Background
Atrial fibrillation (AF) is considered to be an indication of underlying heart disease and is one of the most common cardiac arrhythmia disorders [
1]. Cardiac remodeling, especially the structural remodeling, is a key result of AF [
2]. Cardiac fibroblasts activation and aberrant fibroblast signaling can lead to cardiac fibrosis and heart injury [
3]. Reports showed that cardiac remote ischaemic preconditioning can reduce periprocedural myocardial infarction in the percutaneous coronary interventions patients [
4]. However, the molecular mechanisms of cardiac remodeling during atrial fibrillation remain incompletely understood.
MicroRNAs (miRs), small endogenous non-coding RNAs, about 19–22 nt functional RNA molecule, play important regulatory roles by sequence-specific base pairing on the 3' untranslated region (3'-UTR) of target messenger RNAs (mRNAs) [
5]. miRs can post-transcriptionally silence protein expression either by binding to complementary target mRNAs and degrading these mRNAs, or by inhibiting mRNAs translating into proteins [
6]. miRs are emerging as important regulators in participate in cell proliferation, differentiation, and apoptosis [
7]. The effect of miR-21 on cardiac fibrosis has been well established [
8,
9]. However, the precise function of miR-21 in cardiac fibrosis is still unclear.
Cell adhesion molecule 1 (CADM1), an immunoglobulin superfamily (Igsf) adhesion molecule, is a well-known tumor suppressor for a variety of cancers of epithelial origin [
10]. CADM1 downregulation may through epigenetic silencing [
11]. In immortalized kidney cells, the extracellular domain of CADM1 binds the receptor tyrosine kinase HER3, reducing cell proliferation [
12]. CADM1 is representative cardio-miRs targets [
13]. miRs regulate STAT3 signaling cascades that are involved in cardiac fibrosis as well as pathogenesis of human diseases [
13]. STAT3 an important regulator of cell proliferation [
14]. STAT3 is a downstream signaling molecule of CADM1 [
15]. Currently, recent studies demonstrated that CADM1 suppress squamous cell carcinoma development through decreasing STAT3 activity [
15].
This study was able to investigate the role of miR-21 and CADM1 in cardiac fibrosis and potential interaction between miR-21 and CADM1. More importantly, miR-21 inhibitor repressed cardiac fibrosis progression, miR-21 may be a better alternative to directly inhibit CADM1 expression in cardiac fibrosis. Our studies further support miR-21 acts as important regulators in participate in cardiac fibrosis pathological, enhances cardiac fibrotic remodeling and fibroblast proliferation via CADM1/STAT3 pathway.
Methods
Reagents and antibodies
Isoprenaline was obtained from He Feng (Shanghai, China). α-SMA and collagen I antibodies for were purchased from Boster (Wuhan, China), CADM1, p-STAT3 antibodies were obtained from Cell Signaling (Beverly, MA, USA). The primers of CADM1, STAT3, α-SMA, collagen I and β-actin were produced by Shanghai Sangong Biological and Technological Company (Shanghai, China). Immunohistochemical kit was obtained from the Zhongshan Biotechnology Corporation (Beijing, China). SYBR Green Real Master Mix and Reverse transcription reaction Mix were purchased from Fermentas (Ontario, Canada). Goat anti-rabbit IgG horse radish peroxidase (HRP), rabbit anti-goat IgG HRP, goat anti-mouse IgG HRP were obtained from Santa Cruz (California, USA).
Animals and treatments
Sprague–Dawley (SD) rats (weight 180–230 g) were purchased from the Experimental Animal Center of Anhui Medical University. SD rats were randomly divided into vehicle group and model group. In the model group, we use the method of ISO (2.4 mg/kg/day, 7 days, n = 15) subcutaneous injection. The vehicle object treated the same procedure, and the only difference was that normal saline instead of ISO. After 1 week, heparin injection (625U/100 g), deep anesthesia was induced with pentobarbital (50 mg/100 g body weight), the rats were anesthetized and killed (the cervical dislocation: is the most common method of death in rat. With the thumb and index finger pressed down the rat head, the other hand to seize the tail, forced a little back above the pull, so that the cervical off, causing the spinal cord and brain marrow off, animals immediately died), hearts were quickly isolated and heart tissue specimens were fixed in 4% phosphate-buffered paraformaldehyde. Other heart tissue specimens were snap-frozen in liquid nitrogen and stored at –80 °C for molecular analysis.
