Mutagenesis of the di-leucine motif in the cytoplasmic tail of newcastle disease virus fusion protein modulates the viral fusion ability and pathogenesis

DF-1 cells (a chicken embryo fibroblast cell line), and BSR T7/5 cells (a baby hamster kidney cell line stably expressing T7 RNA polymerase) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY, USA) with 10% fetal bovine serum (FBS; Gibco) and were maintained in DMEM with 2% FBS at 37 °C in a 5% CO₂ incubator (Thermo Forma, Marietta, OH, USA). The recombinant NDV strain rSG10* with artificially introduced Pme I and Sac II restriction sites was generated from rSG10 and kept in our laboratory [20, 26]. The rSG10* was propagated in 9–11 day-old specific-pathogen-free (SPF) embryonated eggs by allantoic cavity inoculation.

To generate LL-motif mutants F/L536A, F/L537A and F/L536AL537A, mutagenesis PCR were conducted using Fast Mutagenesis System (Transgen Biotech, Beijing, China). Primers used were as follows: F/L536A-F: GGCACAACAAAAGACCGCGCTATGGCTTGGA, F/L536A-R: GGTATTATTTCCAAGCCATAGCGCGGTCTTTTGTTG; F/L537A-F: GGCACAACAAAAGACCTTGGCATGGCTTGGA, F/L537A-R: GGTATTATTTCCAAGCCATGCCAAGGTCTTTTGTTG; F/L536AL537A-F: GGCACAACAAAAGACCGCGGCATGGCTTGGA, F/L536AL537A-R: GGTATTATTTCCAAGCCATGCCGCGGTCTTTTGTTG. LL-motif mutant plasmids were individually inserted into the full-length antigenomic cDNA of strain rSG10* in place of the corresponding NDV F open reading frame (ORF) using the restriction endonuclease sites Pme I and Sac II. Virus rescue was performed as previously described [26]. Briefly, the recombinant viruses were recovered by the cotransfection of BSR T7 cells with the full-length cDNA plasmid and the three helper plasmids encoding NP, P and L protein of NDV. At 4 days posttransfection, the cell culture was harvested after three freeze&thaw cycles. The supernatant was then injected into 9-day-old SPF embryonated chicken eggs through the allantoic cavity. After 4 days incubation, the allantoic fluid was harvested and screened with a hemagglutination (HA) assay. The rescued recombinant virus was sequenced after RNA extraction and PCR. The cDNA encoding rSG10* F protein, or the LL motif with various mutations, was cloned into pRK5-Flag (BD Biosciences) to generate the following plasmids: pRK5-Flag-F, pRK5-Flag-F/L536A, pRK5-Flag-F/L537A, and pRK5-Flag-F/L536AL537A.

Mouse polyclonal antibody against NP, rabbit polyclonal antibody against F protein, and chicken polyclonal antibody against HN protein were prepared in our laboratory. Anti-Flag (#14793, CST, MA, USA), anti-β-actin (#3700, CST, MA, USA), anti-GAPDH (#2118, CST, MA, USA), and Anti-Sodium Potassium ATPase (Na/K ATPase) (#ab76020, Abcam, Cambridge, MA) were purchased from Univ-bio (Shanghai Univbio Co., Shanghai, China). The secondary antibodies against mouse, rabbit, or chicken used for indirect immunofluorescence assays (IFA) and western blotting were purchased from Bioss Biotechnology (Beijing, China).

All SPF embryonated eggs and SPF chickens were purchased from Beijing Boehringer Ingelheim Vital Biotechnology Co., Ltd. (Beijing, China). The Beijing Administration Committee of Laboratory Animals approved the animal experimental protocol under the auspices of the Beijing Association for Science and Technology (approval ID SYXK [Jing] 2018-0038) and Ethical Censor Committee at China Agricultural University (CAU approval no. 2021028).

BSR-T7/5 cells grown to 70–80% confluence were transfected with the plasmids using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) and were collected at specific time points for use in further studies.

BSR cells were infected with NDV at an MOI of 3, 0.1, or 0.01. After adsorption for 1 h at 37 °C, the viral solution was removed and then washed three times with phosphate-buffered saline (PBS). The cells were cultured in maintenance medium in a 5% CO₂ incubator and then were collected at specific post-infection time points. Viral titers in the cells were determined as previously described by assay of the median tissue culture infective dose (TCID₅₀) values.

The multiple-cycle growth kinetics in DF-1/ BSR-T7/5 cells was used to determine the growth kinetics of the NDV strains. Cells in triplicate wells of 24-well culture plates were infected with viruses at an MOI of 0.01. Culture supernatants were collected the at specific time points. The viral titers in the collected supernatants were measured by the endpoint dilution method and expressed as TCID₅₀ values.

The cells were fixed at specific time points, incubated with anti-flag antibody at 4 °C overnight, then incubated with fluorescein isothiocyanate (FITC)-conjugated secondary antibodies (Bioss Biotechnology; diluted 1:200) at 37 °C for 1 h, observed, and photographed using a Nikon Ti2-E fluorescence microscope (Nikon, Tokyo, Japan).

