Zum Inhalt

Molecular detection and characterization of Shigella spp. harboring extended-spectrum β-lactamase genes in children with diarrhea in northwest Iran

  • Open Access
  • 01.12.2022
  • Research
Erschienen in:
download
DOWNLOAD
print
DRUCKEN
insite
SUCHEN

Abstract

Shigellosis is one of the acute bowel infections and remains a serious public health problem in resource-poor countries. The present study aimed to survey the distribution of extended-spectrum β-lactamase (ESBL)-producing Shigella strains isolated from patients with diarrhea in northwest Iran. In the present cross-sectional study, from January 2019 to December 2020, 1280 fecal samples were collected from children with diarrhea in Ardabil, Iran. Multiplex PCR assay was applied for the presence of ipaH, invC, wbgZ, rfpB, and rfc genes to detect Shigella spp., Shigella sonnei, Shigella dysenteriae, Shigella flexneri, and Shigella boydii, respectively. Phenotypic detection of ESBL-producing isolates was carried out using the Double Disc Test (DDT). The frequency of main ESBL encoding genes including blaCTX-M, blaSHV, and blaTEM was detected using multiplex PCR. The genetic similarity of S. sonnei isolates was determined using ERIC PCR. A total of 49 Shigella isolates (3.8%; 49/1280) including 42 (85.7%) S. sonnei, 5 (10.2%) S. flexneri, and 2 (4%) S. dysenteriae were identified. S. boydii was not detected in any fecal samples. ESBLs were produced by 10.2% of Shigella spp. including 3 S. sonnei, 1 S. flexneri, and 1 S. dysenteriae. The ESBL encoding genes include blaCTX-M and blaTEM found in 65.3% and 61.2% of isolates, respectively. blaSHV gene was not detected in any isolates. The ERIC-PCR profiles allowed the differentiation of 42 S. sonnei strains into 6 clusters. Our study revealed a high frequency of ESBL-encoding genes among Shigella spp. in northwest Iran. The high prevalence of S. sonnei harboring ESBL genes, in the present work, is the main challenge for dysentery treatment, and this concern justifies the need for effective and regular monitoring of antibiotic usage among patients.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
DDT
Double-disk test
ESBL
Extended-spectrum β-lactamase
XLD agar
Xylose-lysine deoxycholate agar
HE
Hektoen enteric agar
TSI
Triple sugar iron
SIM medium
Sulfide indole motility medium
ODC
Ornithine decarboxylase
LIA
Lysine iron agar
CLSI
Clinical Laboratory Standards Institute
ERIC-PCR
Enterobacterial repetitive intergenic consensus-PCR

Introduction

Shigellosis is one of the main acute bowel diseases and remains a major public health problem in resource-poor countries. This disease is caused by gram-negative bacteria belonging to Enterobacteriaceae [1]. In general, Shigella species are facultative intracellular and non-flagellated clinically important pathogens. Shigella flexneri (S. flexneri) with 10 serotypes, Shigella dysenteriae (S. dysenteriae) with 12 serotypes, Shigella boydii (S. boydii) with 18 serotypes, and Shigella sonnei (S. sonnei) with 1 serotype are the four major serological groups of Shigella spp. [2, 3]. The infectious dose of Shigella species is very low (10 to 100 organisms), and the fecal-oral route represents the main transmission line to shigellosis [4]. According to several factors such as partially developed immunity, poor hygiene, and lack of past exposures, the age group less than 5 years is highly susceptible to Shigella infections. Among developing countries and in children aged < 5 years, diarrhea is the second most common cause of death [5]. The use of effective antibiotics for the treatment of Shigella infections may lead to a reduction in disease transmission and prevention of lethal outcomes [6]. However, despite the existence of effective treatment regimens, shigellosis continues to be a major global health challenge with estimated shigellosis deaths of 28,000 to 48,000 among young children in 2013 [7]. Antibiotic therapy is usually recommended for dealing with shigellosis because it may shorten the clinical course of the disease, reduce the risk of transmission, and prevent potentially fatal complications [8]. Among the different groups of antibiotics, β-lactams and quinolones are usually used against Shigella infections. However, over the past half-century, many countries have reported the high resistance of Shigella species to common antimicrobial agents [9]. Moreover, based on the geographical location, the antibiotic resistance profile of Shigella spp. varies, and the treatment process is difficult [6, 10].
β-Lactams are valuable drugs for treating various types of bacterial infectious diseases [11]. The excessive use of β-lactam antibiotics has led to an increase in resistance to them, especially in gram-negative bacteria. β-lactamases are enzymes that bacteria use to break the β-lactam ring of β-lactam antibiotics and become resistant to them [12, 13]. Different types of β-lactamases have been identified, which differ from each other in terms of structural characteristics and molecular targets, and amino acid sequences [14]. Accordance to Ambler’s classification, β-lactamases are divided into four groups including A, B, C, and D. Extended-spectrum β-lactamase (ESBL) is a group of β-lactamase that confer resistance to potent β-lactams such as third-generation cephalosporins [15]. ESBL-producing Shigella spp. has been identified as a major concern in hospital and community-acquired infections worldwide, especially in developing county [16]. In this regard, the present study aimed to survey the distribution of ESBL-producing Shigella strains isolated from patients with diarrhea in northwest, Iran.

