Skip to main content
Erschienen in: Malaria Journal 1/2020

Open Access 01.12.2020 | Research

Molecular characterization of Plasmodium falciparum DNA-3-methyladenine glycosylase

verfasst von: Nattapon Pinthong, Paviga Limudomporn, Jitlada Vasuvat, Poom Adisakwattana, Pongruj Rattaprasert, Porntip Chavalitshewinkoon-Petmitr

Erschienen in: Malaria Journal | Ausgabe 1/2020

Abstract

Background

The emergence of artemisinin-resistant malaria parasites highlights the need for novel drugs and their targets. Alkylation of purine bases can hinder DNA replication and if unresolved would eventually result in cell death. DNA-3-methyladenine glycosylase (MAG) is responsible for the repair of those alkylated bases. Plasmodium falciparum (Pf) MAG was characterized for its potential for development as an anti-malarial candidate.

Methods

Native PfMAG from crude extract of chloroquine- and pyrimethamine-resistant P. falciparum K1 strain was partially purified using three chromatographic procedures. From bio-informatics analysis, primers were designed for amplification, insertion into pBAD202/D-TOPO and heterologous expression in Escherichia coli of recombinant PfMAG. Functional and biochemical properties of the recombinant enzyme were characterized.

Results

PfMAG activity was most prominent in parasite schizont stages, with a specific activity of 147 U/mg (partially purified) protein. K1 PfMAG contained an insertion of AAT (coding for asparagine) compared to 3D7 strain and 16% similarity to the human enzyme. Recombinant PfMAG (74 kDa) was twice as large as the human enzyme, preferred double-stranded DNA substrate, and demonstrated glycosylase activity over a pH range of 4–9, optimal salt concentration of 100–200 mM NaCl but reduced activity at 250 mM NaCl, no requirement for divalent cations, which were inhibitory in a dose-dependent manner.

Conclusion

PfMAG activity increased with parasite development being highest in the schizont stages. K1 PfMAG contained an indel AAT (asparagine) not present in 3D7 strain and the recombinant enzyme was twice as large as the human enzyme. Recombinant PfMAG had a wide range of optimal pH activity, and was inhibited at high (250 mM) NaCl concentration as well as by divalent cations. The properties of PfMAG provide basic data that should be of assistance in developing anti-malarials against this potential parasite target.
Hinweise

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12936-020-03355-w.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
6-FAM
6-Carboxyfluorescein
Asn
Asparagine
Glu
Glutamic acid
His
Histidine
kDa
Kilodalton
Met
Methionine
Try
Tyrosine
WHO
World Health Organization

Background

Malaria is one of the major infectious diseases threatening two-thirds of the world’s population, especially those living in tropical and sub-tropical regions, imposing both a disease and economic burden in these countries [1]. The World Health Organization (WHO) reported 228 million new cases of malaria in 2018, with 97% of the infection in sub-Saharan Africa caused by Plasmodium falciparum and resulting in 405,000 deaths, mainly of children [2].
Plasmodium falciparum causes most severity in terms of clinical pathology and complication in treatment as it readily develops resistance to all existing anti-malarial agents, including most recently the artemisinins [3, 4], highlighting the urgent need for identification of new parasite targets and development of safe and effective novel drugs targeting them. Although a malaria vaccine has recently become available, it only provides partial protection [5], and chemotherapeutic agents still play an essential role in malaria treatment and prevention.
Among the various parasite targets being studied for drug development, enzymes in P. falciparum DNA repair pathway present potential drugable targets, including P. falciparum uracil DNA glycosylase (PfUGD) [6], P. falciparum DNA polymerase delta (PfPolδ) [7] and P. falciparum ATP-dependent DNA helicase RuvB3 (PfRuvB3) [8]. The parasite genome lacks genes encoding DNA repair enzymes in the non-homologous end joining pathway, but previous identification of PfPolδ [7] suggests parasite base excision repair mechanism might rely mainly on a long patch repair pathway [9].
The high A–T content of the malaria parasite genome implies the potential of these regions being modified (alkylated), thereby the need of a parasite repair enzyme. DNA-3-methyladenine DNA glycosylase (MAG), a single sub-unit monofunctional DNA repair enzyme, belongs to an alkyladenine DNA glycosylase (AAG) superfamily, characterized by an antiparallel β-sheet and flanked by α-helices [10]. The enzyme is capable of removing 3-methyladenine (m3A) as well as other cyclic adducts in DNA, such as 1,N6ethenoadenine (εA), 3,N4-ethenocytosine (εC), N2,3-ethenoguaine (N2,3-εG), and l,N2-ethenoguanine (1,N2-εG) [11]. MAG orthologues are present in Escherichia coli, Saccharomyces cerevisiae, rodents, humans, and plants [12, 13]. It is also known as N-methylpurine DNA glycosylase (MPG) due to its versatility in accommodating a variety of substrates in the active site [14]. MAG knockdown in animal models and cell cultures results in a modulation of sensitivity to alkylating agents [15, 16]. In addition, 3-methyladenine and 1,N6-ethenoadenine are able to inhibit progression of DNA replication fork and thereby the DNA replication process [1719]. In P. falciparum, after decades of debate [2022] the existence of methylated cytosines (me5C) were finally identified in genomic DNA by the use of unbiased bisulfite conversion coupled with deep sequencing [23]. Recently, a hydroxymethylcytosine-like modification was identified at a higher extent compared with me5C and was linked to P. falciparum gene expression [24]. On the other hand, there is no available information to date with regards to purine methylation of the parasite. However, a gene encoding PfMAG was found located on chromosome 14 of chloroquine- and pyrimethamine-sensitive P. falciparum 3D7 strain comprising of 1506 nucleotides coding 501 amino acids (PlasmoDB: PF3D7_1467100).
Since MAG plays an important role in DNA repair and little is known regarding PfMAG, this provides an opportunity to study its properties as a potential target for anti-malarial drug development [25]. Here, native PfMAG was partially purified from parasite crude extract to verify its expression in asexual parasites, and recombinant PfMAG was heterologously produced to allow further characterization of biochemical and functional properties.