The total cell protein was extracted from infected or transfected cells with lysate, and the protein samples were separated using 10% SDS-PAGE, and then transferred to a polyvinylidene difluoride (PVDF) membrane (Amersham Biosciences, Freiburg, Germany). The PVDF membrane was blocked with 5% skimmed milk (wt/vol) at room temperature for 3 h and washed with 0.1% Tween 20 in Tris-buffered saline (TBST), and then incubated at 4 °C overnight with primary antibody. After being washed with TBST, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Bioss Biotechnology; 1:10,000 dilutions) at room temperature for 1 h. Observation of protein bands was performed using enhanced chemiluminescence western blotting detection reagent (CWBIO, Beijing, China).

A total RNA isolation kit (Foregene, Chengdu, China) was used to extract the total RNA from animal tissues or monolayer cells, which was then reverse transcribed into cDNA. RT-qPCR analysis used M5 HiPer SYBR Primeix Estate (Mei5 Biotechnology, Beijing, China). The gene expression was standardized to the expression of the housekeeping gene for β-actin (in BSR-T7/5 cells) or GAPDH (in DF-1 cells). Primers used were as follows: SG10-qNP-F: TTACAACTTGGTCGGGGATG, SG10-qNP-R: CGATATAAACGCATGAGCTG; qβ-actin-F: TGCTGTCCCTGTATGCCTCT, qβ-actin-R: TTTGATGTCACGCACGATTT; qGAPDH-F: ATCACAGCCACACAGAAGACG, qGAPDH-R: TGACTTTCCCACAGCCTTA.

BSR-T7/5 cells were used to detect the ability for syncytial formation. The cells were seeded into 12-well plates and transfected with pRK5-Flag-F, pRK5-Flag-F/L536A, pRK5-Flag-F/L537A, pRK5-Flag-F/L536AL537A, or pCMV-HA-HN or infected with rSG10* or rSG10*-F/L537A at an MOI of 0.1. At specific time points, the cells were washed with PBS, fixed in methanol at room temperature for 20 min, and stained with Giemsa. The stained syncytia were visualized using a Nicon eclipse Ti2 microscrope. The syncytium diameter of each image were measured analyzed with image J software. The average syncytium diameters of wild F transfected or infected groups were set at 100%, and the syncytium diameter of LL-motif mutations were expressed as fusion index, which means the relative percentages to the wild F group.

The pathogenicity of rSG10* and rSG10*-F/L537Awas investigated in 3-week-old chickens. SPF chickens were separated randomly into three groups and were inoculated with 200 µl of PBS or a dose of 10⁵ 50% egg infectious dose (EID₅₀) of virus per bird via the oculonasal route. During the 14-day observation period, the birds were observed every day and scored according to clinical symptoms: healthy, 0; sick, 1; wing drop, paralysis, torticollis, or lack of coordination, 2; prostration, 3; dead, 4. At 3, 5, and 7 dpi, three birds from each group were euthanized, and spleen, proventriculus, duodenum, cecum tonsil, lung, brain, and trachea samples were collected for viral load detection via RT-qPCR. The tissues of chickens killed on the 5th day were fixed and used for histopathological analysis.

BSR-T7/5 cells were infected with viruses at an MOI of 0.1. At 36 dpi, culture supernatants were collected and centrifuged at 5000 × g for 15 min, then layered onto a cushion of 20% (wt/vol) sucrose in PBS and ultracentrifuged at 40,000 rpm at 4 °C for 2 h in a SW41 Beckmann centrifuge tube. The resulting pellets were collected from the bottom and dissolved in 100 µl of Sodium Chloride-Tris-EDTA (STE) Buffer. Samples were boiled and analyzed by western blotting as described above. The amount of protein in the cell lysates and viral particles was estimated from the density of the protein bands using Image J software, and the budding index was calculated as follows: the amount of protein in viral particles/the amount of protein in the corresponding lysates, both normalized to the values obtained with rSG10* protein, which were set at 1.

A cell membrane and cytoplasmic protein extraction kit (Beyotime Biotechnology) was used to analyze the expression of the F protein at the cell membrane. BSR-T7/5 cells were seeded into 6-well plates and transfected with a plasmid or infected with viruses. At a specific time point, the cells were collected and the cytoplasmic and membrane proteins of the cells were separated using the extraction kit, and then analyzed by western blotting. The anti-β-actin and Anti-Na/K ATPase were used for cytoplasmic and cytomembrane marker, respectively.

To quantify the F protein cell surface expression levels by flow cytometry, BSR-T7/5 cells were seeded into 6-well plates and infected with the viruses at an MOI of 3. The infected cells were digested with 0.25% Trypsin/EDTA mixture (Beyotime, Nantong, China) at 36 h post-infection (hpi) and centrifuged at 4 °C at 2000 × g for 5 min, and then incubated with rabbit anti F antiserum (1:50 dilution) at 37 °C for 1 h. Subsequently, the cells were washed with PBS three times, incubated for 1 h at 4 °C with 1:200 diluted FITC-conjugated goat anti-rabbit immunoglobulin G antibodies, and analyzed with BD FACSCANTO II. The percentage of F-positive cells was analyzed with FlowJo software.