Materials and methods

Study area, sample collection, and bacterial isolates

The present research was performed in Ardabil, an ancient city in northwestern Iran. From January 2019 to December 2020, 1280 fecal samples were collected from children with diarrhea who had been referred to the laboratory of Bu Ali Hospital at Ardabil University, belonging to the Iranian health system in Ardabil, Iran. The fecal samples were cultured on MacConkey agar and selenite F medium, and all plates were incubated overnight at 37 °C. After incubation time, all colonies were transferred to Hektoen enteric agar (HE) and xylose-lysine deoxycholate agar (XLD agar), (Merck, Hamburg, Germany) and were incubated at 37 °C for 18 to 24 h. Specimens with green colonies on HE medium, colorless colonies on XLD medium, and non-lactose fermenting colonies on MacConkey agar were suspected of Shigella species. The final identification of Shigella species was conducted using conventional biochemical tests such as triple sugar iron (TSI), SIM medium (sulfide indole motility medium), ornithine decarboxylase (ODC), lysine iron agar (LIA), Simmons citrate, and urea agar. In the next step, all confirmed bacteria were stored at −80 °C in 10% glycerol (Fig. 1).
Fig. 1
A flowchart of method steps
Bild vergrößern

Molecular detection of Shigella species

DNA was extracted using the DNA extraction kit (Sinaclon, Tehran, Iran) according to the manufacturer’s instructions. The NanoDrop device (Thermo Fisher Scientific, Waltham, MA, USA) was used for the evaluation of the quality and quantity of the extracted DNA. Molecular identification of Shigella species was performed using multiplex PCR assay. The specific genes including ipaH, invC, wbgZ, rfpB, and rfc were employed to detect Shigella spp., S. sonnei, S. dysenteriae, S. flexneri, and S. boydii, respectively [17, 18]. The sequence results were submitted in GenBank (accession numbers: MN503255.1 and MN503256.1).
The sequence of the primers used for multiplex PCR assay is shown in Table 1. The PCR reaction was performed in a thermocycler (Bio-Rad, Germany) as follows: 1 cycle at 94 °C for 4 min, 32 cycles at 94 °C for 45 s, different annealing temperatures for each gene for 45 s, 72 °C for 40 s, and the final extension cycle at 72 °C for 10 min. The PCR reaction was carried out at the final volume of 25 μl including 12.5 μl of Master Mix, 0.5 μl of 10 pM forward and reverse primers, and 0.5–1 μl of genomic DNA. All the materials used in the PCR reaction were purchased from SinaClon BioScience Company, Iran. S. flexneri ATCC 12022 and S. sonnei ATCC 9290 were used as a positive control in the PCR reaction. Moreover, DNase-free as a negative control was used for PCR assay. The PCR products were stained by safe stain and screened by electrophoresis on 1–1.5% agarose. The bands associated with PCR products were observed through the application of a transilluminator.
Table 1
Primers used for the detection of the Shigella species and ESBL encoding genes
Primers name
Sequence (5′→3′)
PCR product size (bp)
References
invC
F
TGCCCAGTTTCTTCATACGC
879
[17]
R
GAAAGTAGCTCCCGAAATGC
wbgZ
F
TCTGAATATGCCCTCTAC
430
[17]
R
GACAGAGCCCGAAGAACCG
rfpB
F
TCTCAATAATAGGGAACACAGC
537
[17]
R
CATAAATCACCAGCAAGGTT
rfc
F
TTTATGGCTTCTTTGTCG
211
[17]
R
CTGCGTGATCCGACCATG
ipaH
F
GTTCCTTGACCGCCTTTCCGATACCGTC
619
[18]
R
GCCGGTCAGCCACCCTCTGAGAGTAC
blaSHV
F
ATTTGTCGCTTCTTTACTCGC
1018
[19]
R
TTTATGGCGTTACCTTTGACC
blaCTX-M
F
ATGTGCAGYACCAGTAARGT
544
[19]
R
TGGGTRAARTARGTSACCAGA
blaTEM
F
ATAAAATTCTTGAAGACGAAA
1076
[19]
R
GACAGTTACCAATGCTTAATC
ERIC
F
ATGTAAGCTCCTGGGGATTCAC
Variable
[20]
R
AAGTAAGTGACTGGGGTGAGCG