Methods

PfMAG activity determination of Plasmodium falciparum asexual stages

Plasmodium falciparum K1 strain, a chloroquine- and pyrimethamine-resistant strain isolated in Thailand [26], was cultivated in RPMI 1640 medium (Invitrogen™, CA, USA) supplemented with 10% human serum and human red blood cells (RBCs) at 37 °C using the candle jar method [27]. Media was changed daily and morphology and parasitaemia was observed under a light microscope (1,000× magnification) using Giemsa-stained thin blood film. Parasite culture was initiated with 2% parasitaemia of ring forms obtained from sorbitol synchronization [28]. Ring, trophozoite and schizont stages were separately harvested when parasitaemia reached 20–30%. Each parasite stage was prepared by incubating sedimented, infected RBCs with an equal volume of phosphate-buffered saline pH 7.6 (PBS) containing 0.15% (w/v) saponin at 37 °C for 20 min. Cell suspension was washed twice with PBS by centrifugation at 700×g at 25 °C for 10 min and parasite pellet was stored at − 80 °C until used.
Approximately 0.5 ml aliquot of each stage of parasite pellet was resuspended in 4 volumes of extraction buffer (50 mM Tris–HCl pH 7.6 containing 1 mM EDTA, 2 mM DTT, 0.01% NP40 and 1 mM PMSF) and cells were fragmented in a Dounce homogenizer. An equal volume of dilution buffer (50 mM Tris–HCl pH 7.6 containing 1 mM EDTA, 2 mM DTT, 20% (w/v) sucrose, 0.01% NP40 and 1 mM PMSF) was added to the sample and 3 M KCl was slowly added to the mixture to a final concentration of 0.5 M KCl while stirring on ice for 30 min. Then the sample was centrifuged at 100,000×g at 4°C for 45 min, supernatant dialysed at 4 °C overnight against buffer A (25 mM Tris–HCl pH 8.5 containing 1 mM EDTA, 1 mM PMSF, 1 mM DTT, 5% sucrose, 20% glycerol, and 0.01% NP40) and used for assay of PfMAG activity.

Partial purification of native PfMAG

Parasite culture for partial purification of native PfMAG was carried out using a large-scale culture method [29]. Plasmodium falciparum cultures, containing mostly trophozoite and schizont stages, were harvested at > 20% parasitaemia by centrifugation at 500×g for 10 min at 25 °C. Parasite pellet (2 ml) was resuspended in extraction buffer, homogenized and parasite extract prepared as described above.
Parasite extract was loaded onto a HiTrap Q column (GE Healthcare, USA) equilibrated with buffer A and column then was washed with 10 ml of buffer A and proteins were eluted using 10 ml of a 0–1 M KCl linear gradient in buffer A. Fractions of 250 μl were collected and 5 ml aliquot of each fraction was tested for glycosylase activity. Fractions containing PfMAG activity were pooled and dialyzed against buffer B (50 mM Tris pH 8.0 containing 1 mM PMSF, 2 mM DTT, 1 mM EDTA, 5% sucrose, 20% glycerol, and 0.01% NP40) overnight at 4 °C and then loaded onto HiTrap Capto S column (GE Healthcare) equilibrated with buffer B. The column was washed with buffer B and proteins were eluted with 15 ml of a 0–1 M KCl linear gradient in buffer B. Fractions of 250 μl were collected, assayed for PfMAG activity and pooled fractions dialyzed against buffer B, then loaded onto Hitrap Heparin column (GE Healthcare) equilibrated with buffer B. Column was washed with buffer B and proteins eluted with 10 ml of a 0–1 M KCl linear gradient in buffer B. Fractions containing PfMAG activity were pooled and termed native PfMAG.

PfMAG glycosylase assay

Fluorescent-labelled 27-mer oligonucleotide 5ʹ-[6FAM] CGATTAGCATCCTXCCTTCGTCGTCTCCAT-3ʹ (where X = εA) (Gene Link™; NY, USA) was annealed to its complementary strand 5ʹ-ATGGAGACGACGAAG GTAGGATGCTAATCG-3ʹ at 1:2 molar ratios in 100 μl reaction containing TE buffer (10 mM Tris–HCl pH 8 containing 1 mM EDTA,). The annealing process was carried out by heating at 95 °C for 5 min and cooling to ambient temperature over a period of 30 min, then the annealed substrate was stored at 4 °C until used.
PfMAG activity assay mixture (25 μl) containing 50 mM sodium phosphate pH 7, 1 mM EDTA, 1 mM DTT, 100 mM NaCl, 200 μg/ml BSA, 0.5 μM oligoduplex substrate and 1.5 mM of recombinant PfMAG was incubated at 37 °C for 30 min, then reaction terminated by 200 mM NaOH and heating at 95 °C for 5 min. The solution was mixed with an equal volume of loading buffer (98% formamide, 10 mM EDTA and xylene cyanol FF and bromophenol blue dyes) and resolved on 16% urea PAGE. The 27-mer and 13-mer products were visualized by VersaDoc 4000 MP (Biorad, USA) and quantified using an image-analysis software (Image Lab; Biorad, USA). Recombinant PfMAG activity was evaluated for substrate preference and optimal incubation time, pH, and salt and divalent cations concentrations. One U MAG activity is defined as the amount of PfMAG required to release 1 pmol of 1,N6ethenoadenine in 1 min at 37 °C.
In addition to double-stranded DNA as substrate, fluorescent-labelled, single-stranded 27-mer oligonucleotide was tested as DNA substrate of recombinant PfMAG compared to human DNA-3-methyladenine glycosylase (hAAG) (specificity of 5000 U/mg; Sigma-Aldrich, Germany). Enzyme incubation time varied from 10 to 90 min. Reactions were carried out as described above. PfMAG activity was tested in presence of 50 mM citrate-sodium citrate buffer pH 3–5, phosphate-citrate buffer pH 6–7 and Tris–HCl pH 8–9. PfMAG activity was determined in 50–500 mM NaCl under standard assay reaction described above, as well in the presence of Fe2+, Mg2+ and Zn2+ (0–3 mM) in the absence of EDTA. Relative activity of PfMAG was determined as amount of product divided by total amounts of substrate and product.

Expression analysis of PfMAG using SYBR Green quantitative (q)PCR

Total RNA was isolated from ring, growing trophozoite and schizont stages of P. falciparum using an Easy-Spin™ (DNA-free) and total RNA extraction kit (iNtRON Biotechnology, South Korea). Purity of RNA in eluted samples (50 µl) of was assessed using a NanoDrop™ spectrophotometer (Thermo Scientific, USA). Reverse transcription was carried out using a Maxime™ RT PreMix (Oligo (dT)15 Primer) kit (iNtRON Biotechnology, South Korea) in a reaction volume of 20 µl at 45 °C for 60 min. PCR primers were designed based on alignment of a P. falciparum fragment (NCBI Accession No. XM_001348777) (Table 1), with serine-tRNA ligase as an internal control gene [30]. All amplifications were performed using a LightCycler® FastStart DNA Master SYBR Green I (Roche Applied Science, Germany). The following thermocycling conditions were used: 10 min at 95 °C for initial denaturation and enzyme activation; 45 cycles of 95 °C for 10 s, 55 °C for 5 s and 72 °C for 10 s; followed by melting curve analysis of 65–95 °C. Melting temperature of PfMAG and serine-tRNA ligase cDNA was 72.9 and 74.5 °C, respectively. Relative quantification of PfMAG expression employed a 2−∆∆Ct method [31]. Three independent experiments were performed in duplicate for each parasite sample.
Table 1
Primers used in expression analysis of PfMAG using SYBR Green quantitative PCR
Primer name
Sequence
Reference
PfMAGexpressF
GGAACCAACAAGGGAACATATCA
In house
PfMAGexpressR
TTGTTACACATCCAGGACCACT
In house
s-tRNA syn F
AAGTAGCAGGTCATCGTGGTT
[30]
s-tRNA syn R
TTCGGCACATTCTTCCATAA
[30]

