Molecular markers of resistance to amodiaquine plus sulfadoxine–pyrimethamine in an area with seasonal malaria chemoprevention in south central Niger

The study was conducted in at the Gabi community health centre, Madarounfa district, Maradi Region along the southern border of Niger (Fig. 1). The rainy season extends from June to September with an annual average (2000–2012) precipitation of 445 mm. A previous study showed that the Maradi Region is meso-to hyperendemic for malaria with a rate of slide-positivity for inpatients peaking at 70% during the season of high transmission and falling to 20% during the dry season when the transmission rate is the lowest [16].

Samples for molecular analysis were collected from young children presenting at the Gabi health centre. After clinical examination, children presenting with fever (axillary temperature ≥ 37.5 °C) or history of fever during the previous 24 h were tested for malaria. The presence of P. falciparum was initially investigated by a rapid diagnostic test (HRP2 SD Bioline^®) then confirmed and quantified by microscopy on Giemsa-stained blood smears. Children with uncomplicated P. falciparum infection with parasite density between 2000 and 200,000 per microlitre, aged 6–59 months and/or height greater than 65 cm, and weighing more than 5 kg, were identified and their parents or caregivers invited to participate in the study. Exclusion criteria were the presence of mixed infections with species other than P. falciparum or presence of severe malaria or general danger signs; these children were immediately referred for inpatient evaluation. The recruitment period extended from December 2011 to January 2012. After obtaining informed consent from parents or guardians, 1 ml of venous blood was collected in EDTA anticoagulant tubes. Parasitized blood samples were stored frozen at – 20 °C until analysis.

This study was authorized by the Ministry of Health of Niger, and ethical clearance was obtained from the National Ethical Committee of Niger (authorization N°022/2011/CCNE and N°003/2013/CCNE). Documents relating to the consent procedure were translated into Hausa which is the formal local language. The information sheet detailing the purpose of the study was read in its entirety to the parents or guardians, and a copy of the document was provided. An interview was given to every participant and to parents after which the consent form was signed, or validated by a fingerprint for illiterate persons. All subjects testing positive for malaria, included or not in the study, were treated without charge according national protocols. Data from this study have been deposited in the WorldWide Antimalarial Resistance Network repository for open use in individual patient data meta-analyses.

Genomic DNA was extracted according to manufacturer’s recommendations (QIAamp DNA blood kit, QIAGEN). Measurement of the concentration and purity of DNA was achieved using a NanoDrop2000 UV-Vis spectrophotometer. All amplifications were done in a microtube format, using a Primus 96 thermocycler (PEQLAB Biotechnology). To analyse parasite populations that were as homogeneous as possible, clinical samples were first typed by amplification of polymorphic block 2 sequences of pfmsp2 essentially as described elsewhere [15]. Those producing a single fragment by agarose gel electrophoresis were judged to be monoclonal and selected for analysis of markers associated with resistance. pfdhfr and pfdhps sequences were amplified by nested PCR as described elsewhere [16]. Briefly, M1 (5′TTTATGATGGAACAAGTCTGC3′) and M7 (5′CTAGTATATACATCGCTAACA3′) oligonucleotides were used for primary amplification of pfdhfr sequences (650 bp) and M3b (5′TGATGGAACAAGTCTGCGACGTT3′) and M9 (5′CTGGAAAAAATACATCACA TTCATATG3′) for secondary reactions, producing a 594 bp fragment containing key mutations A16V/S, N51I, C59R, S108N, V140L and I164L. For Pfdhps sequences a 770 bp fragment was first amplified using N1 (5′GATTCTTTTTCAGATGGAGG3′) and N2 (5′TTCCTCATGTAATTCATCTG A3′) then used as template for secondary amplifications using primers R2 (5′AACCTAAACGTGCTGTTCAA3′) and R (5′AATTGTGTGA TTTGTCCACAA3′). The final PCR product (711 bp) contains mutations S436A/F, A437G, K540E, A581G, and A613S, previously associated with parasite responses to sulfonamide. Detailed PCR conditions for amplification of these markers are as described elsewhere [17]. Primers for cycle-sequencing included; Pfdhps_Fwd (AACCTAAACGTGCTGTTCAA), Pfdhps_Rev (AATTGTGTGATTTGTCCACAA), Pfdhps_IntFwd1 (ATTCTATAGTGTAGTTCTAATGC), Pfdhps_IntRev2 (CTGGATTATTTGTACAAGCAC), Pfdhfr_Fwd (TGATGGAACAAGTCTGCGACGTT), Pfdhfr_Rev (CTGGAAAAAATACATCACATTCATATG). Cycle sequencing follow standard BigDye3.1 dye terminator protocol (AppliedBiosystems) on an MJ-Thermocylcer. Sequencing reactions were cleaned on Sephadex G10 columns and analysed on ABI3130xl Genetic Analyser.