Patients and sample acquisition
All patients gave written informed consent to participate in this study, and the Institutional Ethics Committee of The First Hospital of Anhui Medical University (Anhui, China) approved the protocol. The study population consisted of 20 patients with severe isolated AF referred for mitral valve replacement in The First Hospital of Anhui Medical University. Twenty patients of SR underwent heart valve replacement surgery (Table
1). All selected patients were classified as heart function, based on the New York Heart Association (NYHA). During surgical replacement of the mitral valve myocardial samples were obtained from the left atrial appendage. Part of samples were immediately fixed in 10% buffered formalin and embedded in paraffin for immunohistochemical staining. The other samples were divided into pieces and frozen separately in liquid nitrogen following different processing for protein or RNA isolation.
Table 1
Clinical characteristics of all patients including of 20 SR patients and 20 AF patients
Case (Male/Female) | 20 (11/9) | 20 (10/10) |
Age (Year) | 53.2 ± 10.5 | 46.7 ± 9.1 |
LVEF (%) | 55.6 ± 6.9 | 56.8 ± 7.3 |
LAD (mm) | 43.3 ± 4.2 | 58.1 ± 9.5** |
NYHA-C (II/III/IV) | 4/11/5 | 3/12/5 |
Cell culture
The rat cardiac fibroblasts derive from SD neonate rats and cultured. A part of heart tissue was washed by PBS. Equal volumes of 0.25% trypsin and 0.3% type I collagen enzyme were added, and heart tissue slices were incubated in a 37 °C water bath. Cells were collected and the collected cells were filtered with a screen stencil and centrifuged at 1200 rpm for 5 min. Cells were seeded at a concentration of 2 × 104 cells/cm2, and cultured with DMEM containing 10% (v/v) fetal bovine serum, supplemented with 100U/ml penicillin, 100 mg/ml streptomycin, 2 mM L-Glutamine, respectively. After four passages, cells can be cultured with 5 ng/ml recombinant murine TGF-β1 (Peprotech, USA). Cells were passaged for 48 h and serum- starved with DMEM for 24 h. Cell cultures were maintained at 37 °C in an atmosphere of 5% CO2.
Histological analysis
The rats were anesthetized and killed, hearts were quickly isolated and the heart tissue fixed in 10% buffered formalin. The left atrial appendage of the patients done the same procedure. The heart tissue was excised. Tissues were embedded in paraffin and cut into 5 μm thick sections. They were mounted on normal glass slides and stained with hematoxylin & eosin (H&E) and Masson trichrome staining. Images of H&E-stained sections were used to measure cardiomyocyte width using Olympus Image Pro-plus. Each section was assessed under light microscopic fields.
Immunohistochemistry
The tissue sections were formalin fixed and paraffin embedded prior to immunohistochemical staining. Sections were deparaffinized, rehydrated, processed for antigen retrieval. Sections were then incubated with primary antibodies against α-SMA (1:400), CADM1 (1:300) and p-STAT3 (1:200) overnight at 4 °C. After rinsing, the sections were subsequently incubated with a biotinylated goat anti-rabbit secondary antibody for 60 min at room temperature, washed in PBS, and stained with DAB(3, 3′-diaminobenzidine). Slides were counterstained with hematoxylin before dehydration and mounting. Negative controls were run in parallel by replacing the primary antibodies with PBS.
miR-21 mimic and inhibitor transfection
miR-21 mimic, inhibitor and their respective negative control oligonucleotides were designed and chemically synthesized by Biomics Biotechnologies (Nantong, China). The sequences: miR-21 mimic sense 5′-UAGCUUAUCAGACUGAUGU UGA -3′and anti-sense 5′-UCAACAUCAGUCUGAUAAGCUA-3′, miR-21 inhibitor sequences were 5′-UCAACAUCAGUCUGAUAAGCUA-3′. Cardiac fibroblasts was prepared 24 h in antibiotic-free medium before transfection and cultured into six-well plate to achieve >70% confluence on the day of transfection. The miR-21 mimic, inhibitor or their respective NC was transfected into cells using Lipofectamine™ 2000 Reagent (Invitrogen, Carlsbad, CA, USA) in serum-free conditions for 4–6 h before changing to complete medium. The transfected cells were cultured in regular culture medium, and RNA and protein were collected 48–72 h after transfection, respectively.