PCR amplification of PfMAG

DNA of P. falciparum strain K1 was extracted using QIAamp DNA Blood Mini Kit (Qiagen, USA). PfMAG was amplified using forward primer 5ʹ-CACCATGGAA AAAATGAACGAATTC-3ʹ designed from the start codon and incorporating a specific sequence at 5ʹ end (CACC) for unidirectional cloning and reverse primer 5ʹ-TTTGGG AAAAATAGATACGGATGG-3ʹ designed for full-length gene amplification; primers design used P. falciparum strain 3D7 as template (NCBI accession no. XM_001348777). Amplification was performed (using Phusion™ High—Fidelity PCR Kit; Finzyme OY, Finland) as follows: 98 °C for 5 min; 35 cycles of 98 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s; with a final heating at 72 °C for 3 min.

Cloning, heterologous expression and purification of recombinant PfMAG

Amplified full-length PfMAG was ligated into expression vector pBAD202/D-TOPO (Invitrogen, USA). The constructed recombinant plasmid was verified by DNA sequencing and compared to its known P. falciparum 3D7 counterpart. Escherichia coli LMG 194 harbouring recombinant pBAD-PfMAG was grown in LB media containing 50 µg/ml kanamycin sulfate at 37 °C, with shaking at 200 rpm for 2 h. When A600nm of the culture reached 0.4, incubation temperature was reduced to 15 °C and shaking was continued for a further 1 h. L-arabinose (0.02% w/v) was then added to induce recombinant protein expression and the culture was shaken for 16 h. Following sedimentation, bacterial pellet was suspended in lysis buffer (50 mM NaH2PO4 pH 8.0 containing 300 mM NaCl and 10 mM imidazole) and lysed by sonication on ice for 10 min. Then the sample was centrifuged at 10,000×g at 4 °C for 30 min, supernatant added to an equal volume of lysis buffer and loaded onto a HisTrap HP column (GE Healthcare) pre-equilibrated with lysis buffer. The column was washed with washing buffer (50 mM NaH2PO4 pH 8.0 containing 300 mM NaCl and 50 mM imidazole) and protein eluted with a linear 10–500 mM imidazole gradient. Fractions (250 μl) with enzyme activity were pooled and subjected to 12% SDS-PAGE, staining with Coomassie blue R250 and western blotting. The latter employed mouse anti-His primary antibody (Invitrogen, USA) (1:3000 dilution) and rabbit HRP-conjugated anti-mouse IgG antibody (1:5000 dilution). Immunoreactive protein band was visualized by treatment with a mixture of hydrogen peroxide and 3,3′-diaminobenzidine tetrahydrochloride (DAB).

3D structure prediction of PfMAG

In view of a lack of 3D structural models of PfMAG, a predicted structure was constructed using the 502-amino acid sequence of PfMAG K1 as input for simulation of PfMAG by a protein threading method using I-TASSER server [3234] and a Pymol software to align PfMAG and superimpose on human AAG structure.

Results

Partial purification of native PfMAG

Native PfMAG activity was monitored according to P. falciparum developmental stages. Relative to hAAG, native PfMAG activity was 3.1, 10.8 and 12.3% in ring, trophozoite and schizont stage, respectively. Crude extract of P. falciparum trophozoite and schizont stages from synchronized culture were subjected to purification of PfMAG employing sequential anion exchange, cation exchange and heparin affinity chromatography. The results of the partial purification of PfMAG are summarized in Table 2 and its purification profile was demonstrated in Fig. 1. Ultimately a partially purified enzyme was eluted Hitrap Heparin affinity column employing a linear 0.3–0.6 M KCl gradient (Fig. 1). Two milliliter of parasite pellet yielded 140 μg of 38-fold purified PfMAG, specific activity of 147 U/mg protein. These results indicated existence of a functionally active PfMAG that increased with parasite development.
Table 2
Partial purification of native MAG from crude extract of Plasmodium falciparum K1 strain
Fraction
Total activity (U)
Total protein (mg)
Specific activity (U/mg)
Yield (%)
Purification fold
Crude extract
41.6
10.6
3.9
100
HiTrap Capto Q (unbound)
25.4
3.7
6.8
61.0
1.7
HiTrap Capto S
26.0
0.3
96.2
62.4
24.6
HiTrap Heparin
20.6
0.1
147.4
49.6
37.7

Expression of PfMAG during asexual stage development

SYBR Green qPCR indicated PfMAG mean expression level of trophozoite and schizont stage was 0.5 and 3.2-fold(s) of ring form, respectively (Fig. 2), in keeping with relative enzyme activity being highest in schizonts. It was of interest to note the lack of significant difference in PfMAG expression level between ring and trophozoite.

Analysis of PfMAG nucleotide sequence

The 1506-bp amplicon of K1 PfMAG (Fig. 3a) showed 99% identity with that of P. falciparum chloroquine-sensitive strain 3D7 strain (NCBI reference sequence XP_001348813.1) due to the presence of 3-nucleotide (AAT) sequence between nt 25 and 29 (Additional file 1: Figure S1), corresponding to an insertion of asparagine (N) at position 9 of the 502-amino acid recombinant enzyme (Additional file 1: Figure S2) but the insertion is not at the active site (Additional file 1: Figure S3), which is conserved among many organisms, including Plasmodium spp. The predicted molecular mass of PfMAG is 59.3 kDa with a pI of 9.07. There is only 16% amino acid sequence similarity of PfMAG compared to that of human enzyme. In addition, the predicted amino acid sequence of K1 PfMAG was much different from those of MAGs in other organisms including Plasmodium spp. (~ 40%) (Table 3).
Table 3
Amino acid sequence similarity of MAG from Plasmodium falciparum K1 strain compared to MAGs from other organisms
Organism
Similarity (%)
NCBI protein reference sequence accession number
P. falciparum 3D7
99
XP_001348813.1
P. berghei
45
XP_679046.1
P. chabaudi
44
XP_740495.2
P. knowlesi
41
XP_002260194.1
P. vivax
40
EDL45990.1
Mus musculus
18
NP_034952.2
Arabidopsis thaliana
17
NP_187811.1
Homo sapiens
16
XP_024306050.1
Helicobacter pylori
15
EMJ39070.1
Escherichia coli
7
WP_020233157.1
Saccharomyces cerevisiae
6
P22134.1

Simulated 3D structure of PfMAG

In view of a lack of an X-ray crystal structure of PfMAG, a simulated 3D structure was constructed based on alignment with that of hAAG (PDB 1F6O) at 41% coverage with RMSD of 2.13 Å (Fig. 4). PfMAG (putatively) contained 20 α-helixes, 11 β-sheets and 31 loops compared to its human orthologue with 14 α-helixes, 8 β-sheets and 22 loops. As expected, the additional N residue is located in a coil region not involved in substrate binding.

