Background
Warburg effect was first described as a common metabolic feature of cancer cells almost 90 years ago, which has also been known as aerobic glycolysis nowadays [
1]. This phenomenon indicates that cancer cells tend to consume more glucose to produce lactate by glycolysis rather than oxidative phosphorylation even in oxygen-rich conditions [
2]. This metabolic shift is thought to provide diverse glycolytic intermediates for anabolic biosynthesis instead of energy production in rapidly proliferating cancer cells [
3]. Thus, the understanding of controlling the shift from oxidative phosphorylation to aerobic glycolysis is crucial for cancer treatment.
At present, breast cancer (BC) is the most prevalent cancer among women in China and the incidence of BC is still increasing rapidly [
4]. Despite numerous evidence have shown that accumulation of genetic and epigenetic changes cause tumorigenesis and progression [
5], the mechanisms underlying the pathogenesis of BC remain to be clearly defined. Given that recrudescence and metastasis occur frequently and associate closely with BC death [
6], understanding the fundamental mechanism that facilites cancer progression and finding new sights in breast cancer treatment are of great importance.
MicroRNAs (miRNAs) are a class of small non-coding RNAs that can play central regulatory roles in the development of breast cancer [
7]. They can imperfectly pair with the 3′-untranslated region (UTR) of their target mRNAs and trigger mRNAs degradation or translation inhibition [
8]. It has been evidenced that miRNA expression is closely associated with tumor proliferation and metastasis [
9]. For example, miR-146a and miR-301a promotes breast cancer progression by targeting EMT markers and PTEN, respectively [
7,
10]. Positive expression of miR-361-5p has been proved to indicate better prognosis for BC patients [
11]. However, the specific function and regulatory mechanism of miR-361-5p in BC progression is rarely investigated. In this study, we sought to reveal how miR-361-5p exerts influence on BC progression, identify and characterize its target genes.
Methods
Cell lines and cell culture
Human spontaneously immortal cell line and breast cancer cell lines, including MCF-10A, MCF-7, MDA-MB-231, MDA-MB-468, T47D, MDA-MB-549 and HEK-293 T were cultured under conditions recommended by ATCC. The cells were maintained in DMEM (Hyclone) supplemented with 10% FBS (Hyclone) at 37 °C under an air atmosphere containing 5% carbon dioxide.
RNA extraction and RT-PCR
Total RNA were extracted and reverse transcribed by using TRIZOL reagent (Invitrogen) and M-MLV RT kit (Promega). For detecting miR-361-5p, the Mir-VanaTM MiRNA Isolation Kit (Ambion, USA) was used to isolate total RNA from cell lines and patient samples following the manufacturer’s instructions. MiR-361-5p was detected using Platinum Taq DNA Polymerase (Invitrogen) with specific primers: miR-361-5p forward: ATAAAGRGCRGACAGTGCAGATAGTG, miR-361-5p reverse: TCAAGTACCCACAGTGCGGT, and U6 forward: CTCGCTTCGGCAGCACA, U6 reverse: AACGCTTCACGAATTTGCGT. Results were expressed as fold change using the 2-△△CT method.
Plasmid construction and transfection
For the stable transfection of anti-miR-361-5p, anti-miR-361-5p sequence were amplified from miRZip-361-5p construct (System Biosciences) and cloned into pSilencer4.1 system. BC cells were then transfected with the pSliencer vector containing the antisense sequence of miR-361-5p. The cells were selected by puromycin after 48 h transfection and then diluted. MiR-361-5p mimics, miR-control, FGFR1 siRNA, MMP-1 siRNA or siRNA negative control were purchased from Genepharma (China). FGFR1 and MMP-1 cDNA ORF Clone were purchased from Origene (Origene Technology). Transient transfections were performed by using Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocol. Cells were kept in medium containing 2% FBS for 48 h and then harvested and used.
Luciferase reporter assay
HEK293T cells were used to perform the luciferase reporter assay. FGFR1 3′-UTR, mutated FGFR1 3′-UTR, MMP-1 3′-UTR, mutated MMP-1 3′-UTR, or control luciferase reporter plasmid was cotransfected with miR-361-5p mimics or negative control (Ambion) using Lipofectamine 3000 (Thermofisher, USA). Luciferase activity was measured by SecrePair Dual-Luciferase Reporter System (GeneCopoeia).
Western blot
Indicated cells were lysed with RIPA buffer. Protein lysates were electrophoresed through SDS polyacrylamide gel, followed by transferring to PVDF membranes (Millipore, USA). The membranes were blocked with non-fat dry milk at room temperature and then incubated with primary antibodies at 4°Covernight. The primary antibodies included: FGFR1, PDHK1, P-PDHK1, LDHA, P-LDHA, MMP-1 and β-actin (Cell Signaling Technology). Membranes were then washed and incubated with secondary antibodies. Proteins were visualized by the electrochemiluminescence (ECL) western blot substrate detection (Pierce).