The enrolment period was 1 month, in order to collect approximately 150 blood samples. This sample size allows reliable assessment of a prevalence of 12% (corresponding to the prevalence of parasites that carried the triple pfdhdr mutation previously observed in Niger [16]) with a precision of ± 7%. Data were double-entered by two independent entry clerks into EPIinfo version 3.5.2 (Odensk, Denmark). General characteristics of the population were described by mean, standard deviation and range for continuous variables and by absolute number and percentage for categorical variables.

Prevalence of individual mutant codons was determined in the apparently monoclonal clinical samples. These samples showed a high prevalence (> 60%) of mutations N51I, C59R and S108N in pfdhfr, known to be associated with resistance to pyrimethamine. The S108N mutation was the most represented with a prevalence of 69%, whereas the mutation 16V/S, associated with resistance to cycloguanil [18] and mutation I164L, previously described for some highly resistant parasites of Asian origin [19] and very rare African origins were not detected [12]. Five SNPs were genotyped in the pfdhps gene at codons 431, 436, 437, 540, 581 and 613, in the pfdhps locus; the key mutation at codon K540E was not observed, but all other mutations associated with modulation of the responses of parasites to sulfadoxine were detected at variable frequencies. The mutations in codons S436A/F/G and A437G were found in 65 and 83% of isolates, respectively, while A581G and A613S mutations were less frequent (0.1–0.25). Four point mutations associated with reduced responses to amodiaquine were detected in pfmdr1 sequences in codons 86, 184, 1042 and 1246. The prevalence of a mutation changing codon F184Y was 37% whereas the N86Y, N1042D and D1246Y mutations were detected at very low prevalence.

Haplotypes were reconstituted by including all unambiguous data collected at the designated polymorphic positions in pfdhfr, pfdhps and pfmdr1 sequences (Table 1). The wild type genotype N51/C59/S108 (NCS) was identified in 27% (32/118) of the isolates while the triple mutant 51I/59R/108N (IRN) haplotype was detected in 57% (67/118) of the evaluable clinical samples. The ICS and NCN haplotypes (single mutants) and IRS, NRN and ICN (double mutants) were less prevalent at 6% (7/118) and 11% (12/118), respectively. The pfdhps genotypes were defined according to residues found at positions 437, 540, 581 and 613. A total of 5 distinct genotypes were observed. Fourteen % (14/108) of the clinical samples carried only the wild type A437/K540/A581/A613 (AKAA) haplotype, single mutant haplotypes GKAA, AKAS, and AKGA, a double mutant, GKAS, and a triple mutant GAGS (triple mutant) represent 66% (71/108), 13.% (14/108) and 8% (9/108) of the clinical samples tested, respectively. Single and doubly mutated genotypes predominate in Niger and represent 78% of the clinical samples.

The pfmdr1 haplotypes were defined by identifying the residues at polymorphic codons 86, 184, 1042 and 1246. The wild-type sequence NFND was the most prevalent, 52% (63/121). Haplotypes carrying a single (YFND, NYND, NFDD, NFNY) or a double mutation (YYDD, NYDD, NYNY, NFDY and YFNY) were found in 40% (48/121) and 8% (10/121) of the clinical samples. No pfmdr1 genotypes harbouring more than two individual mutated codons were detected.

Thirty-six clinical samples had full sequence information for all three loci. Overall, these parasites carried a wide variety of mutations associated with resistance to SP and AQ; there was no isolate that was fully wild type at either pfdhfr/pfdhps or pfdhfr/pfdhps/pfmdr. With respect to genotypes associated with SP resistance, clinical samples that carried 3 mutations in the pfdhfr sequences and the single 437G in pfdhps (IRN + GKAA) constituted 26% (9/36)—of the clinical samples, but the quintuple mutant (IRN + GEAA) most commonly associated with clinical failure of SP treatment was not observed. However, four clinical samples (0.11) did carry a different quintuple mutant (IRN + GKAS) that may be implicated in SP resistance [17]. The analysis of multilocus genotypes at the pfdhfr/pfdhps/pfmdr loci showed that only two clinical samples carried both a triple mutant pfdhfr (IRN) and a 184Y allele at the pfmdr1 locus; among these, only 1 also carried a double mutant pfdhps allele (GKAS) (Table 2).