Characterization of recombinant PfMAG

The affinity-purified recombinant PfMAG had a molecular mass of 74 kDa (Fig. 3b). Western blotting revealed several faint immunoreactive bands of truncated/degraded proteins (~ 55-kDa) accounting for about 15% of total purified protein (Fig. 3c). Specific activity of the affinity-purified recombinant PfMAG was 1309 U/mg. Recombinant PfMAG acted on double-stranded DNA substrate similar to hAAG control (Fig. 5) and converted a 27-mer double-stranded DNA substrate containing εA into a 13-mer product (90% yield) after for 30 min. PfMAG activity on single-stranded substrate was not as clearly demonstrated as with hAAG.
Recombinant PfMAG had activity over a wide pH range (4–9) (Fig. 6a) but activity was significantly reduced at pH 3, with optimal activity between pH 6 and 7 in a phosphate-citrate buffer. The enzyme had 45.5% relative activity at low-salt concentrations (0–50 mM) and 38.9% at 500 mM compared to optimal concentration of 100–200 mM NaCl that generated 86.3% of product (Fig. 6b). There was no requirement of any divalent cations (Fe2+, Mg2+ or Zn2) for PfMAG activity (Fig. 6c); MgCl2 did not affect glycosylase activity up to 3 mM, but iron and zinc sulfate inhibited enzyme activity at 500 μM.

Discussion

Cellular DNA is constantly damaged by a variety of endogenous metabolites [35]. MAG, a DNA repair enzyme, has multiple substrate specificities, such as methylpurines, ethenopurines and hypoxanthine [3638]. The enzyme can initiate both short- and long-patch base excision in an alkylated base repair process [39] by intercalating a tyrosine residue between two bases in the DNA strand with subsequent hydrolysis of the N-glycosylic bond [40]. Owing to the 80% A–T content of P. falciparum whole genome, high numbers of unrepaired alkylated adenine bases constitute a threat to parasite growth and development.
Highest Pf MAG activity was found in schizont stages, which correlated with gene expression, but this association was not observed between ring and trophozoite stages. There are reports indicating a large proportion of parasite transcriptional activity, measured during intra-erythrocytic development cycle, does not correlate with protein abundance [41, 42], as observed in mammalian cells where, often time, initiation of translation and not transcript abundance is the main determinant of protein levels [43]. In Arabidopsis thaliana, expression of DNA-3-methyladenine glycosylase is also rapidly elevated in dividing tissues and correlates with DNA replication [44]. The human N-methylpurine DNA glycosylase (MPG) orthologue is overexpressed in several types of cancers [45].
Low yield from purification of native PfMAG precluded any further characterization of the parasite enzyme other than determination of molecular mass and purity. As in many other studies of malaria parasite enzymes, heterologous expression and affinity purification of recombinant proteins is the recourse in lieu of labour-intensive, large-scale parasite cultivation. The presence of small protein fragments from Escherichia coli-expression suggests use of a eukaryote expression host might improve yield and quality of the recombinant protein.
Surprisingly, K1 PfMAG contains an extra asparagine residue at codon 9 compared to 3D7 PfMAG, but based on sequence location and that from a simulated 3D structure, this indel mutation does not appear to affect enzyme activity. Interestingly, PfMAG is nearly twofold larger than of hAAG [46]. The simulated 3D structure of the parasite enzyme shows the extended region consisting of 8 α-helices, 3 β-sheets and 11 loops located at the C-terminus of the parasite protein, and this additional sequence does not bear homology with any other orthologues.
Unlike hAAG, PfMAG was less capable of acting on single-stranded DNA substrate. HAAG is able to excise εA from single-stranded DNA albeit at low efficiency [38], suggesting the possible role of other parasite glycosylase(s) in the repair of these frequent lesions in single-stranded DNA transiently generated during replication and transcription. For instance, in Escherichia coli, 3-methyladenine glycosylase has been shown to remove 3-methyladenine from single-stranded DNA [47], and bovine uracil DNA glycosylase [48] and human single-strand selective monofunctional uracil DNA glycosylase [49] also excises uracil from single-stranded DNA substrate.
Recombinant PfMAG functioned over a wide range of pH compared to human and Saccharomyces pombe orthologues that show an extremely narrow range of optimal pH (7.5–7.6) [50, 51]. However, PfMAG demonstrated optimal activity in salt concentrations comparable to other MAG orthologues, e.g., 100 mM NaCl and KCl for human and S. pombe enzyme, respectively [50, 51], but higher concentrations (250–500 mM) inhibited activity in a dose dependent manner for all three enzymes. The roles of high-salt concentration in inhibiting glycolytic activity are variously attributed to high ionic strength, conformational changes affecting stability and/or solubility and binding of anions to catalytic site [52, 53].
Similar to other DNA glycosylases, PfMAG did not require Mg2+ or any other cofactor for damage recognition and/or excision in the assay reaction [54]. PfMAG was not affected by MgCl2 even up to 3 mM, which was different from a previous study where MgCl2 is able to stimulate and inhibit enzyme activity in a biphasic manner, the latter effect attributed to interference with substrate binding [55]. On the other hand, Fe2+ and Zn2+ were inhibitory at micromolar concentrations (Fig. 6c), with previous observation that human N-methylpurine-DNA glycosylase contains an amino acid residue at the active site with a potential to bind Zn2+, thereby interfering with the catalytic process [56].

Conclusion

Highest levels of PfMAG activity and its gene expression were demonstrated in schizont compared to ring and trophozoite stages. Recombinant PfMAG preferentially acted on double- rather than single-strand DNA, and had a molecular mass twice that of the human enzyme, a broad pH range of activity, optimal activity at 100 mM NaCl, but higher concentrations were inhibitory, and no requirement for Mg2+ cofactor but Fe2+ and Zn2+ were inhibitory in micromolar range. Exploiting characteristics different from those of the human enzyme should provide insights into identifying compounds specifically targeting PfMAG, which could be developed into a potential novel anti-malarial.