One-step qRT-PCR
To detect the expression of miR-21 in human atrial tissues, rat heart tissues and cardiac fibroblasts, qRT-PCR was carried out using the ABI 7500 Real Time PCR system (Foster City, CA, USA). Total RNAs were extracted through one-step method with Trizol (Invitrogen, USA). RNA-concentration was determined by IMPLEN NanoPhotometer. One-step real-time qPCR was performed to confirm expression of miR-21, it was measured using EzOmics miRNA qPCR Detection Primer Set (Biomics, USA) and EzOmics One-Step qPCR Kit (Biomics, USA). PCR was performed at 42 °C for 30 min; 95 °C for 10 min, followed by 40 cycles of amplification. Analysis the miR-21 expression was performed using the comparative CT method with U6 as endogenous controls, and the test was repeated three times.
qRT-PCR
Total RNA was isolated from cells and tissues, and the first-strand cDNA was synthesized using RT-PCR synthesis kit according to the manufacturer's instructions. PCR for mRNA of CADM1 and STAT3 were performed by using RT-PCR kits. RT-PCR was carried out under standard protocol using the following primers (Table
2). PCR was performed at 42 °C for 30 min; 95 °C for 10 min, followed by 40 cycles of amplification. Analysis the miR-21 expression was performed using the comparative CT method with β-actin as endogenous controls, and the test was repeated three times.
Table 2
Primer sequences used for real time fluorescent quantitative polymerase chain reaction
Rat CADM1 | Forward | 5'-TGGCGTTACCTT GGTAACC-3' |
Reverse | 5'-GGTGTTGAGCCCTTTCCAG-3' |
Rat α-SMA | Forward | 5' TGGCCACTGCTGCTTCCTCTTCTT 3' |
Reverse | 5' GGGGCCAGCTTCGTCATACTCCT 3' |
Rat STAT3 | Forward | 5'-CACCCATAGTGAGCCCTTGGA-3' |
Reverse | 5'-TGAGTGCAGTGACCAGGACAGA-3' |
Rat β-actin | Forward | 5' TGG AATCCTGTGGCATCCATGAAAC 3' |
Reverse | 5' ACGCAGCTCAGT AACAGTCCG 3' |
Human CADM1 | Forward | 5'-TCAACACGCCGTACTGTCTG -3' |
Reverse | 5'-GTGGGAGGAGGGATAGTTGTG -3' |
Human STAT3 | Forward | 5'- GAAGAATCCAACAACGGCAG-3' |
Reverse | 5'- TCACAATCAGGGAAGCATCAC-3' |
Human β-actin | Forward | 5'-GCTCGTCGTCGACAACGGCTC-3' |
Reverse | 5'-CAAACATGATCTGGGTCATCTTCTC-3' |
Cell proliferation assay
Cell proliferation was determined by the 3-(4, 5-dimethylthiazol-2-yl)-2, 4-diphenyl- tetrazolium bromide (MTT) assay based on the formation of formazan from MTT by metabolically active cells. The cells were seeded in 96-well culture plates at a density of 5 × 103 cells per well and transfected with miR-21 inhibitor and negative control, respectively. Twenty four hours later, cell proliferation was assessed. MTT was added to the medium at a final concentration of 5 mg/ml for 4–6 h. The resulting formazan crystals were dissolved in 150 μl dimethyl sulfoxide (DMSO), and measured at the optical density (OD) of 490 nm on a microplate reader (Bio-Tek EL, USA). All experiments were performed in triplicate and repeated at least three times.