Phenotypic detection of ESBL-producing isolates

ESBL production was determined according to the Clinical Laboratory Standards Institute (CLSI) guidelines [21]. Phenotypic detection of ESBL-producing isolates was carried out using ceftazidime (CAZ) and cefotaxime (CTX) disks (Becton Dickinson) and by the double-disk test on freshly prepared Mueller-Hinton agar (Fig. 2). Briefly, CAZ and CTX 30 μg disks, with and without clavulanic acid (CA) 10 μg disk, were used for testing. An inhibition zone ≥ 5 mm for CAZ or CTX tested in combination with CA versus its zone when tested alone was considered as ESBL-producing isolates. Escherichia coli ATCC 25922 was used as the standard strain.
Fig. 2
PCR product electrophoresis of invC gene. Lane L is related to DNA marker: 100 bp (SMO321, Fermantas); Lane P: positive control; Lane 1–3: positive samples; Lane N: negative control
Bild vergrößern

Molecular detection of ESBL encoding genes

A multiplex PCR assay targeting the main ESBL encoding genes including blaTEM, blaCTX-M, and blaSHV was performed. The sequence of primers used for multiplex PCR assay is shown in Table 1. The multiplex PCR was performed at the final volume of 25 μl including 12 μl of 2 × Master Mix (SinaClon BioScience Company, Iran; Cat. no. PR901638) containing 3 mmol/l MgCl2, 0.4 mmol/l dNTPs, 1 × PCR buffer, 0.08 IU Taq DNA polymerase, 1 μl of 10 pmol of each forward and reverse primer, 3 μl of template DNA, and 8 μl of sterile distilled water. Escherichia coli ATCC 25922 was used as a standard strain.

ERIC-PCR

The enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) was performed in a volume of 50 μl, containing 1 μl of bacterial genomic DNA (200–600 μl/ml), 3.7 μl of buffer TBE 10×, 1.5 μl of each dNTP (10 mM), 2.5 μl of (50 mM) 2Mgcl, 2 μl of each forward and reverse primer (90 pmol), and 1 μl of Taq DNA polymerase (5 units). Besides, the left volume was filled with 36.3 μl of PCR-grade water. The ERIC-PCR was conducted with the following conditions: initial denaturation of 95 °C for 4 min and 32 cycles of 95 °C for 60 s, 55 °C for 60 s, and 72 °C for 45 s followed by a final extension of 72 °C for 10 min. Primer sequences are presented in Table 1. The PCR products were stained with safe stain and electrophoresed on 2% agarose gel along with a 1-kb DNA ladder [20].

Statistical analysis

The data were inputted and analyzed using the SPSS software ver. 23 (SPSS Inc., Chicago, IL, USA). A binary method and ward method were used for computing distance matrix and hierarchical clustering, respectively. The cophenetic value was determined as 0.647; this index measures the correlation of cophenetic (height) distance to the original distance in the data. To assess clustering tendency (the feasibility of the clustering analysis), Hopkins statistics was used, and its value was less than 0.5 (Hopkins statistic = 0.4), indicating that we could perform cluster analysis on the data set. All statistical analyses were performed in R software.

Results

In the present study, a total of 1280 fecal samples were screened for Shigella genus. Conventional biochemical tests were employed for the identification and differentiation of Shigella spp. Based on biochemical tests, Shigella spp. was detected in 8.8% (n = 113/1280) of the fecal samples (Fig. 1). The prevalence of Shigella species among children with diarrhea is summarized in Table 2. Overall, Shigella species were isolated from 3.8% (n = 49/1280) of the samples using PCR assay (Fig. 3). The prevalence of Shigella species is given as follows: S. sonnei (n = 42 /49; 85.7%), S. flexneri (n = 5/49; 10.2%), and S. dysenteriae (n = 2/49; 4%). S. boydii was not detected in the fecal samples.
Table 2
The frequency of ESBL encoding genes in Shigella species
Shigella species
N (%)
ESBL
blaCTX
blaTEM
blaSHV
S. flexneri
N = 5 (10.2%)
1 (20%)
3 (60%)
5 (100%)
0 (0%)
S. dysenteriae
N = 2 (4.1%)
1 (50%)
1 (50%)
2 (100%)
0 (0%)
S. sonnei
N = 42 (85.7%)
3 (7.1%)
28 (66.7%)
23 (54.8%)
0 (0%)
S. boydii
N = 0 (0%)
-
-
-
-
Total
N = 49 (100%)
5 (10.2%)
32 (65.3%)
30 (61.2%)
0 (0%)
Fig. 3
Phenotypic detection of ESBL-producing isolate using double disc test. The synergy between cefotaxime (CTX) and cefotaxime- clavulanate (CTC) is demonstrated
Bild vergrößern
ESBLs were produced by 5 out of 49 (10.2%) Shigella isolates including 3 S. sonnei, 1 S. flexneri, and 1 S. dysenteriae. The prevalence of ESBL-producing Shigella species is shown in Table 2.
The ESBL encoding genes include blaCTX-M and blaTEM found in 65.3% and 61.2% of isolates, respectively (Figs. 4 and 5). blaSHV gene was not detected in any isolates. The frequency of ESBL encoding genes among Shigella species is shown in Table 2.
Fig. 4
Illustration of blaTEM PCR product on 1% agarose gel; lane 1, size marker (ladder 100 bp: SMO321, Fermantas); lane 2, negative control; lanes 3 and 5–7, positive blaTEM: 1076 bp samples
Bild vergrößern
Fig. 5
PCR product electrophoresis for the study of blaCTX-M gene on 1% agarose gel; lane 1, DNA marker (ladder 100 bp: SMO321, Fermantas); lane 2, negative control; lanes 3, 4, and 6, positive blaCTX-M: 544 bp
Bild vergrößern

