGAG 3′ |
JEV NS3 | Forward: 5′ AGAGCGGGGAAAAAGGTCAT 3′ |
Reverse: 5′ TTTCACGCTCTTTCTACAGT 3′ |
GAPDH | Forward: 5′ ATGGGGGAAGGTGAAGGTCG 3′ |
Reverse: 5′ GGGGTCATTGATGGCAACAATA 3′ |
IFIT-1 | Forward: 5′ AGAAGCAGGCAATCACAGAAAA 3′ |
Reverse: 5′ CTGAAACCGACCATAGTGGAAAT 3′ |
IFIT-2 | Forward: 5′ CACATGGGCCGACTCTCAG 3′ |
Reverse: 5′ CCACACTTTAACCGTGTCCAC 3′ |
Western blotting
The harvested cell pellet was lysed in RIPA buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) with 1 μM PMSF and 1X proteCEASE-50 (#427P; G-Biosciences, St. Louis, MO, USA). The lysate was sonicated, and protein was quantified by bicinchoninic acid (BCA) assay. Equal amount of protein was loaded into each well, resolved on 12% SDS-PAGE gel, and transferred on PVDF membrane. Five percent skimmed milk in 1X TBS-Tween 20 was used for blocking the membrane. The membranes were then incubated in primary antibody (1:1,000) overnight followed by three washes with TBST each for 15 min. Later, the membrane was incubated in HRP-conjugated secondary antibody for 1 h and then washed thrice with 1X TBST (15 min each) and developed by using super-signal developing reagent as HRP substrate. Primary antibodies against TRAF6 (#8028; Cell Signaling Technology, Danver, MA, USA), anti-IRAK1 (#4504; Cell Signaling Technology), anti-IRAK2 (#4367; Cell Signaling Technology), anti-phospho-NFKB p65 (#3037; Cell Signaling Technology), anti-NFKB p65 (#4764; Cell Signaling Technology), anti-STAT1 (#9172 Cell Signaling Technology), anti-phospho-STAT1 (#8826 Cell Signaling Technology), anti-JEV NS1 (#ab41651; Abcam) and anti-β-tubulin (#ab6046; Abcam) antibodies were diluted in 5% BSA in TBST buffer. Goat-raised HRP-conjugated anti-rabbit secondary antibody (ab6721-1; Abcam) was used in 1:50,000 dilution.
Luciferase assays
CHME3 cells were seeded in six-well dishes and were transfected with NF-κB luciferase reporter plasmid (1 μg) along with β-galactosidase (700 ng) vector by using Lipofectamine 2000. For miR-146a overexpression and anti-miR experiments, 100 pmol of scrambled miR and miR-146a and 100 pmol of Cy3-labeled scrambled anti-miR and anti-miR-146a were co-transfected along with plasmids, and luciferase activity was measured 48 h post transfection. For infection, cells were counted 24 h post transfection and infected with JEV (MOI 5). Cells were incubated for 24 h after infection and were lysed to measure luciferase activity. ISRE and IFN-β luciferase assay was also done in similar manner. Luciferase activity was measured 24 h post infection. For measuring the luminescence activity, cells were lysed in 1X lysis buffer provided by Luciferase Assay kit (#E4030; Promega, Madison, WI, USA) and luminescence was measured by adding luciferase assay reagent as per manufacturer’s protocol. Luciferase activity was measured in Perkin Elmer multiplate reader (Enspire 2300 Multimode plate reader). The luciferase activity was normalized by β-galactosidase activity. β-galactosidase activity was measured by using β-Galactosidase kit (#E2000; Promega, Madison, WI, USA) as per manufacturer’s protocol.
ELISA of TNF-α
CHME3 cells were seeded into six-well plate, and 100 pmol of miR-146a was transfected by using Lipofectamine 2000. Scramble sequence was used as control. Twenty four hours post transfection, JEV infection was given, the supernatant was collected after 24 h, and ELISA was performed to determine secreted TNF-α level by using human TNF-α ELISA kit (#-KHC3011, Invitrogen) according to manufacturer’s protocol. For anti-miR experiments, 100 pmol of anti-miR-146a was transfected along with Cy3-labeled negative control prior to JEV infection.
Statistical analysis
All experiments were done in triplicates, and comparison was made between all data sets by a one-tailed, unpaired Student’s t-test or one-way ANOVA. Data was considered significant when P < 0.05. * denotes P < 0.05, ** denotes P < 0.005, and *** denotes P < 0.001.
