miRNA-146 negatively regulates the production of pro-inflammatory cytokines via NF-κB signalling in human gingival fibroblasts

HGFs were prepared from explants of the gingiva of 10 periodontitis patients who were acquired during periodontal flap surgery after receiving the informed consent of the patients. The epithelial tissues were torn from the gingiva after 24 h of soaking in 2 U/ml dispase II (Takara, Japan). Gingival connective tissues were cut into pieces and cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA) with 20% foetal bovine serum (FBS) (Hyclone, USA). The medium was changed every 3 days for total 10–20 days until confluent cell monolayers were formed [13]. After four or five subcultures, homogeneous, slim, spindle-shaped cells were obtained and cultured in DMEM with 10% FBS, penicillin (100 U/ml) and streptomycin sulphate (50 μg/ml). TPCA-1 (an IKK-2 inhibitor), PD98059 (a MEK-1/2 inhibitor), SP600125 (a JNK-1/2 inhibitor) or an IRAK1/4 inhibitor was added to the culture at the concentrations and times indicated below, with or without simulation of 1 μg/ml of P.g LPS (Ultrapure, activates TLR4 only, InvivoGen, USA). All inhibitors were purchased from Sigma (USA). Betulinic acid was purchased from R&D (USA).

Total RNA was extracted from cultured cells with TRIzol (Invitrogen, USA) according to the manufacturer’s instructions. miRNA was polyadenylated and reverse transcribed using poly(A) polymerase and MMLV reverse transcriptase (Clontech, USA). miR-146a and miR-146b expressions in the total RNA extracts were measured with SYBR Advantage qPCR Premix (Clontech, USA), and the reactions were run on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, USA). The U6 small nuclear RNA (NR_003027) was used as an internal control. Each sample was amplified in triplicate. Data were analysed with SDS software (ABI, USA). The sequences of the target mature miRNAs and specific forward PCR primers were follows: hsa-miR-146a, GGGTGAGAACTGAATTCCA; hsa-miR-146b-5p, GGGTGAGAACTGAATTCCA; universal reverse PCR primer, CAGTGCGTGTCGTGGAGT; and U6 small nuclear RNA primers, GCTTCGGCAGCACATATACTAAAAT (U6-forward) and CGCTTCACGAATTTGCGTGTCAT (U6-reverse).

Two kilobases promoter sequence of miR-146a/b primary transcripts were cloned into the 5’ site of the luc2 reporter gene in pGL4.10 plasmid (Promega, USA). We co-transfected 200 ng of reporter plasmid, 20 ng of pRL-TK-Renillaluciferase and 100 ng of p50/p65 pcDNA3.0 plasmid into the HGFs using Lipofectamine 2000 (Invitrogen, USA). After 24 h of transfection, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, USA) according to the manufacturer’s instructions. The luciferase data were normalised to transfection efficiency by dividing the firefly luciferase activity by the activity of Renilla luciferase.

A total of 10⁵ HGFs per sample were harvested and lysed with 100 μl lysis buffer (50 mM HEPES, pH 7.0), 1% Nonidet P-40, 5 mM EDTA, 450 mM NaCl, 10 mM Na pyrophosphate, and 50 mM NaF and freshly supplemented with inhibitors (1 mM Na orthovanadate, 1 mM PMSF, 10 μg/ml aprotinin, leupeptin, pepstatin) at room temperature for 20 min. Aliquots of the whole-cell extracts were prepared and subjected to 10% SDS-PAGE and then electroblotted onto nitrocellulose membranes. The membranes were then probed with Abs as indicated. Antibodies against p-JNK (Thr183/Tyr185), total JNK (56G8), p-Erk1/2 (Thr202/Tyr204, D13.14.4E), total Erk1/2 (137 F5), p-IRAK4 (Thr345/Ser346), total IRAK4, total IκB-α and HRP-labelled secondary antibody were purchased from Cell Signaling. Membranes were visualised with Super Signal West Pico Chemiluminescent Substrate (Pierce, USA)

For analysis of cytokine production in the supernatant, human IL-1β, IL-6, and TNF-α ELISA Duoset kits were purchased from R&D and used according to the manufacturer’s protocol.

The results are presented as the mean ± SD where applicable. Student’s t tests were used to compare pairs of independent groups. For all tests, values of p < 0.05 were considered statistically significant.

After P.g LPS treatment, the HGFs produced inflammatory cytokines including IL-1β, IL-6, and TNF-α. These cytokines secretion are all depend on TLR4 and its downstream kinases [14]. Prior to using specific inhibitors to block these kinases, we first analysed the activation states of these kinases after P. g LPS treatment. We used 1 μg/ml P. g LPS to stimulate the HGFs, harvested the cells between 0 and 12 h, and detected the expression and phosphorylation levels of the IRAK4, JNK, Erk and IκB-α kinases by western blot. IRAK4 was activated as early as 2 h after exposure to P. g LPS, then activation peaked at 6 h, and IRAK4 was subsequently dephosphorylated (Figure 1A). Similar to IRAK4, Erk1/2 also reached its highest activation level 2 h after P. g LPS stimulation and returned to the unstimulated level at 4 h (Figure 1B). There is slight activation of JNK, even without the stimulation of P. g LPS, same as reported in other fibroblast research [15]. This type of constitutive phosphorylation of JNK may be caused by serum in the cell culture medium or other reason unknown, but we still found obvious increase of JNK activation after P. g LPS stimulation. This phosphorylation of JNK reaches its peak in 6–8 h, and keeps in high level after 12 h (Figure 1C). We did not detect IκB-α expression or its phosphorylation 2 h after P. g LPS stimulation, which confirmed its rapid degradation and proved that NF-κB signaling is activated after that time point (Figure 1D). Taken together, these results suggest that LPS-TLR4 signal transduction activates multiple kinases in HGFs, particularly NF-κB and Erk1/2 (Figure 1E).