ERIC PCR analysis

The genotyping profiles of 42 isolates of S. sonnei strains according to ERIC-PCR fingerprinting are shown in Figs. 6 and 7. All 42 S. sonnei under analysis produced 6–10 amplicons ranging from 100 to 1500 bp. The ERIC-PCR profiles allowed the differentiation of 42 S. sonnei strains into 6 clusters.
Fig. 6
PCR product electrophoresis for the ERIC-PCR typing on 1% agarose gel; lane M: DNA marker (ladder100 bp: Cinnaclon, Iran)
Bild vergrößern
Fig. 7
Dendrogram relating to isolated strains of S. sonnei
Bild vergrößern

Discussion

Among children in developing countries, despite the existence of effective treatment regimens, shigellosis continues to be the main public-health concern with an annual estimate of 163.2 million new cases and 1.1 million deaths [22]. In Iran, there are no specific guidelines to employ antibiotic therapy, and in most cases, physicians prescribe antibiotics without any stool cultures [23]. Therefore, performing epidemiological studies and gathering information regarding phenotypic and molecular mechanisms of antibiotic resistance to control infections and the development of local treatment guidelines are necessary.
In the present study, we surveyed the prevalence and molecular characterization of Shigella species harboring ESBL genes in patients with diarrhea from the northwest of Iran. This study showed a prevalence of 3.8% (49/1280) of shigellosis that was lower than the rates found in previously published studies conducted by Farajzadeh Sheikh et al. [6], Soltan Dallal et al. [24], Abbasi et al. [25], and Ranjbar et al. [20]. All of these studies were performed in Iran, and it was reported that the prevalence of Shigella spp. was 7.2%, 7.9%, 8.2%, and 9.4%, respectively.
However, the results of our study are in agreement with those of previous studies from Dhital et al. in Nepal [26], Aggarwal et al. in India [22], Jomehzadeh et al. from Iran [27], and Bakhshi et al. in Iran [28]. These studies found that the frequency of Shigella species in the patients with diarrhea was 2.1%, 1.9%, 5.9%, and 1.3%, respectively.
The detected variation in the prevalence of Shigella spp. could be due to the difference in the sample collection seasons, geography, specimen size, diversity of specimen type, study population, and applied detecting methods [27]. The result of the present study indicates that shigellosis is the main public health problem in the northwest of Iran. Therefore, it is critical to take several measures such as promoting awareness about the safety of water and food and improving health conditions.
Our finding revealed that S. sonnei had the highest frequency among Shigella species. In contrast, S. boydii was not detected in fecal samples. This result was in line with previous reports from Farajzadeh Sheikh et al. in Iran [29], Zhang et al. in China [30], Abbasi et al. in Iran [25], Bakhshi et al. in Iran [28], Ranjbar et al. in Iran [20], and Tajbakhsh et al. in Iran [31].
According to previous studies, it seems that in the southern regions of Iran, in the cities such as Shiraz, Ahvaz, and Kerman, S. flexneri is the dominant strain, while in northern regions of Iran, S. sonnei strain is prevalent [27, 3236]. In contrast with our results, several different studies in various countries including Nepal [24], Ethiopia [37], Bulgaria [38], India [22], Iran [34], and Peru [39] have reported the S. flexneri as the leading cause of shigellosis.
In general, Shigella species can cause several diseases such as diarrheal in both developed and developing countries [40]. It has been reported that S. flexneri is the predominant serogroup in developing countries and is responsible for 44.5–80% of all Shigella infections such as diarrhea, while S. sonnei is a major cause of diarrheal in industrialized and developed countries [30].
In the present study, 10.2% were ESBL-producing strains by the double-disk method. Most ESBL-producing species were detected in S. sonnei which was following studies reported by Ranjbar [41]. In contrast, in a study performed by Aminshahidi et al., 54.5% of S. flexneri strain was ESBL positive [33].
Several different studies have surveyed the frequency of ESBL-producing Shigella strains. Results of a study performed by Li et al. from China revealed that ESBLs were produced by 18.1% of Shigella isolates, and most of the ESBL-producing species belonged to the S. flexneri isolates (19.5 %) [15]. In another study, Zhang et al. in China revealed that 10 Shigella isolates produced ESBLs including 8 S. sonnei isolates and 2 S. flexneri isolates [30].
Moreover, the prevalence of ESBL-producing Shigella isolates in the studies carried out by Aminshahidi et al. in Iran [33], Tau et al. in South Africa [42], Zamanlou et al. in Iran [43], Farajzadeh Sheikh et al. in Iran [29], Abbasi et al. in Iran [25], and Dhital et al. in Nepal [26] was > 50%, 0.3%, 54.2%, 43%, 52.6%, and 6.7%, respectively. In most studies, the highest prevalence of S. sonnei strains was ESBL producing.
The detected variation in the frequency of ESBL-producing Shigella species could be due to the differences in the applied detecting methods, variations in geographical location, and differences in sample size, sample type, and study participants [44]. Mobile genetic elements such as integrons, plasmids, and transposons can transmit the drug resistance genes among different bacteria and are responsible for antibiotic resistance in Shigella spp. [25]. In general, the main aim of antibiotic prescription in children with bloody and chronic diarrhea is the reduction in the duration of the disease. Because most Shigella infections are contagious and severe, appropriate antibiotic prescription and suitable treatment are essential [27].
Recently, the emergence of multidrug-resistant (MDR) Shigella species is increasing. The treatment of MDR strains is very difficult and is considered an alarming public health concern, worldwide [29].
In the present study, the blaCTX-M with a frequency of 65.3% was the most predominant ESBL encoding gene followed by the blaTEM gene with a frequency of 61.2% which was in line with previous reports by Andres et al. from Argentina [18], Vasilev et al. from Israel [19], Abbasi et al. from Iran [4], Farajzadeh Sheikh et al. from Iran [8], and Liu et al. from China [20].
β-Lactamases are the enzymes encoded by several genes and were considered the main mechanisms of resistance to β-lactam antibiotics such as cephalosporins (especially third-generation cephalosporins) among gram-negative bacteria. The high prevalence of ESBL-producing and β-lactamase genes leads to complicated treatment [33, 45].
Identification of ESBL among Shigella strains is an undeniable concern because it reduces antibiotic treatment options, and the spread of mobile resistance determinants will be a great threat to the treatment of invasive diseases in the future.
The present study has several limitations including the following: [1] the antibiotic susceptibility of Shigella species against different classes of antibiotics such as carbapenems was not determined, [2] the frequency of virulence genes was not determined, [3] the prevalence of other antibiotic resistance encoding genes such as genes encoding AmpC β-lactamase was not examined, and [4] the patients’ demographic data such as age, underlying disease, duration of hospitalization, and the outcome of treatment are not accessible; therefore, we were unable to perform deep analyses.

