Background
Liver fibrosis is a common consequence of most chronic liver diseases [
1]. Liver fibrosis received more attention until the hepatic stellate cell (HSC) was identified as the main ECM-producing cells in the injured liver [
2]. Under the normal physiologic condition, HSCs reside in the space of disse and store a large amount of vitamin A. After suffering from liver injury, HSCs will be activated, and then proliferate, eventually transdifferentiate into myofibroblast-like cells [
3].
microRNAs (miRNAs), short (~22 nt) conceding RNA molecules, can directly regulate gene expression by binding to the 3’UTR region of target mRNA to participate in lots of regulation of physiological process and diseases [
4‐
8]. Recently, researchers focused on the role of miRNA in liver fibrosis pathophysiology to determine their regulatory effects on proliferation, differentiation of HSC [
9‐
11]. Several abnormally expressed miRNAs were found and identified between quiescent and activated HSCs by using miRNA array or RT-PCR [
12‐
19]. Previous studies have reported that miRNAs were critically involved in the activation of HSCs. Among them, miR-29b precursor allowed activated HSCs to switch to a more quiescent state [
10]. Similarly, overexpression of miR-27a/b could lead HSCs to a quiescent phenotype [
20]. microRNA-338 (miR-338), a newly identified miRNA, played a crucial role in a variety of carcinomas. Aberrant expression of miR-338 was closely related to cell proliferation, invasion, early detection and clinic pathologic variables in liver cancer, colorectal cancer, gastric cancer and neuroblastoma [
21‐
25]. In previous research, our miRNA microarray data have found altered expression of miR-338-3p during culture activation of HSC [
14]. However, little is known about the role of miR-338-3p in liver fibrosis.
Cyclin-dependent kinase 4 (
CDK4) is found to be involved in cell cycle regulation. Activation of cyclin D—
CDK4 promotes the cell cycle progression through G1/S transition [
26]. Inhibition of
CDK4 shows promising efficacy on advanced breast cancer [
27]. In liver tissue and hepatoma cells,
CDK4/6 inhibition is a potent mediator of cytostasis [
28]. However, whether the CDK4 participates in the fibrogenic process and regulates HSC activation and proliferation remains largely unknown. In this study, RT-PCR data suggested that miR-338-3p expression in fully activated HSCs were significantly decreased compared with that in quiescent HSCs. Transforming growth factor (TGF-β) is deemed to be the most potent fibrogenic cytokine. The results showed that there was a negative relationship between TGF-β and miR-338-3p. Therefore, we speculated that miR-338-3p was closely associated with HSCs function. Then, we found overexpression of miR-338-3p could suppress HSCs activation and proliferation while inhibition of miR-338-3p could promote HSCs activation and proliferation. Based on the Bioinformatics prediction, we found that
CDK4 was a potential target gene of miR-338-3p. Further luciferase reporter assay and RT-PCR confirmed their complementary binding. Moreover, our results indicated that overexpression of
CDK4 could partially block miR-338-3p-inhibited cell activation and proliferation.
Methods
Primary rat HSCs, cell lines and culture
The isolation method of primary rat HSCs was according to the previous literature [
29]. Primary Rat HSCs, HSC-T6 and HEK293T (human embryonic kidney cell line) were kindly gifted from Dr. Gao (Tongji University, Shanghai, China). The primary cells and cell lines were cultured in DMEM (Dulbecco’s modified Eagle’s medium, Thermo, Waltham, MA, USA) containing 10% FBS (Fetal bovine serum, FBS, Gibco, Grand Island, NY, USA) at 37 °C in a humidified atmosphere of 5% CO2.
Plasmid construction
Wild-type 3’UTR containing predicted miR-338-3p binding sites were amplified from HSC-T6 genomic DNA and inserted into the PGL3 luciferase reporter vector. Mutant 3’UTR was generated using the Quick Change Lighting Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The CDK4 expression vector was obtained by cloning the CDK4-coding sequence into the pcDNA.
RT-PCR analysis
Total RNA was extracted from cultured HSCs using Trizol Reagent (Takara, Dalian, China). The primer sequences used for mRNA detection in this study were listed as follows: GAPDH (PF: CAGTGCCAGCCTCGTCTCAT, PR: AGGGGCCATCCACAGTCTTC); ColI (PF: ATCCTGCCGATGTCGCTAT, PR: CCACAAGCGTGCTGTAGGT); α-SMA (PF: CCGAGATCTCACCGACTACC, PR: TCCAGAGCGACATAGCACAG); CDK4 (PF: GAAGAAGAAGCGGAGGAAGAGG, PR: TTAGGTTAGTGCGGGAATGAAT).