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12936-020-03355-w.

Acknowledgements

The authors thank Ms. Kanthinit Thima, Department of Protozoology, Faculty of Tropical Medicine, Mahidol University for assistance in parasite culture.
Not applicable.
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Sachs J, Malaney P. The economic and social burden of malaria. Nature. 2002;415:680–5.PubMed Sachs J, Malaney P. The economic and social burden of malaria. Nature. 2002;415:680–5.PubMed
3.
Zurück zum Zitat Noedl H, Se Y, Schaecher K, Smith BL, Socheat D, Fukuda MM, et al. Evidence of artemisinin-resistant malaria in western Cambodia. N Engl J Med. 2008;359:2619–20.PubMed Noedl H, Se Y, Schaecher K, Smith BL, Socheat D, Fukuda MM, et al. Evidence of artemisinin-resistant malaria in western Cambodia. N Engl J Med. 2008;359:2619–20.PubMed
4.
Zurück zum Zitat Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, et al. Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2009;361:455–67.PubMedPubMedCentral Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, et al. Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2009;361:455–67.PubMedPubMedCentral
5.
Zurück zum Zitat The RTS,S clinical trials partnership. A phase 3 trial of RTS, S/AS01 malaria vaccine in African infants. N Engl J Med. 2012;367:2284–95. The RTS,S clinical trials partnership. A phase 3 trial of RTS, S/AS01 malaria vaccine in African infants. N Engl J Med. 2012;367:2284–95.
6.
Zurück zum Zitat Suksangpleng T, Leartsakulpanich U, Moonsom S, Siribal S, Boonyuen U, Wright GE, et al. Molecular characterization of Plasmodium falciparum uracil-DNA glycosylase and its potential as a new anti-malarial drug target. Malar J. 2014;13:149.PubMedPubMedCentral Suksangpleng T, Leartsakulpanich U, Moonsom S, Siribal S, Boonyuen U, Wright GE, et al. Molecular characterization of Plasmodium falciparum uracil-DNA glycosylase and its potential as a new anti-malarial drug target. Malar J. 2014;13:149.PubMedPubMedCentral
7.
Zurück zum Zitat Vasuvat J, Montree A, Moonsom S, Leartsakulpanich U, Petmitr S, Focher F, et al. Biochemical and functional characterization of Plasmodium falciparum DNA polymerase δ. Malar J. 2016;15:116.PubMedPubMedCentral Vasuvat J, Montree A, Moonsom S, Leartsakulpanich U, Petmitr S, Focher F, et al. Biochemical and functional characterization of Plasmodium falciparum DNA polymerase δ. Malar J. 2016;15:116.PubMedPubMedCentral
8.
Zurück zum Zitat Limudomporn P, Moonsom S, Leartsakulpanich U, Suntornthiticharoen P, Petmitr S, Weinfeld M, et al. Characterization of Plasmodium falciparum ATP-dependent DNA helicase RuvB3. Malar J. 2016;15:526.PubMedPubMedCentral Limudomporn P, Moonsom S, Leartsakulpanich U, Suntornthiticharoen P, Petmitr S, Weinfeld M, et al. Characterization of Plasmodium falciparum ATP-dependent DNA helicase RuvB3. Malar J. 2016;15:526.PubMedPubMedCentral
9.
Zurück zum Zitat Haltiwanger BM, Matsumoto Y, Nicolas E, Dianov GL, Bohr VA, Taraschi TF. DNA base excision repair in human malaria parasites is predominantly by a long-patch pathway. Biochemistry. 2000;39:763–72.PubMed Haltiwanger BM, Matsumoto Y, Nicolas E, Dianov GL, Bohr VA, Taraschi TF. DNA base excision repair in human malaria parasites is predominantly by a long-patch pathway. Biochemistry. 2000;39:763–72.PubMed
10.
Zurück zum Zitat Lau AY, Schärer OD, Samson L, Verdine GL, Ellenberger T. Crystal structure of a human alkylbase-DNA repair enzyme complexed to DNA: mechanisms for nucleotide flipping and base excision. Cell. 1998;95:249–58.PubMed Lau AY, Schärer OD, Samson L, Verdine GL, Ellenberger T. Crystal structure of a human alkylbase-DNA repair enzyme complexed to DNA: mechanisms for nucleotide flipping and base excision. Cell. 1998;95:249–58.PubMed
11.
Zurück zum Zitat Dosanjh MK, Chenna A, Kim E, Fraenkel-Conrat H, Samson L, Singer B. All four known cyclic adducts formed in DNA by the vinyl chloride metabolite chloroacetaldehyde are released by a human DNA glycosylase. Proc Natl Acad Sci USA. 1994;91:1024–8.PubMedPubMedCentral Dosanjh MK, Chenna A, Kim E, Fraenkel-Conrat H, Samson L, Singer B. All four known cyclic adducts formed in DNA by the vinyl chloride metabolite chloroacetaldehyde are released by a human DNA glycosylase. Proc Natl Acad Sci USA. 1994;91:1024–8.PubMedPubMedCentral
12.
Zurück zum Zitat Saparbaev M, Kleibl K, Laval J. Escherichia coli, Saccharomyces cerevisiae, rat and human 3-methyladenine DNA glycosylases repair 1, N6-ethenoadenine when present in DNA. Nucleic Acids Res. 1995;23:3750–5.PubMedPubMedCentral Saparbaev M, Kleibl K, Laval J. Escherichia coli, Saccharomyces cerevisiae, rat and human 3-methyladenine DNA glycosylases repair 1, N6-ethenoadenine when present in DNA. Nucleic Acids Res. 1995;23:3750–5.PubMedPubMedCentral
13.
Zurück zum Zitat Santerre A, Britt AB. Cloning of a 3-methyladenine-DNA glycosylase from Arabidopsis thaliana. Proc Natl Acad Sci USA. 1994;91:2240–4.PubMedPubMedCentral Santerre A, Britt AB. Cloning of a 3-methyladenine-DNA glycosylase from Arabidopsis thaliana. Proc Natl Acad Sci USA. 1994;91:2240–4.PubMedPubMedCentral
14.
Zurück zum Zitat Wyatt MD, Allan JM, Lau AY, Ellenberger TE, Samson LD. 3-methyladenine DNA glycosylases: structure, function, and biological importance. Bioassays. 1999;21:668–76. Wyatt MD, Allan JM, Lau AY, Ellenberger TE, Samson LD. 3-methyladenine DNA glycosylases: structure, function, and biological importance. Bioassays. 1999;21:668–76.
15.
