miR-337 regulates the proliferation and invasion in pancreatic ductal adenocarcinoma by targeting HOXB7

The human pancreatic cancer cell lines PANC-1 and As-PC-1 were purchased from the American Type Culture Collection. The cells were maintained in DMEM media supplemented with 10% fetal bovine serum (Gibco), 100 U/ml penicillin G (Invitrogen), and 0.1 mg/ml streptomycin sulfate (Invitrogen) at 37°C in a humidified, 5% CO₂, 95% air atmosphere. This study was approved by the Research Ethics Committee of Zhengzhou University, China.

miR-337 mimics and the negative control (NC) were chemically synthesized by Shanghai GenePharma Co. Ltd. PANC- 1 and As-PC-1 cells were seeded in 6-well plates. A final concentration of either 50 nM RNA mimics or NC RNA was transfected into the cells using Lipofectamine™ 2000 (Invitrogen) according to the manufacturer's protocol.

The wild-type HOXB7 3'UTR luciferase reporter vector (pmirGLO-HOXB7-WT) was constructed by amplifying the human genomic DNA and then cloning it into the Xbal site of pmirGLO-control vector. The primers used were as follows: 5' GGGATGGAGAAAGGGCAGAGGAAGA 3' (foward), 5' GCTACAGAACAGGTAGATAATATCC 3'(reverse). The mutant type HOXB7 3'UTR luciferase reporter vector (pmirGLO-HOXB7-MUT) was established using a site-directed mutagenesis kit (Promega) with pmirGLO-HOXB7-Wt serving as a template. miR-337 mimics or NC (final concentration, 50 nM), 100 ng luciferase reporter plasmid were cotransfected into PANC-1 (or As-PC-1) cells of 90% confluence in 24-well plates. After 24 h, cells were lysed and luciferase activity was measured using a Dual-Luciferase Reporter Assay System (Promega).

The cultured cells were lysed by using RIPA buffer. BCA Protein Assay Kit was used to measure the protein concentrations. The total protein was loaded onto 10% SDS-PAGE gels and transferred to PVDF membranes. Membranes were probed overnight at 4°C with antibody recognizing HOXB7 (1:600, Santa Cruz), or GAPDH (1:2000, Santa Cruz) in TBST containing 1% BSA (w/v). Blots were then incubated for 2 h with anti-mouse secondary antibodies. Immune complexes were detected using an ECL Plus Detection Kit (Pierce, Rockford, IL, U.S.) and quantified using a scanning densitometer with molecular analysis software (Bio-Rad, Hercules, CA, U.S.).

Total RNA was isolated from cell lines using Trizol (Invitrogen). The expression levels of mature miR-337 and its precursor were quantified using quantitative real-time PCR (qRT-PCR) using the TaqMan human microRNA assay kits (Qiagen). U6 snRNA served as an internal normalized reference. The relative expression ratio of miR-337 was presented as the fold change as normalized to an endogenous reference (U6 RNA) relative to the normal cell line.

After transfection, cells were seeded in a 96-well plate at a density of 1 × 10⁴ cells per well and incubated for four days. In vitro cell proliferation was evaluated using a CCK-8 (Beyotime Inst Biotech, China) according to manufacturer's instructions. The absorbance was determined at 450 nm wavelength with a reference wavelength of 630 nm. All experiments were performed in triplicate.

Twenty-four hours after RNA transfection, cells were trypsinized and plated on 6-well plates (1000 cells/well) and cultured of 2 weeks. Then the colonies were captured with the Olympus SZX12 and QCapture Pro software. Cell colonies > 0.1 mm in diameter were counted under a microscope.

Cells (6 × 10⁶ per well) at 12 h post-transfection were seeded in six-well plates and allowed to adhere for 24 h. Confluent monolayer cells were scratched with a 200 μl pipette tip and then washed three times with 1 × PBS to clear cell debris and suspension cells. Fresh serum-free medium was added, and the cells were allowed to close the wound for 36 h. Photographs were taken at 0 and 36 h at the same position relative to the wound.

The lower side and upper sides of separate polycarbonate membranes (8 μm pores) of a transwell (Costar, Lowell, MA, U.S.) were coated with Matrigel (80 μg/well) for the invasion assays. The cells were added to the upper chambers of a transwell; after incubation for 16 h at 37°C, the cells on the lower side were stained with Giemsa stain. The level of invasion was determined using a microscope at × 200 magnification. All experiments were performed in triplicate.

Statistical treatment was performed using SPSS 16.0 software. One-way analysis of variance (ANOVA) and the χ² test were used to analyze the significance between groups. Multiple comparisons between the experimental group and control groups were made using Tukey's HSD when the probability for ANOVA was statistically significant. All data represent mean ± SD. The statistical significance was set at P < 0.05.

Whether miR-337 affected the expression of HOXB7 protein was investigated by Western blot analysis. The levels of HOXB7 protein were clearly lower in miR-337 overexpressing cells (PANC-1 and As-PC-1) than in control cells (Figure 1B). Four prediction programs (miRBase, RNA22, miRanda, and TargetScan) were used to search for potential miR-337 targets to characterize the mechanism associated with miR-337 action. This analysis identified HOXB7 as a potential target of miR-337 (Figure 1A). In order to further support these results, two reporter plasmids carrying a wild-type HOXB7 3'UTR and a mutant HOXB7 3'UTR, respectively, were constructed. Cotransfection experiments showed that miR-337 mimics obviously inhibited luciferase activity in cells transfected with pmirGLO-HOXB7-WT but not in cells transfected with pmirGLO-HOXB7-MUT. The inhibitory effect was completely abrogated with pmirGLO-HOXB7-MUT, which contained a mutation in the miR-337 binding site (Figure 1C, D).

CCK-8 for proliferation assay was performed for PANC-1 and As-PC-1 cell lines, which were transfected with either miR-337 mimics or NC. Marked inhibition of growth was observed on the first day after transfection, and a marked inhibitory effect on cell proliferation lasted for four days (Figure 2A). The biological effect of miR-337 mimics on anchorage-independent colony formation in soft agar was also determined. After 2 weeks significantly less (P < 0.05) PANC-1 (or As-PC-1) cells colony forming potential was observed in cells treated with miR-337 mimics than in the blank and negative control groups, as assessed by the number of clones (Figure 2B).

To evaluate the roles of miR-337 in the regulation of cell mobility, the invasion ability of PANC-1 (or As-PC-1) cells in vitro after different transfections was examined using a wound healing assay and transwell invasion assay. For a wound healing assay, PANC-1 (or As-PC-1) cells transfected with miR-337 mimics at 36 h after incubation exhibited a slower rate of invasion than that of miR-337 NC and untransfected group (Figure 3A). To further evaluate the impact of miR-337 over-expression on cell invasion, PANC-1 (or As-PC-1) cells were treated with the different oligonucleotides and placed in a transwell chamber. The numbers of miR-337-mimic-treated PANC-1 and As-PC-1 cells invading through the Matrigel were significantly lower (P < 0.05, P < 0.05) than in the blank control and the NC groups (Figure 3B). These results demonstrate that miR-337 over-expression inhibits the invasive ability of PANC-1 and As-PC-1cells in vitro.