To further test whether selective pharmacological inhibitors were functional in HGFs, we stimulated the cells with separate inhibitors and analysed the phosphorylation levels and total amounts of their targets. As expected, based on reports of other cell lines, PD98059 (an inhibitor of Erk kinase-1/2 and MEK-1/2, which is an upstream activator of Erk-1/2) [16], SP600125 (a JNK-1/2 inhibitor) [17], and TPCA-1 (which inhibits IKK-2 and prevents the degradation of the IκB-α proteins and NF-κB signals) [18],[19] worked well in HGFs (Figure 1 B-E).

To explore whether miRNA-146 expression is regulated by these kinases during activation of LPS-TLR4, we further used selective pharmacological inhibitors, such as the IRAK1/4 inhibitor [20], TPCA-1, SP600125 and PD98059 to block the overall downstream signal pathway or specific pathway of TLR4. In our previous report [12], we found that HGFs strongly express miR-146a and miR-146b 24 h after P. g LPS treatment and their expression levels depend on TLR4-IRAK1/4 signals. To further analyse the precise mechanisms of miR-146 expression, we treated the HGFs with different kinase inhibitors at the indicated concentrations and analysed miRNA expression levels. Treatment with a high concentration (10 μM) of IRAK1/4 inhibitor or the NF-κB inhibitor TPCA-1 led to a reduction of miR-146 expression compare to control. However, usage of SP600125 or PD98059, blocking JNK or Erk signalling pathways respectively, only weakly influenced miR-146a (Figure 2A) and miR-146b (Figure 2B) levels. These findings indicate that miR-146 expression is mainly controlled by factors downstream of NF-κB and IRAK1/4 other than JNK or Erk signals. Moreover, we also used betulinic acid (BetA), which activates NF-κB by increasing IKK activity and IκB-α degradation [21]. After 24 h of treatment with BetA, the levels of miR-146 expression in the HGFs were greater than those of the controls regardless of the P. g LPS stimulation condition (Figure 3). Taken together, these results imply that miR-146 expression is under the regulation of NF-κB signals.

miR-146 level is not up-regulated under P. g LPS-TLR4 stimulation when using NF-κB and IRAK1/4 inhibitor (Figure 2). And key result of the P. g LPS-TLR4 signals in HGFs is the production of numerous inflammatory cytokines that induce inflammation. Next, we want to explore whether cytokine secretion is also affected as miR-146 by IRAK1/4 and NF-κB inhibitors. In our earlier research [12], we found that high levels of IL-1β, IL-6 and TNF-α are secreted by HGFs after P. g LPS treatment. Cytokine secretion is further elevated when miR-146 is inhibited, which suggests that miR-146 plays a key role in the modulation of LPS-induced cytokine production. Thus, we next used specific pharmacological inhibitors to uncover the specific mechanisms of the expression of inflammatory cytokines in P. g LPS-treated HGFs. The indicated concentrations of inhibitors were added to the HGF culture media with or without P. g LPS simulation. Twenty-four hours later, the supernatants were harvested, and the cytokines levels were analysed by ELISA. As expected, IRAK1/4 inhibited the expression of most of the cytokines at the 10 μM concentration, and TNF-α was the most sensitive and its level decreased even under the low concentration (1 μM) of IRAK1/4 inhibitor (Figure 4A). Interestingly, TPCA-1 partially mimicked the effects of IRAK1/4; it substantially reduced IL-1β and IL-6 levels at the 10 μM concentration, and inhibited TNF-α at both the low and high concentrations (Figure 4B). In contrast, PD98059 and SP600125 only weakly influenced IL-1β and IL-6 levels at either the high or low concentrations, but both inhibitors down-regulated TNF-α levels (Figure 4C, 4D). In summary, these data indicate that HGF cytokine expression after P. g LPS stimulation is subject to complicated control mechanisms; IL-1β and IL-6 depend primarily on NF-κB signals, and TNF-α relies on both the NF-κB and AP-1 pathways.

It has been reported that both the miR-146a and miR-146b genes have putative NF-κB binding sites in their promoter loci and that the promoter constructs within these loci can be activated in luciferase assays after TLR4 stimulation [9]; these findings provide strong evidence that NF-κB directly controls the expression of miR-146. To confirm whether same situation exists in HGFs, we constructed separate plasmids containing either miR-146a or miR-146b 5’ promoter sequence in upstream of the luciferase reporter gene. Overexpression of p50 or p65 (common members of the NF-κB family) revealed that either p50 or p65 can activate the promoter of miR-146. Furthermore, co-transfection revealed that p50 and p65 have additive effects on the 5’ promoters of miR-146a and miR-146b (Figure 5). These results prove that the promoter of miR-146 is the target of NF-κB in HGFs.