Background
Cervical cancer (CC) is the fourth leading cause among cancer-related deaths in women, and due to delayed initial screening, it mainly occurs in developing countries and causes about 265,000 deaths every year worldwide [
1]. Nowadays, advances in CC therapies have improved treatment outcomes, while the prognosis remains limited and ineffective and a great number of patients died of metastasis. Although human papilloma virus (HPV) is the major risk factor for CC [
2,
3], independent alterations in tumour suppressor genes and oncogenes are essential for the development of these cancers as well [
4,
5]. Therefore, it’s crucial to identify specific molecules and markers that contribute to understanding cervical carcinogenesis and ascertaining diagnostic and treatment strategies. Recently, researchers have focused on the effect of miRNAs on CC and a lot of miRNAs were found to play great importance in the initiation and development of CC [
6‐
8].
MicroRNAs are a class of 18-25-nucleotide, highly conserved non-coding RNAs that post-transcriptionally regulate gene expression by binding to their 3′UTRs and regulate a wide range of physiological and pathological processes including cell differentiation, proliferation, apoptosis, invasion and migration [
9‐
12]. In addition, growing evidences indicate that miRNAs are aberrantly expressed in human cancers and may function as tumor suppressors or oncogenes [
13]. miR-484 was located on chr6. The expressions and functions of miR-484 in cancers were little. Although Yang et al. [
14] reported that miR-484 was overexpressed in premalignant lesions of hepatocellular carcinoma (HCC), and can promote hepatocyte transformation and hepatoma development in two hepatocyte orthotopic transplantation models. Until now, the role and mechanism of miR-484 in CC cells are not clear.
Epithelial–mesenchymal transition (EMT) is an essential requirement for cancer invasion and metastasis [
15‐
17]. The transcription factors Snail, Slug, Twist, zinc finger E-box-binding homeobox (ZEB) play vital role in initiation of EMT process. Recent reports have showed that the miR-200 family and other miRNAs regulate EMT through targeting these transcription factors [
18‐
20]. ZEB family factors (ZEB1 and ZEB2) are transcriptional repressors that comprise two widely separated clusters of C2H2-type zinc fingers which bind to paired CAGGTA/G E-box-like promoter elements. These factors promote EMT by repressing expression E-cadherin [
21‐
23] and are important intracellular mediators of TGFβ-induced EMT. Over the past few years, ZEB1 has increasingly been considered as an important contributor to the process of malignancies including endometrioid cancer [
24], breast cancer [
25], lung adenocarcinomas [
26] as well as cervical cancer [
27]. On the one hand, it has been shown that miRNAs, such as the miR-200 family can directly bind to 3′UTR of the ZEB mRNA to down-regulate its expression and influence epithelial differentiation [
28,
29]. On the other hand, it has been revealed that SMAD proteins directly act with the promoter of the ZEB factor and indirectly regulates establishment and maintenance of EMT [
30,
31].
In this report, we demonstrated that miR-484 is down-regulated in cervical cancer tissues and cell lines, and overexpression of miR-484 inhibits cell proliferation, cell viability and exacerbates apoptosis, suppresses cell migration, invasion and EMT process of CC cells as well. Moreover, miR-484 was validated to directly bind to the 3′UTR of the ZEB1 and SMAD2 transcript, inhibiting their expression in CC cells. We also found that SMAD2 is an upstream regulator of ZEB1. Therefore, miR-484 regulated EMT process through both directly and indirectly targeting ZEB1. Collectively, our present work provides the first evidence that miR-484 down-regulates ZEB1 and SMAD2 expression to repress malignant properties in CC cells. The findings may provide insights into the mechanisms underlying carcinogenesis and potential biomarkers for cervical cancer.
Methods
Human cervical cancer tissue specimens and cell lines
Fifteen CC tissues and the paired adjacent non-tumor cervical tissues were obtained from the cancer center of Sun Yat-sen University. The diagnose was evaluated by pathological analysis. Written informed consent was obtained from each patient and ethics approval for this work was granted by the Ethics Committee of Sun Yat-Sen University. The cervical samples were classified by pathologists. The human CC cell lines HeLa, Caski and ME-180 were maintained in RPMI-1640 medium. C33A, SiHa and SW756 were maintained in MEM-α medium according to Ref. [
32]. Primary cultures of normal cervical keratinocytes (NCx) were obtained from hysterectomy specimens removed for non-neoplastic disease unrelated to the cervix. Cell culture and determination of growth rates were according to Ref. [
33]. All the cells were maintained in a humidified incubator with 5% carbon dioxide (CO
2) at 37 °C.
Vector construction
To over-express miR-484, the primary miR-484 fragment was amplified from genomic DNA and cloned into pcDNA3 vector between BamHI and EcoRI sites. To block the function of miR-484, we purchased the 2′-O-methyl-modified antisense oligonucleotide of miR-484 (ASO-miR-484) and the scramble control oligonucleotides (ASO-NC) from the GenePharma (Shanghai, China).