Zurück zum Zitat Engelward BP, Dreslin A, Christensen J, Huszar D, Kurahara C, Samson L. Repair-deficient 3-methyladenine DNA glycosylase homozygous mutant mouse cells have increased sensitivity to alkylation-induced chromosome damage and cell killing. EMBO J. 1996;15:945–52.PubMedPubMedCentral Engelward BP, Dreslin A, Christensen J, Huszar D, Kurahara C, Samson L. Repair-deficient 3-methyladenine DNA glycosylase homozygous mutant mouse cells have increased sensitivity to alkylation-induced chromosome damage and cell killing. EMBO J. 1996;15:945–52.PubMedPubMedCentral
16.
Zurück zum Zitat Paik J, Duncan T, Lindahl T, Sedgwick B. Sensitization of human carcinoma cells to alkylating agents by small interfering RNA suppression of 3-alkyladenine-DNA glycosylase. Cancer Res. 2005;65:10472–7.PubMed Paik J, Duncan T, Lindahl T, Sedgwick B. Sensitization of human carcinoma cells to alkylating agents by small interfering RNA suppression of 3-alkyladenine-DNA glycosylase. Cancer Res. 2005;65:10472–7.PubMed
17.
Zurück zum Zitat Racine JF, Zhu Y, Mamet-Bratley MD. Mechanism of toxicity of 3-methyladenine for bacteriophage T7. Mutat Res. 1993;294:285–98.PubMed Racine JF, Zhu Y, Mamet-Bratley MD. Mechanism of toxicity of 3-methyladenine for bacteriophage T7. Mutat Res. 1993;294:285–98.PubMed
18.
Zurück zum Zitat Tolentino JH, Burke TJ, Mukhopadhyay S, McGregor WG, Basu AK. Inhibition of DNA replication fork progression and mutagenic potential of 1, N6-ethenoadenine and 8-oxoguanine in human cell extracts. Nucleic Acids Res. 2008;36:1300–8.PubMedPubMedCentral Tolentino JH, Burke TJ, Mukhopadhyay S, McGregor WG, Basu AK. Inhibition of DNA replication fork progression and mutagenic potential of 1, N6-ethenoadenine and 8-oxoguanine in human cell extracts. Nucleic Acids Res. 2008;36:1300–8.PubMedPubMedCentral
19.
Zurück zum Zitat Boiteux S, Laval J. Imidazole open ring 7-methylguanine: an inhibitor of DNA synthesis. Biochem Biophys Res Commun. 1983;110:552–8.PubMed Boiteux S, Laval J. Imidazole open ring 7-methylguanine: an inhibitor of DNA synthesis. Biochem Biophys Res Commun. 1983;110:552–8.PubMed
20.
Zurück zum Zitat Pollack Y, Katzen AL, Spira DT, Golenser J. The genome of Plasmodium falciparum. I: DNA base composition. Nucleic Acids Res. 1982;10:539–46.PubMedPubMedCentral Pollack Y, Katzen AL, Spira DT, Golenser J. The genome of Plasmodium falciparum. I: DNA base composition. Nucleic Acids Res. 1982;10:539–46.PubMedPubMedCentral
21.
Zurück zum Zitat Pollack Y, Kogan N, Golenser J. Plasmodium falciparum: evidence for a DNAmethylation pattern. Exp Parasitol. 1991;72:339–44.PubMed Pollack Y, Kogan N, Golenser J. Plasmodium falciparum: evidence for a DNAmethylation pattern. Exp Parasitol. 1991;72:339–44.PubMed
22.
Zurück zum Zitat Choi SW, Keyes MK, Horrocks P. LC/ESI-MS demonstrates the absence of 5-methyl-2′-deoxycytosine in Plasmodium falciparum genomic DNA. Mol Biochem Parasitol. 2006;150:350–2.PubMed Choi SW, Keyes MK, Horrocks P. LC/ESI-MS demonstrates the absence of 5-methyl-2′-deoxycytosine in Plasmodium falciparum genomic DNA. Mol Biochem Parasitol. 2006;150:350–2.PubMed
23.
Zurück zum Zitat Hammam E, Ananda G, Sinha A, Scheidig-Benatar C, Bohec M, Preiser PR, et al. Discovery of a new predominant cytosine DNA modification that is linked to gene expression in malaria parasites. Nucleic Acids Res. 2020;48:184–99.PubMed Hammam E, Ananda G, Sinha A, Scheidig-Benatar C, Bohec M, Preiser PR, et al. Discovery of a new predominant cytosine DNA modification that is linked to gene expression in malaria parasites. Nucleic Acids Res. 2020;48:184–99.PubMed
24.
Zurück zum Zitat Ponts N, Fu L, Harris EY, Zhang J, Chung DW, Cervantes MC, et al. Genome-wide mapping of DNA methylation in the human malaria parasite Plasmodium falciparum. Cell Host Microbe. 2013;14:696–706.PubMedPubMedCentral Ponts N, Fu L, Harris EY, Zhang J, Chung DW, Cervantes MC, et al. Genome-wide mapping of DNA methylation in the human malaria parasite Plasmodium falciparum. Cell Host Microbe. 2013;14:696–706.PubMedPubMedCentral
25.
Zurück zum Zitat Yanow SK, Purcell LA, Lee M, Spithill TW. Genomics-based drug design targets the AT-rich malaria parasite: implications for antiparasite chemotherapy. Pharmacogenomics. 2007;8:1267–72.PubMed Yanow SK, Purcell LA, Lee M, Spithill TW. Genomics-based drug design targets the AT-rich malaria parasite: implications for antiparasite chemotherapy. Pharmacogenomics. 2007;8:1267–72.PubMed
26.
Zurück zum Zitat Thaithong S, Beale GH, Chutmongkonkul M. Susceptibility of Plasmodium falciparum to five drugs: an in vitro study of isolates mainly from Thailand. Trans R Soc Trop Med Hyg. 1983;77:228–31.PubMed Thaithong S, Beale GH, Chutmongkonkul M. Susceptibility of Plasmodium falciparum to five drugs: an in vitro study of isolates mainly from Thailand. Trans R Soc Trop Med Hyg. 1983;77:228–31.PubMed
27.
Zurück zum Zitat Trager W, Jensen JB. Human malaria parasites in continuous culture. Science. 1976;193:673–5.PubMed Trager W, Jensen JB. Human malaria parasites in continuous culture. Science. 1976;193:673–5.PubMed
28.
Zurück zum Zitat Lambros C, Vanderberg JP. Synchronization of Plasmodium falciparum erythrocytic stages in culture. J Parasitol. 1979;65:418–20.PubMed Lambros C, Vanderberg JP. Synchronization of Plasmodium falciparum erythrocytic stages in culture. J Parasitol. 1979;65:418–20.PubMed
29.
Zurück zum Zitat Chavalitshewinkoon P, Wilairat P. A simple technique for large scale in vitro culture of Plasmodium falciparum. Southeast Asian J Trop Med Public Health. 1991;22:544–7.PubMed Chavalitshewinkoon P, Wilairat P. A simple technique for large scale in vitro culture of Plasmodium falciparum. Southeast Asian J Trop Med Public Health. 1991;22:544–7.PubMed