Conclusion

The present study elucidated an update on the phenotypic and genotypic prevalence of ESBLs appearing among Shigella species circulating in the northwest of Iran. The high prevalence of Shigella species, especially S. sonnei, harbored ESBL genes in the present work; this is the main challenge for dysentery treatment, and it highlights the need for effective and regular monitoring of antibiotic usage among patients. Therefore, continued surveillance of the antimicrobial resistance profile and monitoring of the prevalence of Shigella species-producing ESBLs in Iran are urgently required. Epidemiological studies such as the present study provide valuable data on indigenous and resistant strains which help identify sources of infection, improve infection control systems, administrate effective drug treatment, and increase public health in the human community.

Declarations

The present research was performed following the Declaration of Helsinki and approved by the Institutional Ethics Committee of the Ardabil University of Medical Sciences (IR.ARUMS.REC.1397.23). All authors made substantial contributions to the conception and design, acquisition of data, or analysis and interpretation of data. They played an active role in drafting the article or revising it critically to achieve important intellectual content, gave the final approval of the version to be published, and agreed to be accountable for all aspects of the work.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
download
DOWNLOAD
print
DRUCKEN
Titel
Molecular detection and characterization of Shigella spp. harboring extended-spectrum β-lactamase genes in children with diarrhea in northwest Iran
Verfasst von
Sahar Sabour
Amir Teimourpour
Jafar Mohammadshahi
Hadi Peeridogaheh
Roghayeh Teimourpour
Taher Azimi
Zahra Hosseinali
Publikationsdatum
01.12.2022
Verlag
Springer International Publishing
Erschienen in
Molecular and Cellular Pediatrics / Ausgabe 1/2022
Elektronische ISSN: 2194-7791
DOI
https://doi.org/10.1186/s40348-022-00152-0
1.
Zurück zum Zitat Poramathikul K, Bodhidatta L, Chiek S, Oransathid W, Ruekit S, Nobthai P et al (2016) Multidrug-resistant Shigella infections in patients with diarrhea, Cambodia, 2014–2015. Emerg Infect Dis 22(9):1640CrossRef
2.
Zurück zum Zitat Muthuirulandi Sethuvel D, Devanga Ragupathi N, Anandan S, Veeraraghavan B (2017) Update on: Shigella new serogroups/serotypes and their antimicrobial resistance. Letters Appl Microbiol 64(1):8–18CrossRef
3.
Zurück zum Zitat Opintan J, Newman MJ (2007) Distribution of serogroups and serotypes of multiple drug resistant Shigella isolates. Ghana Med J. 41(1):8
4.
Zurück zum Zitat Shigella WE (2002) Wash your hands of the whole dirty business. Cmaj 167(3):281
5.
Zurück zum Zitat Manetu WM, M’masi S, Recha CW. (2021) Diarrhea disease among children under 5 years of age: a global systematic review. Open. J Epidemiol 11(3):207–221
6.
Zurück zum Zitat Sheikh AF, Moosavian M, Abdi M, Heidary M, Shahi F, Jomehzadeh N et al (2019) Prevalence and antimicrobial resistance of Shigella species isolated from diarrheal patients in Ahvaz, southwest Iran. Infect Drug Resist. 12:249CrossRef
7.
Zurück zum Zitat Jahan Y, Moriyama M, Hossain S, Rahman MM, Ferdous F, Ahmed S et al (2019) Relation of childhood diarrheal morbidity with the type of tube well used and associated factors of Shigella sonnei diarrhea in rural Bangladesh site of the Global Enteric Multicenter Study. Tropical Med Health 47(1):1–10CrossRef
8.
Zurück zum Zitat Williams PC, Berkley JA (2018) Guidelines for the treatment of dysentery (shigellosis): a systematic review of the evidence. Paediatr Int Child Health 38(sup1):S50–S65CrossRef
9.
Zurück zum Zitat Ranjbar R, Farahani A (2019) Shigella: antibiotic-resistance mechanisms and new horizons for treatment. Infect Drug Resist 12:3137CrossRef
10.
Zurück zum Zitat Behzadi P, Gajdács M (2021) Writing a strong scientific paper in medicine and the biomedical sciences: a checklist and recommendations for early career researchers. Biologia futura. 72(4):395–407CrossRef
11.