The gene encoding ZEB1/SMAD2 was amplified from the cDNA of HeLa cells, and the product was cloned into pcDNA3-Flag vector between EcoRI and XhoI sites. The shRNA for knocking down SMAD2 and ZEB1 were synthesized from GenePharma (Shanghai, China) and were annealed and cloned into pSilencer 2.1-neo vector (Ambion) between BamHI and HindIII sites.
The 3′UTR of ZEB1/SMAD2 (containing the predicted binding sites for miR-484) was amplified from the cDNA of HeLa cells and then was cloned into pcDNA3-EGFP vector between the
BamHI and
EcoRI sites (downstream of EGFP). The mutant 3′UTR of ZEB1/SMAD2 (five nucleotides were mutated in the miR-484 binding sites) was amplified from the construct (pcDNA3-EGFP/ZEB1 or pcDNA3-EGFP/SMAD2 3′UTR). All of the primers for PCR amplification and all the oligonucleotides for annealing are listed in Table
1.
Table 1
The oligonucleotides and primers used in this study
Pri-miR-484-forward | CGACGGATCCAAGCGCACCCTTCACTTC |
Pri-miR-484-reverse | GCTCGAATTCCGCTTCAAGGTTCCTTTCG |
ASO-miR-484 | AUCGGGAGGGGACUGAGCCUGA |
ASO-NC | CAGUACUUUUGUGUAGUACAA |
SMAD2-forward | GCGGAATTCAACATGTCGTCCATCTTGCCATTC |
SMAD2-reverse | CCAGCTCGAGTTATGACATGCTTGAGCAACG |
ZEB1-forward | GCGGATCCGCGGATGGCCCCAGGTGTAAG |
ZEB1-reverse | GACGCCTCGAGTTAGGCTTCATTTGTCTTTTCTTC |
SMAD2-3′UTR-S | GATCCTTTCTAGTATCTTACAGCCTGATAAGCTTG |
SMAD2-3′UTR-AS | AATTCAAGCTTATCAGGCTGTAAGATACTAGAAAG |
ZEB1-3′UTR-S | GATCCTTCTGGAGAGGTCAGAGTTGACAAGCTTG |
ZEB1-3′UTR-AS | AATTCAAGCTTGTCAACTCTGACCTCTCCAGAAG |
SMAD2-3′UTRmut-S | GATCCTTTCTAGTATCTTACCGAGCTATAAGCTTG |
SMAD2-3′UTRmut-AS | AATTCAAGCTTATAGCTCGGTAAGATACTAGAAAG |
ZEB1-3′UTRmut-S | GATCCTTCTGGAGAGGTCATCTAACTACAAGCTTG |
ZEB1-3′UTRmut-AS | AATTCAAGCTTGTAGTTAGATGACCTCTCCAGAAG |
miR-484-RT primer | GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACATCGGGAG |
miR-484-forward | TGCAGTCAGGCTCAGTCCCC |
U6-RT primer | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC |
U6-forward | TGCGGGTGCTCGCTTCGGCAGC |
Reverse primer | CCAGTGCAGGGTCCGAGGT |
qPCR-actin-forward | CGTGACATTAAGGAGAAGCTG |
qPCR-actin-reverse | CTAGAAGCATTTGCGGTGGAC |
qPCR-ZEB1-forward | TAAAGTGGCGGTAGATGGTA |
qPCR-ZEB1-reverse | ACTGTTTGTAGCGACTGGATT |
qPCR-FN1-forward | CAGTGGGAGACCTCGAGAAG |
qPCR-FN1-reverse | TCCCTCGGAACATCAGAAAC |
qPCR-Snail-forward | TTCTCTAGGCCCTGGCTGC |
qPCR-Snail-reverse | TACTTCTTGACATCTGAGTGGGTCTG |
qPCR-Twist-forward | GCAAGAAGTCGAGCGAAGAT |
qPCR-Twist-reverse | GCTCTGCAGCTCCTCGAA |
Prediction of miRNA targets
Cell transfection
Transient transfection was performed in antibiotic-free Opti-MEM medium (Invitrogen) with the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol.
RNA isolation and reverse transcription quantity (RT-qPCR)
Extraction of total RNA from cells was performed using the TRIzol reagent (Invitrogen, CA) following the manufacturer’s instructions. Expression of mature miRNAs and mRNAs were quantified by RT-qPCR using the SYBR Premix Ex TaqTM (Promega, Madison, WI). The concentration of RNA were measured with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and stored at −80 °C for further use. Special stem-loop primers were used for the miRNA reverse transcription (RT) reaction, and U6 small nuclear B noncoding RNA (RNU6B) was used as the endogenous control to normalize the level of miRNA. The oligo (dT) primer was used for the RT reaction for gene expression. β-actin was used as the endogenous control to normalize the level of genes. All analyses were performed in triplicate and reported as 2
−ΔΔCt. The primers for RT and PCR are provided in Table
1.