Cell cycle
Cell cycle analysis kit (Beyotime, China) for cell cycle analysis. The cells were seeded at a density of 5 × 103 cells per well in 96-well culture plates and transfected with miR-21 inhibitor and their negative control, respectively. Cells were washed with cold PBS after fixation, then stained with 0.5 ml of propidium iodide (PI) staining buffer at 37 °C for 30 min in the dark. The cell cycle analyses were performed on BD LSR flow cytometer. The phases of cell cycle were analyzed by WinMDI software program. The experiments were performed in triplicate.
Western blotting
Total protein samples were extracted, the protein concentration was detected using a BCA protein assay kit (Boster, China). Total protein from samples were electrophoresed on a 10% SDS-PAGE gel and blotted onto a PVDF membrane. After blocking, the membrane was probed with antibodies against CADM1, p-STAT3, α-SMA, collagen I and β-actin diluted in TBS/Tween20 (0.075%). Visualization of the second antibody was performed using a chemiluminescence detection procedure, ECL-chemiluminescent kit, according to the manufacturer’s protocol. The integrated density of each band was normalized to the corresponding β-actin band. β-actin was used as loading control.
Statistical analysis
Experimental results are expressed as means ± SD. Statistical analysis was performed by using the ANOVA or the Student’s t test when appropriate. P value <0.05 was considered significant. All experiments were performed at least three times.
Discussion
Cardiac fibrosis could appear as a result of AF [
16]. Excessive fibroblast activation and collagen production are the major pathogenic mechanisms in the progression cardiac fibrosis [
16,
17]. Therefore, the present study aimed to investigate the new mechanisms for cardiac fibroblast proliferation and cardiac fibrosis. Firstly, we evaluated the changes of pathological changes in the rat hearts. Masson’s and H&E assay shown that cardiac fibrosis rat collagen significantly deposition compared with the normal rat.
Abnormal expression of genes involved in cardiac fibroblast activation and fibrosis. Our study indicated that the mRNA and protein of STAT3 increased in activated fibroblast and fibrosis tissue. TGF-β1 induced fibroblasts activation and proliferation through STAT3. However, CADM1 mRNA and protein expression was significantly decreased in cardiac fibrosis tissue and fibroblast. Studies demonstrated that CADM1 may inhibit STAT3 activity and control cellular proliferation. Therefore, CADM1/STAT3 pathway is important for cardiac fibrosis development.
Emerging evidence suggests that miR-21 regulation of cardiac fibroblast activation and fibrosis [
9,
18]. We demonstrated that the expression of miR-21 increased in cardiac fibroblast and fibrosis tissue. We also showed that silencing of miR-21 can inhibit α-SMA expression. Furthermore, the cell proliferation assay suggested that miR-21 inhibitors can suppress cardiac fibroblasts proliferation. However, it remains unclear whether miR-21 has an effect on CADM1 in cardiac fibroblast activation and fibrosis, we found that miR-21 overexpression correlated with CADM1/STAT3 in cardiac fibroblasts.
miRs therapy can control CADM1/STAT3 pathway, we examined what changes of CADM1/STAT3, after treatment cardiac fibroblasts with miR-21 mimics and inhibitors. Our experiment found that miR-21 may control CADM1 expression. Moreover, these data indicated that miR-21 suppress CADM1 may result in upregulation of STAT3 expression.
In sum, we found that miR-21 contribute to fibroblast proliferation and cardiac fibrosis via CADM1/STAT3 pathway. Our findings showed that miR-21 and CADM1 play a key role in cardiac fibrosis, indicating that miR-21, CADM1 and STAT3 may serve as therapeutic target of fibroblast activation and fibrosis. More importantly, we showed that miR-21 can inhibit cardiac fibroblasts proliferation, through regulation of the CADM1/STAT3 pathway, mediated by miR-21 and the targeting of the CADM1.
Conclusions
Our findings indicated that miR-21 and CADM1 are involved in the pathogenesis of cardiac fibrosis, implicating that miR-21, CADM1 and STAT3 signaling pathway molecules could be used as therapeutic target of cardiac fibrosis. miR-21 can inhibit cardiac fibroblasts proliferation, through the CADM1/STAT3 pathway, mediated by miR-21, targeting CADM1.