Discussion
JEV infection leads to neuroinflammation in JEV-infected patients, which leads to high morbidity and mortality. However, the survivors still show neurological and cognitive impairments [
31]. JEV has been reported to evade the innate response of host and establish pathogenesis [
32]. Recently, Hayasaka
et al. reported that JEV JaOArS982 strain infection formed two different disease severity groups in mice, one of which succumbed mild infection with lower levels of TNF-α and IL-10 [
33]. They got different results by using different JEV strains. They reported lower titer of JaOArS982 strain in the brain of infected mice, compared to the higher titer of other infective JEV strains, which elicited lower cytokine secretion in mice brain. This data is in support of our findings as our results are also strain specific, and we got decreased levels of miR-146a, in cells infected by JEV (P20778). This suggests that JEV JaOArS982 strain successfully shuts down the cellular inflammatory response to facilitate its survival. Interferon-induced Jak-STAT pathway activates anti-viral machinery of cells, which modulates cellular inflammatory response [
34]. Viruses are known to target STAT1 to escape the IFN-induced anti-viral immune response. Simian [
35] and mumps virus [
36,
37] abrogate Jak-STAT signaling by targeting STAT1. JEV has also been reported to abrogate the Jak-STAT pathway by blocking STAT1 phosphorylation and neutralizing IFN-α-induced anti-viral response [
38]. Viruses modulate the cellular microRNA expression for their benefit [
14]. miR-122 [
39] has been reported to facilitate HCV replication. Vesicular stomatitis, dengue, and Chikungunya virus upregulate miR-146a to suppress cellular inflammatory response [
19,
20,
21]. Enterovirus has been reported to induce miR-141 expression to suppress host translational machinery [
40]. JEV has been reported to upregulate miR-29b to suppress the microglial activation [
17] and miR-155 to suppress JEV-induced inflammatory response [
18]. In this study, we deciphered the role of microRNA-146a in modulating innate immune response and JEV pathogenesis in human microglial cells.
We report the JEV-mediated increased expression of miR-146a in CHME3 cells. Our results are contradictory to findings of Pareek
et al. who found downregulated miR-146a levels upon JEV infection [
27]. This discrepancy may be due to different strains of virus used by Pareek
et al. To confirm this strain-specific effect of JEV, we determined miR-146a levels in P20778 strain used by Pareek
et al. and found similar results to their findings. This suggested that increased expression of miR-146a is strain specific. JEV infection downregulated the adaptor molecules TRAF6, IRAK1, and IRAK2 involved in NF-κB activation, which are targeted by miR-146a. To describe the specific role of miR-146a in targeting of these adaptor molecules, miR-146a was silenced and we found that anti-miR-146a rescued TRAF6, IRAK1, and IRAK2 from downregulation upon JEV infection. To further unveil the downstream effects on NF-κB activity, NF-κB promoter luciferase assay and Western blot analysis were performed. We found reduced luciferase activity at 24 h post JEV infection and reduced phosphorylation of NF-κB p65 subunit upon JEV infection. To confirm the presence of negative feedback loop, we checked the NF-κB luciferase activity at early time points (6 and 12 h) and found initial upregulation in luciferase activity followed by a decrease in luciferase activity at later hours. Initial NF-κB activation by JEV preludes the miR-146a overexpression, which further led to the downregulation of adaptor proteins involved in NF-κB activation and constitute a negative regulatory loop [
41]. Hence, we conclude that JEV-mediated upregulation of miR-146a takes place to downregulate NF-κB activation.
miR-146a overexpression suppressed NF-κB activation as demonstrated by luciferase assay, and inhibition of miR-146a enhanced NF-κB activation upon JEV infection. Recently, Jin Ho Paik
et al. also reported similar results upon miR-146a overexpression [
42]. Our findings demonstrated that miR-146a creates an anti-inflammatory environment in cells. NF-κB subunits act as transcription factor for expression of pro-inflammatory cytokines. miR-146a overexpression also suppressed JEV-induced cytokine production (IL-6, TNF-α, IFN-β). The replication of JEV is increased upon miR-146a overexpression due to an anti-inflammatory environment created by overexpression of miR-146a. However, this enhanced replication of viral RNA was observed only at 24 h post infection and this effect reduced at later time points. To rule out the possibility that this reduced effect on viral replication could be due to degradation of overexpressed miR-146a at later hours, we checked the levels of miR-146a at later hours by RT-PCR and found that the level of miR-146a was retained in CHME3 cells (data not shown). We also found elevated levels of viral NS1 protein in miR-146a overexpressing cells. This may be due to greater accumulation of viral proteins in miR-146a overexpressing cells. Recently, Bing-Ching Ho
et al. also reported that miR-146a supports the survival of
Enterovirus in mice and silencing of miR-146a improved the survival of
Enterovirus-infected mouse due to restoration of interferon production [
43]. This suggested that the cellular anti-viral machinery got compromised in miR-146a overexpressing cells and supported viral replication. However, a recent study by Kundu
et al. reported increased levels of SOCS1 and SOCS3 during early time points of infection which promoted JEV replication at early time points, but the viral titer got decreased due to the decrease in levels of SOCS1 and SOCS3 during later time points, which led to the activated cellular immune response [
30]. We also found a decrease in viral mRNA levels at later time points. This decrease in viral titer in later time points may help the virus to persist latently in cells. Expression of a truncated form of viral NS1 protein and production of low virus titer in persistently JEV-infected murine neuroblastoma cells as an aftermath of virus-cell interaction [
44] also depict that restriction of viral replication can assist viral persistence. Decrease in viral titer at later time points may be due to the activation of cellular immune machinery which nullified the effect of miR-146a overexpression.