Fluorescent reporter assays
To identify the direct target relationship between miR-484 and the 3′UTR of ZEB1/SMAD2 mRNA, the CC cells were cotransfected with pcDNA3/pri-miR-484 or ASO-miR-484 and the 3′UTR of ZEB1/SMAD2 or the mutant 3′UTR of ZEB1/SMAD2 in 48-well plates. The vector pDsRed2-N1 (Clontech, Mountain View, CA) expressing RFP (red fluorescent protein) was transfected together with the above plasmids and used as an internal control standard. 48 h after transfection, the cells were lysed by RIPA buffer and fluorescence intensities of EGFP and RFP were detected with an F-4500 fluorescence spectrophotometer (Hitachi, Tokyo, Japan).
Cell viability assay and colony formation assay
The cell viability of CC cells was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay. The absorbance was determined at 570 nm (A570) (Bio-Tek Instruments, Winooski, VT, USA) after CC cells transfection for 24, 48 and 72 h. The details of methods were according to Ref. [
34].
For colony formation assay, the cells were seeded into 12-well plates at a density of 300 HeLa or 400 C33A per well at post-transfection 24 h. Change medium every 3 days. After 11 or 13 days, the cells were stained with crystal violet, and colonies including more than 50 cells were counted. The average number was used to evaluate the formation ability.
Cell cycle analysis and apoptosis assay by flow cytometry
Cell cycle analysis and apoptosis assay was according to Refs. [
6] and [
35] respectively.
Cell migration and invasion assays
The migration and invasion were analyzed by 24-well Boyden chambers with an 8-μm pore size polycarbonate membrane (Corning, Cambridge, MA). Briefly, 8 × 105 cells were resuspended in culture medium without FBS and seeded in the upper chamber. Then the chamber was placed into a 24-well plate containing 800 μL of culture media with 20% FBS. Approximately 48 h later, the cells were fixed with paraformaldehyde and stained with crystal violet. The cells did not pass through the membrane were removed with the cotton stick while the cells that passed through the membrane were counted.
Western blot analysis
The detailed procedures for western blot were described in a previous study [
36]. The primary anti-bodies used in this study including ZEB1, SMAD2, E-cadherin, cytokeratin, vimentin, N-cadherin, fibronectin and GAPDH, which were obtained from Saier Co. (Tianjin, China). The secondary goat anti-rabbit antibodies were purchased from Sigma.
Immunohistochemistry
The tumor tissues were fixed in 4% formaldehyde for 24 h and sent to Tangshan People’s Hospital for immunohistochemistry.
Statistical analyses
All the data are presented as the mean ± SD. Each experiment was performed at least three times, and the analysis was performed using paired t test. p ≤ 0.05 was considered statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).
Discussion
miRNAs have been indicated to be important regulators of a variety of biological processes, and their aberrant expressions are relevant to cancer initiation and development. In recent years, miRNAs were reported as potential biomarkers as therapeutic approaches in human cancers [
37]. Understanding the role of miRNAs in cervical cancer will provide theoretical basis for miRNA-specific personalized treatment and molecular-targeted therapy.
miR-484 was originally discovered to be associated with resistance to chemotherapeutic agents in cancer [
38]. This year, an aberrant expression of miR-484 has also been described in high-fat-diet-induced tumours, with a fluctuant miR-484 overexpression during feeding [
39]. Ectopic expression of miR-484 initiates tumourigenesis and cell malignant transformation of HCC through synergistic activation of the TGF-β/Gli and NF-κB/IFN-I pathways [
14]. This indicated that miR-484 may act as a significant role in tumor metastasis including EMT process. To our understanding, the functional study of miR-484 in cervical cancer is still missing. Here, we demonstrated that miR-484 was down-regulated in cervical cancer tissues compared to adjacent non-tumor tissues, which is different from the result in HCC. These differences may be due to the different types of cancer and the phases of the cancer, but the mechanisms need to be elucidated in the future. For example, miR-200s is downregulated and inhibit local invasion in breast cancer but enhances spontaneous metastasis and colonization of lung adenocarcinoma [
40]. Functional analyses revealed that overexpression of miR-484 suppressed the malignant behavior of cervical cancer cells. Specifically, miR-484 overexpression significantly inhibited the cell proliferation, migration, invasion and EMT, whereas ASO-miR-484 enhanced these oncogenic features. In addition, western blot indicated that the expression of EMT markers including E-cadherin, cytokeratin, vimentin, N-cadherin and fibronectin were significantly modulated by miR-484, which is consistent with the formation of EMT. Collectively, miR-484 functions as a tumor suppressor in cervical cancer cells.