CCK-8 assay and Edu assay
Cell proliferation was performed using CCK-8 assay (Dojindo, Japan) and Edu (Ribibio, Guangzhou, China) assay. For CCK-8, HSC-T6 was transfected with the miR-338 precursor, miR-338 inhibitor (Ribibio, Guangzhou, China) or pcDNA-CDK4 in 96 well culture plates. Proliferation rates were tested at 24, 48 and 72 h after transfection. The EdU assay was conducted according to the protocol of Ribibio Edu Kit.
Luciferase assay
Luciferase assay was performed with the Dual Luciferase Reporter Assay System (Promega, Madison, WI). Transfection was carried out in 48 well plates using Fugen (Roche). There were two groups. One was co-transfected with 200 ng wild-type-CDK4-3’UTR, 20 nm miR-338 precursor, and 20 ng Renilla. Another was co-transfected with 200mutant CDK4 3’UTR without binding site of miR-338-3p, 20 nm miR-338 precursor, and 20 ng Renilla. 48 h later, Firefly and Renilla luciferase activities were tested.
Western blotting
Cells were lysed in SDS sample buffer. Antibodies against GAPDH (Biogot, 1:5000 dilution, Nanjing, China), Col1 (Abcam, 1:1500 dilution, Cambridge, MA, USA), α-sma (Sigma, 1:1000 dilution, Shanghai, China) and CDK4 (Biogot, 1:3000 dilution, Nanjing, China) were used in this study. Signals were visualized with ImageQuant LAS 4000 (GE Healthcare Life Sciences).
Statistical analysis
The statistical analysis in our study was performed by using SPSS 22.0. Data were given as mean ± SEM. Two tailed t-test was used to determine between two groups. Statistical significance level was set at p < 0.05.
Discussion
Liver fibrosis is a scarring response to liver damage. It’s a common pathological process for most of the liver disorder. A small number of patients go on to progress cirrhosis and/or hepatocellular carcinoma. Fortunately, liver fibrosis can be reversed if the inflammation was controlled [
31].
Aberrant expression of miRNAs have been involved in liver fibrosis and regarded as a potential treatment strategy. Intervening miRNAs expression could assist activated HSCs to return to a quiescent phenotype. miRNA microarray and RT-PCR was carried out to determine abnormally expressed miRNAs during HSCs activation. Our results suggested that miR-338-3p was significantly downregulated in this process. miR-338 is located on chromosome 17q25.3 with a length of 22 nt and produces two mature forms, miR-338-3p and miR-338-5p. miR-338 was first reported in neurodegeneration and gradually studied in various disease [
32]. In hepatocellular carcinoma, miR-338 downregulation was associated with tumor size, TNM stage, vascular invasion and in trahepatic metastasis [
21,
22]. In colorectal carcinoma, miR-338 expression was significantly increased in both blood and tissue samples. It might appear to be a potential biomarker for early detection in colorectal carcinoma [
23]. In gastric carcinoma, miR-338 was epigenetically silenced and its reduction was related to pathological variables. Overexpression of miR-338 could suppress cell proliferation, migration, invasion and tumorigenicity [
24]. Moreover, combined with other six miRNAs, miR-338 could be used to predict gastric cancer prognosis [
33]. Despite in cancer, miR-338 was also involved in idiopathic pulmonary fibrosis [
34].
This is the first study to identify the biological function of miR-338-3p in liver fibrosis. Our results demonstrated that miR-338 precursor transfection suppressed the activation and proliferation of HSC-T6, whereas inhibition of miR-338-3p promoted cell activation and proliferation.
To understand the underlying mechanism of miR-338-mediated inhibition of proliferation, we identified
CDK4, a member of the cyclin-dependent kinase family
, as a candidate target gene.
CDK4 usually work with Cyclin D to regulate the cell cycle in G1/S stage. Aberrant activation of
CDK4 was closely associated with various kinds of carcinomas.
CDK4 expression is significantly upregulated in lung cancer tissues and function as an important element for cell proliferation [
35,
36]. In breast cancer, inhibition of
CDK4 can induce G1 arrest [
37]. These observations suggest that inhibition of
CDK4 might be beneficial for cancer treatment. An increasing body of clinical trials targeting
CDK4 has been launched. However, the role of
CDK4 in liver fibrosis remains largely unknown. In this study, Luciferase reporter assay showed that there was a combination of miR-338 and
CDK4. Hence, we deduced that miR-338-3p inhibited HSCs’ activation and proliferation likely through silencing CDK4. Our data indicated that restoring CDK4 expression could partially rescue miR-338-inhibited cell activation and proliferation.
Acknowledgment
We thank Tongji University School of Medicine for technical help.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.