Zurück zum Zitat Jomehzadeh N, Ahmadi K, Rahmani Z (2021) Prevalence of plasmid-mediated AmpC β-lactamases among uropathogenic Escherichia coli isolates in southwestern Iran. Osong Public Health Res Perspect 12(6):390CrossRef
12.
Zurück zum Zitat Armin S, Fallah F, Karimi A, Shirdoust M, Azimi T, Sedighi I et al (2020) Frequency of extended-spectrum beta-lactamase genes and antibiotic resistance patterns of gram-negative bacteria in Iran: a multicenter study. Gene Reports. 21:100783CrossRef
13.
Zurück zum Zitat Jomehzadeh N, Ahmadi K, Bahmanshiri MA (2022) Investigation of plasmid-mediated quinolone resistance genes among clinical isolates of Klebsiella pneumoniae in southwest Iran. J Clin Lab Analysis.:e24342
14.
Zurück zum Zitat Tarafdar F, Jafari B, Azimi T (2020) Evaluating the antimicrobial resistance patterns and molecular frequency of blaoxa-48 and blaGES-2 genes in Pseudomonas aeruginosa and Acinetobacter baumannii strains isolated from burn wound infection in Tehran, Iran. New Microbes and New Infections 37:100686CrossRef
15.
Zurück zum Zitat Azimi L, Fallah F, Karimi A, Shirdoust M, Azimi T, Sedighi I et al (2020) Survey of various carbapenem-resistant mechanisms of Acinetobacter baumannii and Pseudomonas aeruginosa isolated from clinical samples in Iran. Iran J Basic Med Sci. 23(11):1396
16.
Zurück zum Zitat Behzadi P, García-Perdomo HA, Karpiński TM, Issakhanian L (2020) Metallo-ß-lactamases: a review. Mol Biol Rep. 47(8):6281–6294CrossRef
17.
Zurück zum Zitat Ojha SC, Yean Yean C, Ismail A, Banga Singh K-K (2013) A pentaplex PCR assay for the detection and differentiation of Shigella species. BioMed Res Int.
18.
Zurück zum Zitat Sethabutr O, Venkatesan M, Yam S, Pang LW, Smoak BL, Sang WK et al (2000) Detection of PCR products of the ipaH gene from Shigella and enteroinvasive Escherichia coli by enzyme linked immunosorbent assay. Diagnost Microbiol Infect Dis 37(1):11–16CrossRef
19.
Zurück zum Zitat Mandal J, Sangeetha V, Das A, Parija SC (2013) Characterization of extended-spectrum β-lactamase-producing clinical isolates of Shigella flexneri. J Health, Population Nutr 31(3):405CrossRef
20.
Zurück zum Zitat Ranjbar R, Ghazi FM (2013) Antibiotic sensitivity patterns and molecular typing of Shigella sonnei strains using ERIC-PCR. Iran J Public Health. 42(10):1151
21.
Zurück zum Zitat Wayne P (2020) Performance standards for antimicrobial susceptibility testing. In, Institute CaLS, editor
22.
Zurück zum Zitat Aggarwal P, Uppal B, Ghosh R, Prakash SK, Chakravarti A, Jha AK et al (2016) Multi drug resistance and extended spectrum beta lactamases in clinical isolates of Shigella: a study from New Delhi, India. Travel Med Infect Dis 14(4):407–413CrossRef
23.
Zurück zum Zitat Azimi T, Maham S, Fallah F, Azimi L, Gholinejad Z (2019) Evaluating the antimicrobial resistance patterns among major bacterial pathogens isolated from clinical specimens taken from patients in Mofid Children’s Hospital, Tehran, Iran: 2013–2018. Infect Drug Resist. 12:2089CrossRef
24.
Zurück zum Zitat Soltan Dallal M, Ranjbar R, Yaghoubi S, Rajabi Z, Aminharati F, Adeli BH (2018) Molecular epidemiology and genetic characterization of Shigella in pediatric patients in Iran. Infez Med. 26(4):321–328
25.
Zurück zum Zitat Abbasi E, Abtahi H, van Belkum A, Ghaznavi-Rad E (2019) Multidrug-resistant Shigella infection in pediatric patients with diarrhea from Central Iran. Infect Drug Resist. 12:1535CrossRef
26.
Zurück zum Zitat Dhital S, Sherchand JB, Pokharel BM, Parajuli K, Mishra SK, Sharma S et al (2017) Antimicrobial susceptibility pattern of Shigella spp. isolated from children under 5 years of age attending tertiary care hospitals, Nepal along with first finding of ESBL-production. BMC Research Notes. 10(1):1–5CrossRef
27.
Zurück zum Zitat Jomehzadeh N, Ahmadi K, Javaherizadeh H, Afzali M (2021) Distribution of genes encoding virulence factors of Shigella strains isolated from children with diarrhea in southwest Iran. Mol Biol Rep. 48(2):1645–1649CrossRef
28.
Zurück zum Zitat Bakhshi B, Afshari N, Fallah F (2018) Enterobacterial repetitive intergenic consensus (ERIC)-PCR analysis as a reliable evidence for suspected Shigella spp. Outbreaks. Brazilian J Microb. 49:529–533CrossRef
29.