miRNAs generally play their roles by regulating their target genes. To better understanding the role of miR-484 in CC, we applied bioinformatics analyses to predict that the 3′UTR of SMAD2/ZEB1 contains miR-484 binding sites. EGFP reporter assay demonstrated that miR-484 directly targets SMAD2 and ZEB1 transcripts. Western blot analyses showed the decreased expression of ZEB1 and SMAD2 upon overexpression of miR-484 and vise versa. Functionally, overexpression of miR-484 could inhibit cell proliferation, migration, invasion and EMT, while the ectopic expression of SMAD2/ZEB1 abrogated the inhibitory effects of miR-484 on these tumorigenic features in cervical cancer cells. Meanwhile, we also showed that knocking-down of SMAD2/ZEB1 abrogated the tumorigenic effects induced by ASO-miR-484. Thus, we concluded that miR-484 may function as tumor suppressor by down-regulation of ZEB1 and SMAD2 expressions in cervical cancer.
Upregulation of the expression of ZEB1 plays an important role in the progression and metastasis in many cancers [
24‐
26], including cervical cancer [
27]. Our previous study has shown that SMAD2 promotes cell growth by facilitating the G1/S phase transition, enhances cell migration and invasion through regulated EMT in CC cell lines [
6]. In addition, regulating SMAD2 by miRNAs has been identified to be involved in the TGFβ-induced EMT. For example, miR-18b targets SMAD2 and inhibits TGF-β1-induced differentiation of hair follicle stem cells into smooth muscle cells [
41], and miR-27a inhibits colorectal carcinogenesis and progression [
42]. Expectedly, ectopic expression of SMAD2 counteracts the inhibition of EMT induced by miR-484 in CC cells. The restoration of SMAD2/ZEB1 expression mostly blocked the inhibitory influence of miR-484 on malignant behavior (Figs.
5,
6,
7). The expression of miR-484 and SMAD2/ZEB1 in the tissues and cell lines demonstrated that miR-484 had negative correlation with SMAD2/ZEB1, and that SMAD2 had positive correlation with ZEB1 (Fig.
9b, c). This result further supported that SMAD2 is an upstream protein of ZEB1 and they are both regulated by miR-484. Previous work has demonstrated that SMAD directly binds to the promoter of the ZEB factor and indirectly regulates EMT [
30,
31], which is in accordance with our results in CC. In summary, all these results prove that miR-484 inhibits the development of CC and may partially (if not completely) through down-regulating SMAD2 and ZEB1 expressions.
Except for ZEB, other transcription factors such as Snail, Slug and Twist are also the master regulators of EMT [
22], which can activated by TGFβ directly and repress the transcription of E-cadherin [
23]. The TGFβ/ZEB/miR-200 double-negative feedback loop has been found and postulated to explain both the stability and interchangeability of the epithelial versus mesenchymal phenotypes in MDCK cell systems [
43,
44]. In the present study, we found that miR-484 could target both SMAD2 and ZEB1 genes simultaneously, and ZEB1 is regulated by SMAD2 as well, which is different from The ZEB/miR-200 double-negative feedback loop. Interesting, our results also showed that miR-484 affects the expression of Snail, Slug and Twist as well, which may due to miR-484 regulating ZEB1 to the EMT-related regulators, while the detailed regulatory mechanism need to be further investigated. These results indicate that miR-484 exerts multiple pathways of regulation on EMT and highlight the importance of stringently regulating transcription factors. These findings also fit the emerging concept that miRNAs fine-tune gene expression to precisely modulate essential biological processes and provide a mechanistic view of miRNA-based regulation on specific molecules and markers involved in cancer metastasis.
Despite these studies, further development of the underlying mechanisms need to be investigated. And our next work is to found out the upstream regulatory mechanisms of miR-484 in CC cells.
Conclusions
In summary, our study demonstrated that miR-484 plays an important role in tumorigenesis and related to the EMT process in CC for the first time. miR-484 inhibits the proliferation, and exacerbates apoptosis, suppresses migration, invasion and EMT process through the down-regulation of ZEB1 and SMAD2 expression and functions as a tumor suppressor gene. In other words, miR-484 regulated EMT process through both directly and indirectly targeting ZEB1. Altogether, our findings provide new insights into the roles of miR-484 in cervical carcinogenesis and imply its potential applications as new biomarkers in cervical cancer.
Authors’ contributions
Conceived and designed the experiments: TH, HY. Performed the experiments: HY, LY. Analyzed the data: HY. Contributed reagents/materials: LM, XH, LW. Wrote the paper: HY. Revised the paper: TH, XH. All authors read and approved the final manuscript.