Cell proliferation and colony formation assays
The xCELLigence RTCA DP (Roche) instrument was used to perform the real-time cell proliferation assays according to the manufacturer’s instructions. The concomitant changes in Cell Index reflected the changes in cell numbers. For colony formation assays, 1 × 103 cells were seeded in a well of a 6-well plate and cultured for 1–2 weeks. The cells were then fixed and stained. The cell colonies were imaged and analyzed.
Cell invasion assay
For transwell invasion assays, 2 × 105 cells were plated into the upper chamber of the insert (Corning) coated with Matrigel (BD Bioscience). Cells were seeded in medium without serum in the upper chamber and the medium in lower chamber was supplemented with 10% FBS. Cells were cultured for 48 h and cells invaded to the underside of the membrane were fixed, stained, imaged and counted.
Cellular glucose-6-phosphate assay
The levels of glucose-6-phosphate in indicated cells were measured using Glucose-6-phosphate Fluorometric Assay kit (Cayman, USA). All results were normalized to total protein expression levels.
The extracellular acidification rate (ECAR) was detected using a Seahorse Bioscience XF24 extracellular flux analyzer (Seahorse Bioscience). The cartridge sensor was hydrated overnight with buffer at 37 °C without CO2. Indicated cells were plated in an XF24 Islet Capture Microplate and the medium was replaced with serum-free DMEM/F12 without sodium bicarbonate. ECAR values were observed under basal conditions and measured after the input of oligomycin (1 μM), FCCP (1 μM), and antimycin A (1 μM) into the well. ECAR values were analyzed by using the Seahorse XF-24 software. Every point represents an average of five different wells.
Glucose consumption and lactate production
Glucose consumption and lactate production were measured by using the supernatant of the indicated cells. The glucose assay kit (Sigma-Aldrich, St. Louis, MO, USA) was used to measure glucose levels following the manufacturer’s instructions. The lactate production was determined by the colorimetric lactate kit (Bio Vision, Milpitas, CA, USA). The concentrations of metabolite were examined on deproteinized samples by performing specific enzymatic assays by a CMA600 analyzer (CMA Microdialysis AB, Sweden). The results were normalized to protein content using the Pierce BCA Protein assay (Thermo Scientific).
Immunofluorescence assay
Indicated cells were fixed with formaldehyde and permeabilized with 0.2% Triton X-100. After blocked with 10% goat serum, the indicated cells were incubated with primary antibodies and then corresponding secondary antibodies (Cell Signaling Technology). Images were taken using Zeiss confocal microscopy.
Animal studies
Balb/c nude mice and SCID mice were purchased from Vital Rivers (Beijing, China) and maintained under SPF conditions. All experiments involving animals were performed in accordance with the Guide for the Administration of Affairs Concerning Experimental Animals, the national guideline for animal experiments. Cells were suspended in culture medium. A 160 μl sample of medium containing 1 × 107 cells was injected into the dorsal flank of nude mice subcutaneously. The growth of tumor was monitored every week and the tumor xenografts were collected and weighed after 5 weeks. For lung metastasis model, 2 × 107 cells were injected through the tail vein of SCID mice. After 5 weeks, the mice were injected with luciferin through tail vein 10 min before imaging. Imaging was performed by the Xenogen IVIS Spectrum Imaging System (Caliper Life Sciences, USA). Then the mice were sacrificed and the lungs were collected for detection. The number of metastatic nodules and tumor volume were evaluated. For each tissue, HE staining was performed for histological examination. All the animal experiments were approved by the Animal Experimental Ethics Committee of Harbin Medical University.
Clinical samples
Sixty pairs of primary breast cancer and corresponding normal breast tissues were collected and conserved in −80 °C condition after breast resection and pathological confirmation between November 2005 and March 2006 in the Second Affiliated Hospital of Harbin Medical University. The patients should not receive chemotherapy or radiation therapy before BC resection in this study. This study was performed according to the ethical standards of Declaration of Helsinki and all the patients provided written informed consent for the use of tissues. The TNM stage was determined in accordance to the classification proposed by the AJCC Cancer Staging Manual.
In situ hybridization and immunohistochemistry
In situ hybridization and immunohistochemistry staining were performed as previously described [
12].
Statistical analysis
Results were presented as mean ± standard deviation from at least three replicates. The Student’s t-test was used to compare differences between groups. Statistical analysis was performed by GraphPad Prism 5 software. Significant data were indicated by asterisks P < 0.05 (*), P < 0.01 (**).