Zurück zum Zitat Sheikh AF, Bandbal MM, Saki M (2020) Emergence of multidrug-resistant Shigella species harboring extended-spectrum beta-lactamase genes in pediatric patients with diarrhea from southwest of Iran. Mol Biol Rep. 47(9):7097–7106CrossRef
30.
Zurück zum Zitat Zhang R, Zhou HW, Cai JC, Zhang J, Chen G-X, Nasu M et al (2011) Serotypes and extended-spectrum β-lactamase types of clinical isolates of Shigella spp. from the Zhejiang province of China. Diag Microbiol Infect Dis. 69(1):98–104CrossRef
31.
Zurück zum Zitat Tajbakhsh M, García Migura L, Rahbar M, Svendsen CA, Mohammadzadeh M, Zali MR et al (2012) Antimicrobial-resistant Shigella infections from Iran: an overlooked problem? J Antimicrob Chemother. 67(5):1128–1133CrossRef
32.
Zurück zum Zitat Nikfar R, Shamsizadeh A, Darbor M, Khaghani S, Moghaddam M (2017) A study of prevalence of Shigella species and antimicrobial resistance patterns in paediatric medical center, Ahvaz, Iran. Iran J Microbiol 9(5):277
33.
Zurück zum Zitat Aminshahidi M, Arastehfar A, Pouladfar G, Arman E, Fani F (2017) Diarrheagenic Escherichia coli and Shigella with high rate of extended-spectrum beta-lactamase production: two predominant etiological agents of acute diarrhea in Shiraz. Iran. Microbial Drug Resistance. 23(8):1037–1044CrossRef
34.
Zurück zum Zitat Shokoohizadeh L, Kaydani GA, Ekrami A (2017) Molecular characterization of Shigella spp. isolates from a pediatric hospital in southwestern Iran. Gastroenterol Hepatol Bed to Bench. 10(4):319
35.
Zurück zum Zitat Pour MBMG, Shokoohizadeh L, Navab-Akbar FT (2016) Analysis of clonal relationships among Shigella spp. isolated from children with shigellosis in Ahvaz, Iran. Arch Adv Biosci 7(2):45–51
36.
Zurück zum Zitat Nave HH, Mansouri S, Sadeghi A, Moradi M (2016) Molecular diagnosis and anti-microbial resistance patterns among Shigella spp. isolated from patients with diarrhea. Gastroenterol Hepatol Bed Bench. 9(3):205
37.
Zurück zum Zitat Tosisa W, Mihret A, Ararsa A, Eguale T, Abebe T (2020) Prevalence and antimicrobial susceptibility of Salmonella and Shigella species isolated from diarrheic children in Ambo town. BMC Pediatr 20(1):1–8CrossRef
38.
Zurück zum Zitat Petrov MM, Petrova A, Stanimirova I, Mircheva-Topalova M, Koycheva L, Velcheva R, et al. Evaluation of antimicrobial resistance among Salmonella and Shigella isolates in the University Hospital “St. George,” Plovdiv, Bulgaria. Folia microbiologica. 2017;62(2):117-125.
39.
Zurück zum Zitat Lluque A, Mosquito S, Gomes C, Riveros M, Durand D, Tilley DH et al (2015) Virulence factors and mechanisms of antimicrobial resistance in Shigella strains from periurban areas of Lima (Peru). Int J Med Microbiol. 305(4-5):480–490CrossRef
40.
Zurück zum Zitat Li J, Li B, Ni Y, Sun J (2015) Molecular characterization of the extended-spectrum beta-lactamase (ESBL)-producing Shigella spp. in Shanghai. European J Clin Microbiol Infect Dis. 34(3):447–451CrossRef
41.
Zurück zum Zitat Ranjbar R, Ghazi FM, Farshad S, Giammanco GM, Aleo A, Owlia P et al (2013) The occurrence of extended-spectrum β-lactamase producing Shigella spp. in Tehran, Iran. Iran J Microbiol 5(2):108
42.
Zurück zum Zitat Tau NP, Smith AM, Sooka A, Keddy KH, Group for Enteric R, MDSiS A (2012) Molecular characterization of extended-spectrum β-lactamase-producing Shigella isolates from humans in South Africa, 2003–2009. J Med Microbiol 61(1):162–164CrossRef
43.
Zurück zum Zitat Zamanlou S, Ahangarzadeh Rezaee M, Aghazadeh M, Ghotaslou R, Babaie F, Khalili Y (2018) Characterization of integrons, extended-spectrum β-lactamases, AmpC cephalosporinase, quinolone resistance, and molecular typing of Shigella spp. from Iran. Infect Dis. 50(8):616–624CrossRef
44.
Zurück zum Zitat Jomehzadeh N, Saki M, Ahmadi K, Zandi G (2022) The prevalence of plasmid-mediated quinolone resistance genes among Escherichia coli strains isolated from urinary tract infections in southwest Iran. Mol Biol Rep. 1-7
45.
Zurück zum Zitat Mook P, McCormick J, Bains M, Cowley LA, Chattaway MA, Jenkins C et al (2016) ESBL-producing and macrolide-resistant Shigella sonnei infections among men who have sex with men, England, 2015. Emerg Infect Dis. 22(11):1948CrossRef