30.
Zurück zum Zitat Baker J, Gatton ML, Peters J, Ho MF, McCarthy JS, Cheng Q. Transcription and expression of Plasmodium falciparum histidine-rich proteins in different stages and strains: implications for rapid diagnostic tests. PLoS ONE. 2011;6:e22593.PubMedPubMedCentral Baker J, Gatton ML, Peters J, Ho MF, McCarthy JS, Cheng Q. Transcription and expression of Plasmodium falciparum histidine-rich proteins in different stages and strains: implications for rapid diagnostic tests. PLoS ONE. 2011;6:e22593.PubMedPubMedCentral
31.
Zurück zum Zitat Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆Ct method. Methods. 2001;25:402–8.PubMed Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆Ct method. Methods. 2001;25:402–8.PubMed
32.
Zurück zum Zitat Zhang Y. I-TASSER server for protein 3D structure prediction. BMC Bioinform. 2008;9:40. Zhang Y. I-TASSER server for protein 3D structure prediction. BMC Bioinform. 2008;9:40.
33.
Zurück zum Zitat Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc. 2010;5:725–38.PubMedPubMedCentral Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc. 2010;5:725–38.PubMedPubMedCentral
34.
Zurück zum Zitat Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The I-TASSER Suite: protein structure and function prediction. Nat Methods. 2015;12:7–8.PubMedPubMedCentral Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The I-TASSER Suite: protein structure and function prediction. Nat Methods. 2015;12:7–8.PubMedPubMedCentral
35.
Zurück zum Zitat Rydberg B, Lindahl T. Nonenzymatic methylation of DNA by the intracellular methyl group donor S-adenosyl-l-methionine is a potentially mutagenic reaction. EMBO J. 1982;1:211–6.PubMedPubMedCentral Rydberg B, Lindahl T. Nonenzymatic methylation of DNA by the intracellular methyl group donor S-adenosyl-l-methionine is a potentially mutagenic reaction. EMBO J. 1982;1:211–6.PubMedPubMedCentral
36.
Zurück zum Zitat Asaeda A, Ide H, Asagoshi K, Matsuyama S, Tano K, Murakami A, et al. Substrate specificity of human methylpurine DNA N-glycosylase. Biochemistry. 2000;39:1959–65.PubMed Asaeda A, Ide H, Asagoshi K, Matsuyama S, Tano K, Murakami A, et al. Substrate specificity of human methylpurine DNA N-glycosylase. Biochemistry. 2000;39:1959–65.PubMed
37.
Zurück zum Zitat Singer B, Antoccia A, Basu AK, Dosanjh MK, Fraenkel-Conrat H, Gallagher PE, et al. Both purified human 1, N6-ethenoadenine-binding protein and purified human 3-methyladenine-DNA glycosylase act on 1, N6-ethenoadenine and 3-methyladenine. Proc Natl Acad Sci USA. 1992;89:9386–90.PubMedPubMedCentral Singer B, Antoccia A, Basu AK, Dosanjh MK, Fraenkel-Conrat H, Gallagher PE, et al. Both purified human 1, N6-ethenoadenine-binding protein and purified human 3-methyladenine-DNA glycosylase act on 1, N6-ethenoadenine and 3-methyladenine. Proc Natl Acad Sci USA. 1992;89:9386–90.PubMedPubMedCentral
38.
Zurück zum Zitat Lee CYI, Delaney JC, Kartalou M, Lingaraju GM, Maor-Shoshani A, Essigmann JM, et al. Recognition and processing of a new repertoire of DNA substrates by human 3-methyladenine DNA glycosylase (AAG). Biochemistry. 2009;48:1850–61.PubMed Lee CYI, Delaney JC, Kartalou M, Lingaraju GM, Maor-Shoshani A, Essigmann JM, et al. Recognition and processing of a new repertoire of DNA substrates by human 3-methyladenine DNA glycosylase (AAG). Biochemistry. 2009;48:1850–61.PubMed
39.
Zurück zum Zitat Alseth I, Osman F, Korvald H, Tsaneva I, Whitby MC, Seeberg E, et al. Biochemical characterization and DNA repair pathway interactions of Mag1-mediated base excision repair in Schizosaccharomyces pombe. Nucleic Acids Res. 2005;33:1123–31.PubMedPubMedCentral Alseth I, Osman F, Korvald H, Tsaneva I, Whitby MC, Seeberg E, et al. Biochemical characterization and DNA repair pathway interactions of Mag1-mediated base excision repair in Schizosaccharomyces pombe. Nucleic Acids Res. 2005;33:1123–31.PubMedPubMedCentral
40.
Zurück zum Zitat Lau AY, Wyatt MD, Glassner BJ, Samson LD, Ellenberger T. Molecular basis for discriminating between normal and damaged bases by the human alkyladenine glycosylase, AAG. Proc Natl Acad Sci USA. 2000;97:13573–8.PubMedPubMedCentral Lau AY, Wyatt MD, Glassner BJ, Samson LD, Ellenberger T. Molecular basis for discriminating between normal and damaged bases by the human alkyladenine glycosylase, AAG. Proc Natl Acad Sci USA. 2000;97:13573–8.PubMedPubMedCentral
41.
Zurück zum Zitat Foth BJ, Zhang N, Mok S, Preiser PR, Bozdech Z. Quantitative protein expression profiling reveals extensive post-transcriptional regulation and post-translational modifications in schizont-stage malaria parasites. Genome Biol. 2008;9:R177.PubMedPubMedCentral Foth BJ, Zhang N, Mok S, Preiser PR, Bozdech Z. Quantitative protein expression profiling reveals extensive post-transcriptional regulation and post-translational modifications in schizont-stage malaria parasites. Genome Biol. 2008;9:R177.PubMedPubMedCentral
42.
Zurück zum Zitat Le Roch KG, Johnson JR, Florens L, Zhou Y, Santrosyan A, Grainger M, et al. Global analysis of transcript and protein levels across the Plasmodium falciparum life cycle. Genome Res. 2004;14:2308–18.PubMedPubMedCentral Le Roch KG, Johnson JR, Florens L, Zhou Y, Santrosyan A, Grainger M, et al. Global analysis of transcript and protein levels across the Plasmodium falciparum life cycle. Genome Res. 2004;14:2308–18.PubMedPubMedCentral
43.
Zurück zum Zitat Schwanhausser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, et al. Global quantification of mammalian gene expression control. Nature. 2011;473:337–42.PubMed Schwanhausser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, et al. Global quantification of mammalian gene expression control. Nature. 2011;473:337–42.PubMed