Discussion
In this study, we found that the expression of miR-361-5p was downregulated in breast cancer and was associated with poor prognosis. As a tumor suppressor, miR-361-5p inhibited BC cells aerobic glycolysis and proliferation by directly targeting FGFR1, a promoter of glycolytic pathway. Meanwhile, miR-361-5p also targeted MMP-1 to suppress BC cells invasion and metastasis. Thus, our results provide evidence that miR-361-5p inhibits glycolytic metabolism, proliferation and invasion of BC cells and reveal the specific regulatory mechanism of miR-361-5p in BC, suggesting that miR-361-5p and its target genes may serve as potential therapeutic targets for BC patients.
Emerging evidence has demonstrated that microRNAs play crucial roles in multiple biological and pathological processes of cancer, including tumor cell proliferation, invasion and metastasis [
19]. It has been reported that some miRNAs acted as tumor regulators and could reduce the expression of many target oncogenes [
20]. MiR-361-5p, known as a tumor suppressor, was reported to play functional roles in several cancers [
21,
22]. However, the role of miR-361-5p and its regulatory mechanism in BC have rarely been discussed. By coincidence, our previous study has demonstrated that miR-361-5p inhibits the malignant phenotype of colorectal and gastric cancer by targeting SND1 [
12]. Morever, another recent study also showed that increased expression of miR-361-5p predicted improved BC survival [
23]. Similarly, Cao et al. reported that the clinical outcomes of patients with positive miR-361-5p expression was better than that of patients with negative miR-361-5p expression [
11]. Consistent with those studies, we observed that miR-361-5p was down-regulated in breast cancer compared with normal breast tissue, and decreased miR-361-5p expression was correlated with poor DFS. Nevertheless, we found that decreased miR-361-5p expression was also correlated with larger tumor size, lymph node metastasis and higher TNM stage, which was not significantly evidenced in the previous study. This difference in results might be caused by the distinct grouping modes between the two studies. In addition, we were the first to analyze the functional roles of miR-361-5p in BC cells and found that miR-361-5p suppressed breast cancer cells proliferation, invasion and metastasis both in vitro and in vivo. Based on these results, miR-361-5p could be recognized as a tumor suppressive miRNA in BC.
The type of glucose metabolism in tumors can shift widely between glycolysis and OXPHOS [
24]. Considering the fact that increased glucose uptake is associated with enhanced biosynthetic metabolism, the specific molecular mechanisms that upregulate glycolysis and anabolic biosynthesis are of great importance. Accumulating evidence showed that dysregulation of multiple metabolic enzymes might contribute to the aerobic glycolysis process, including glucose transporter 1 (GLUT1), pyruvate dehydrogenase kinase 1 (PDHK1) and lactate dehydrogenase (LDHA) [
25‐
27]. Previous studies found that phosphorylation of LDHA and PDHK1 by FGFR1 was common in diverse cancers which could activate LDHA and PDHK1 and promote glycolysis [
16,
17]. Consistent with these studies, we found that FGFR1 reverted the anti-glycolytic function of miR-361-5p by upregulating the activity of PDHK1 and LDHA, which enrich the mechanism that miR-361-5p inhibited BC cells glycolysis and proliferation. However, there might be many other questions remain to be solved, such as possible involvement of other targets and the detailed post-translational modifications of the metabolic enzymes. The investigation of these issues will no doubt enrich the mechanism that miR-361-5p and FGFR1 regulate BC cells glycolysis and proliferation.
Due to the fact that FGFR1 overexpression only partly converted the invasion ability of miR-361-5p-transfected cells, we questioned the possibility that another target of miR-361-5p might mediate its anti-metastatic phenotype. MMP-1, which belongs to a large family of peptidases, was identified to cleave the components of extracelluar matrix and play crucial roles in the movement of epithelial cells [
28]. Consistent with that, we demonstrated that MMP-1 was a direct functional target of miR-361-5p and mediated the anti-metastatic phenotype of miR-361-5p in BC cells. Interestingly, a previous study showed that the activation of FGFR1 might be induced in response to MMP-1 [
29]. Thus, the regulatory relationship between FGFR1 and MMP-1 downstream to miR-361-5p in breast cancer remains to be investigated in the future. Meanwhile, considering that several studies reported miR-361-5p to act its function by targeting some other factors, such as Twist1, VEGFA and FOXM1 [
30‐
32], it remains to be explored whether other targets may contribute to the anti-tumor effect of miR-361-5p.
Acknowledgements
This work was supported by the National Natural Science Foundation of China (No. 81372838), the National Natural Science Foundation of China (No. 81701705), the Found of Distinguished Young Scholars of the Second Affiliated Hospital of Harbin Medical University.