Kompaktes Leitlinien-Wissen Pädiatrie (Link öffnet in neuem Fenster)

Mit medbee Pocketcards schnell und sicher entscheiden.
Leitlinien-Wissen kostenlos und immer griffbereit auf ihrem Desktop, Handy oder Tablet.

Neu im Fachgebiet Pädiatrie

Kindlicher Rückenschmerz: Vom Schulranzen bis zur Spondylitis

Rückenschmerzen bei Kindern und Jugendlichen sind kein triviales Beschwerdebild. Neben funktionellen Ursachen müssen auch ernsthafte Pathologien bedacht werden. Eine sorgfältige klinische Abklärung mit Blick auf „Red Flags“ ist daher entscheidend.

Bundesverfassungsgericht: Triage-Regelung nicht mit Grundgesetz vereinbar

Das Bundesverfassungsgericht hat Regelungen zur Triage für nichtig erklärt. Es gab damit Verfassungsbeschwerden von Intensiv- und Notfallmedizinern statt. Der Eingriff in die Berufsfreiheit der Ärztinnen und Ärzte sei verfassungsrechtlich nicht gerechtfertigt, betont das Gericht.

Was lindert kindliche Kopfschmerzen?

Die Migräne-Inzidenz steigt auch bei Kindern und Jugendlichen. Medikamentös gibt es nur wenige Optionen, insbesondere für die Prophylaxe. Multimodale Ansätze sind gefragt. Hilft dabei auch ein strukturiertes Riechtraining? 

Vermehrt psychische Störungen nach vorzeitiger Pubertät

Kommen Kinder vorzeitig in die Pubertät, ist das Risiko für unterschiedliche psychische Störungen deutlich erhöht. Jungen sind dabei stärker gefährdet als Mädchen.

Update Pädiatrie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Bildnachweise
Die Leitlinien für Ärztinnen und Ärzte, Rückenuntersuchung bei kleinem Mädchen/© Viacheslav Lakobchuk / stock.adobe.com (Symbolbild mit Fotomodellen), Junge Ärztin vor einem Triage-Zelt/© Milos / Stock.adobe.com (Symbolbild mit Fotomodell), Kranker Junge mit erhöhter Temperatur/© Imgorthand / Getty Images / iStock (Symbolbild mit Fotomodell)