44.
Zurück zum Zitat Shi L, Kent R, Bence N, Britt AB. Developmental expression of a DNA repair gene in Arabidopsis. Mutat Res. 1997;384:145–56.PubMed Shi L, Kent R, Bence N, Britt AB. Developmental expression of a DNA repair gene in Arabidopsis. Mutat Res. 1997;384:145–56.PubMed
45.
Zurück zum Zitat Song S, Xing G, Yuan L, Wang J, Wang S, Yin Y, et al. N-methylpurine DNA glycosylase inhibits p53 mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents. Cell Res. 2012;22:1285–303.PubMedPubMedCentral Song S, Xing G, Yuan L, Wang J, Wang S, Yin Y, et al. N-methylpurine DNA glycosylase inhibits p53 mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents. Cell Res. 2012;22:1285–303.PubMedPubMedCentral
46.
Zurück zum Zitat Samson L, Derfler B, Boosalis M, Call K. Genetics Cloning and characterization of a 3-methyladenine DNA glycosylase cDNA from human cells whose gene maps to chromosome 16. Proc Natl Acad Sci USA. 1991;88:9127–31.PubMedPubMedCentral Samson L, Derfler B, Boosalis M, Call K. Genetics Cloning and characterization of a 3-methyladenine DNA glycosylase cDNA from human cells whose gene maps to chromosome 16. Proc Natl Acad Sci USA. 1991;88:9127–31.PubMedPubMedCentral
47.
Zurück zum Zitat Bjelland S, Seeberg E. Different efficiencies of the Tag and AlkA DNA glycosylases from Escherichia coli in the removal of 3-methyladenine from single-stranded DNA. FEBS Lett. 1996;397:127–9.PubMed Bjelland S, Seeberg E. Different efficiencies of the Tag and AlkA DNA glycosylases from Escherichia coli in the removal of 3-methyladenine from single-stranded DNA. FEBS Lett. 1996;397:127–9.PubMed
48.
Zurück zum Zitat Eftedal I, Guddal PH, Slupphaug G, Volden G, Krokan HE. Consensus sequences for good and poor removal of uracil from double stranded DNA by uracil-DNA glycosylase. Nucleic Acids Res. 1993;21:2095–101.PubMedPubMedCentral Eftedal I, Guddal PH, Slupphaug G, Volden G, Krokan HE. Consensus sequences for good and poor removal of uracil from double stranded DNA by uracil-DNA glycosylase. Nucleic Acids Res. 1993;21:2095–101.PubMedPubMedCentral
49.
Zurück zum Zitat Haushalter KA, Todd Stukenberg MW, Kirschner MW, Verdine GL. Identification of a new uracilDNA glycosylase family by expression cloning using synthetic inhibitors. Curr Biol. 1999;9:174–85.PubMed Haushalter KA, Todd Stukenberg MW, Kirschner MW, Verdine GL. Identification of a new uracilDNA glycosylase family by expression cloning using synthetic inhibitors. Curr Biol. 1999;9:174–85.PubMed
50.
Zurück zum Zitat O’Connor Timothy R. Purification and characterization of human 3-methyladenine-DNA glycosylase. Nucleic Acids Res. 1993;21:5561–9.PubMedPubMedCentral O’Connor Timothy R. Purification and characterization of human 3-methyladenine-DNA glycosylase. Nucleic Acids Res. 1993;21:5561–9.PubMedPubMedCentral
51.
Zurück zum Zitat Memisoglu A, Samson L. Cloning and characterization of a cDNA encoding a-methyladenine DNA glycosylase from the fission yeast Schizosaccharomyces pombe. Gene. 1996;177:229–35.PubMed Memisoglu A, Samson L. Cloning and characterization of a cDNA encoding a-methyladenine DNA glycosylase from the fission yeast Schizosaccharomyces pombe. Gene. 1996;177:229–35.PubMed
52.
Zurück zum Zitat Warren JC, Cheatum SG. Effect of neutral salts on enzyme activity and structure. Biochemistry. 1966;5:1702–7.PubMed Warren JC, Cheatum SG. Effect of neutral salts on enzyme activity and structure. Biochemistry. 1966;5:1702–7.PubMed
53.
Zurück zum Zitat Park C, Raines RT. Quantitative analysis of the effect of salt concentration on enzymatic catalysis. J Am Chem Soc. 2001;123:11472–9.PubMed Park C, Raines RT. Quantitative analysis of the effect of salt concentration on enzymatic catalysis. J Am Chem Soc. 2001;123:11472–9.PubMed
54.
Zurück zum Zitat Izumi T, Wiederhold LR, Roy G, Roy R, Jaiswal A, Bhakat KK, et al. Mammalian DNA base excision repair proteins: their interactions and role in repair of oxidative DNA damage. Toxicology. 2003;15:43–65. Izumi T, Wiederhold LR, Roy G, Roy R, Jaiswal A, Bhakat KK, et al. Mammalian DNA base excision repair proteins: their interactions and role in repair of oxidative DNA damage. Toxicology. 2003;15:43–65.
55.
Zurück zum Zitat Adhikari S, Toretsky JA, Yuan L, Roy R. Magnesium, essential for base excision repair enzymes, inhibits substrate binding of N-methylpurine-DNA glycosylase. J Biol Chem. 2006;281:29525–32.PubMed Adhikari S, Toretsky JA, Yuan L, Roy R. Magnesium, essential for base excision repair enzymes, inhibits substrate binding of N-methylpurine-DNA glycosylase. J Biol Chem. 2006;281:29525–32.PubMed
56.
Zurück zum Zitat Wang P, Guliaev AB, Hang B. Metal inhibition of human N-methylpurine-DNA glycosylase activity in base excision repair. Toxicol Lett. 2006;166:237–47.PubMed Wang P, Guliaev AB, Hang B. Metal inhibition of human N-methylpurine-DNA glycosylase activity in base excision repair. Toxicol Lett. 2006;166:237–47.PubMed
Metadaten
Titel
Molecular characterization of Plasmodium falciparum DNA-3-methyladenine glycosylase
verfasst von
Nattapon Pinthong
Paviga Limudomporn
Jitlada Vasuvat
Poom Adisakwattana
Pongruj Rattaprasert
Porntip Chavalitshewinkoon-Petmitr
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
Malaria Journal / Ausgabe 1/2020
Elektronische ISSN: 1475-2875
DOI
https://doi.org/10.1186/s12936-020-03355-w

Weitere Artikel der Ausgabe 1/2020

Malaria Journal 1/2020 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.