miR-146a targets STAT1 gene which leads to abrogation of Jak-STAT pathway [
45]. We also found similar results, where miR-146a overexpression reduced the STAT1 levels and inhibition of miR-146a upregulated the STAT1 levels. We also analyzed the effect of miR-146a overexpression on Jak-STAT pathway. Suppression of ISRE promoter activity and downregulated expression of interferon-stimulated genes (ISGs) were found in miR-146a overexpressing cells upon JEV infection. Interferon-induced protein with tetratricopeptide repeat (IFIT) proteins are well-known interferon-induced anti-viral proteins, having anti-proliferative effects [
46]. IFIT-1 has been reported to restrict JEV replication [
47]. IFIT-2 has been also reported to restrict VSV replication [
48]. miR-146a downregulated the JEV induced expression of IFIT-1 and IFIT-2. Downregulation of IFIT levels perturb the cellular anti-viral machinery, which helps in JEV replication in host cells. Tang
et al. has reported downregulation of other ISGs (OAS1, Mx1, LY6E) upon miR-146a overexpression [
22]. These findings indicated that miR-146a abrogated the Jak-STAT pathway and downregulated the expression of ISGs, which led to the suppression of innate immune response against the virus and augmented the viral replication in miR-146a overexpressing cells.
We also analyzed the effect of JEV infection on STAT1 activation at different time points. JEV induced the STAT1 activation at early time points but downregulated the STAT1 levels at later time points due to targeting of the STAT1 by miR-146a. Inhibition of miR-146a led to the increased STAT1 levels upon JEV infection. The ISRE promoter activity and expression of IFIT-1 and IFIT-2 also displayed similar trends. We observed initial upregulation of ISRE promoter activity and levels of IFIT1 and IFIT2 upon JEV infection, which supported the activation of cellular innate immune machinery against the virus. At 24-h time point, we found decreased levels of IFIT1 and IFIT2 and reduced ISRE promoter activity which indicated that the virus has successfully suppressed the cellular inflammatory response. We observed the decreased expression of IL-6 and TNF-α at 24 h as compared to 12 h post JEV infection. These findings suggest that JEV-mediated miR-146a upregulation led to the suppression of NF-κB activation and STAT1 degradation, caused the downregulation of ISGs at later time point (24 h). Downregulation of ISGs has been reported to facilitate persistence of virus in cells [
49]. This is a strategy embraced by JEV to suppress the cellular inflammatory response in human microglial cells and evade innate immune response. However; this effect is time dependent and other strategies adopted by the cell to combat viral replication could play an important role. The host cell triggers various anti-viral signaling pathways to curtail viral replication. Further studies are required to find out other anti-viral strategies adopted by JEV to evade cellular immune response. This study demonstrated strain-specific effects of JEV, as different JEV strains may lead to the varying downstream effects in host cellular immune responses. Understanding the regulatory role of cellular microRNAs during JEV infection in microglial cells would be helpful in understanding the molecular mechanism of JEV neuropathogenesis.
Acknowledgements
The authors are thankful to Prof. Adolfo Gracia-Sastre, Department of Medicine and Microbiology, Mount Sinai School of Medicine, New York, NY, USA, for providing NF-κB and IFN-β luciferase vector as a kind gift. Authors are thankful to Ms. Ritu Mishra for her suggestions during experiments and manuscript preparation. Authors are thankful to the director, Centre for Cellular and Molecular Biology (CCMB), Hyderabad, for his support. Nikhil Sharma is a recipient of CSIR-Senior Research Fellowship. Authors highly acknowledge the financial support from the DST grant number (INT/Korea/P-08/2011) of the Department of Science and Technology, and grant on RNAi Science and Technology of the Department of Biotechnology, Govt. of India; New Delhi respectively.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
NS is currently working as a CSIR-Senior Research Fellow and pursuing his Ph.D program. NS designed and carried out most of the experiments and wrote the manuscript. RV performed some initial experiments to establish the proof of the concept. KLK propagated JEV in mice. AB provided the JEV and microglial cells. SKS guided the team during the planning of the experimental design, analyzed the data, and wrote the paper. All authors read and approved the final manuscript.