BSR-T7/5 cells infected with the viruses were harvested at 36 hpi, then lysed in Pierce IP lysis buffer (Thermo), and then centrifuged at 14000 × g for 10 min. The supernatants were precleared by incubation with Protein A agarose beads (Sino Biological, Beijing, China) for 2 h at 4 °C, then the supernatants were incubated with agarose beads coupled with rabbit polyclonal antibody against F protein. The resulting immunoprecipitates and cell lysates were further analyzed via western blotting analysis.

All data were analyzed using GraphPad Prism software version 5.0 (GraphPad Software Inc., San Diego, CA, USA). Statistical differences between different groups were assessed using one-way and two-way analysis of variance (ANOVA) tests. Statistical significance was set at *P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001.

Plasmids expressing the wild-type NDV strain SG10 F protein (WT-F), and mutated F protein with a single amino acid replacement of leucine with alanine at position 536 or 537 (F/L536A or F/L537A), and a variant with a double amino acid replacement (F/L536AL537A), with N-terminal Flag tags, were transfected into BSR T7/5 cells. At 36 or 48 h post-transfection, the synthesis of F protein was detected by IFA and quantified by western blotting. As shown in Fig. 1A, B, a significant reduction of F protein expression was found in the F/L537A and F/L536AL537A transfected groups (p ≤ 0.05), especially in the F/L536AL537A group in which only a small amount of F protein could be detected at 48 h post-transfection. To investigate whether the decrease in F protein expression affected syncytium formation, we co-transfected the F mutants and a plasmid encoding HN protein into BSR T7/5 cells and found that transfection of F/L537A and F/L536AL537A resulted in a reduction in syncytium diameter at 48 hpt compared with wild type F transfection group (Fig. 1C). In summary, these results demonstrated that LL-motif mutations affected F protein expression and influenced syncytium formation after transfection.

To investigate the role of LL motifs in the NDV life cycle, the LL motif-mutated NDV full-length plasmids rSG10*-F/L536A, rSG10*-F/L537A, and rSG10*-F/L536AL537A were constructed. Despite many attempts, only one mutant virus, rSG10*-F/L537A, could be successfully rescued. The mutant virus rSG10*-F/L537A was stably inherited in chicken embryo and expressed NDV-specific protein in BSR-T7/5 cells, while the recombinant virus rSG10*-F/L536A was extremely unstable during passaging and the recombinant virus rSG10*-F/L536AL537A could not be rescued successfully. Therefore, the rSG10*-F/L537A strain was used in all subsequent experiments.

The pathogenicity of the rSG10*-F/L537A strain in 3-week-old SPF chickens was evaluated. The chickens infected with rSG10* showed typical clinical symptoms at 4 days post inoculation (dpi), which reached a peak at 7 dpi (Fig. 2A). Death of chickens started at 5 dpi and the final mortality rate reached 80% (Fig. 2B). In the rSG10*-F/L537A infection group, only a few of the chickens developed mild clinical symptoms at 5 dpi, prostration was observed in only three of ten chickens during the 14-day observation period, and the final mortality rate was 20%. No clinical symptoms or deaths were observed in the control group (Fig. 2A, B). The pathological damage to target organs caused by rSG10*-F/L537A infections was much slighter than that caused by rSG10* infection. In the rSG10* infection group, gross lesions, including laryngotracheal bleeding, splenomegaly, severe bleeding of glandular gastric papilla, cecal tonsil enlargement, bleeding, duodenal hemorrhage, and necrosis, were observed. In contrast, only some chickens in the rSG10*-F/L537A infection group showed splenomegaly and slight bleeding of the glandular gastric nipple and duodenum (Fig. 2C). Microscopic evaluations of the lesions were consistent with the gross lesions. In the rSG10* infection group, epithelial-cell abscission in the trachea, lymphocyte infiltration in the lungs, massive emptying of lymphocytes in the spleen, necrosis of the lamina propria and glandular tubules in the proventriculus, massive emptying of lymphocytes in the cecal tonsil, necrosis of the lamina propria, and reduction of intestinal glands in the duodenum were observed. In the rSG10*-F/L537A infection group, only a small amount of lymphocyte infiltration in the lung, partial emptying of lymphocytes in the spleen, and necrosis of tissue in the upper lamina propria of the proventriculus were observed (Fig. 2D). The viral load in the target organs of infected chickens was detected by reverse transcription-quantitative PCR (RT-qPCR). As shown in Fig. 2E, the viral loads in the spleen, proventriculus, cecal tonsil, duodenum, and brain in the rSG10*-F/L537A-infected chickens were much lower than those of the rSG10*-infected chickens at 5 dpi. At 7dpi, the viral loads in all the infected groups were decreased, but the viral loads in the spleen and cecal tonsil in the rSG10*-F/L537A group were still lower than those in the rSG10* group. These results indicated that an LL-motif mutation could reduce the pathogenicity of NDV in chickens.

The multistep growth curves of the rSG10*-F/L537A strain were determined by infecting DF-1 and BSR T7/5 cells. The results showed that rSG10*-F/L537A had growth defects compared with rSG10* at 36–72 hpi (Fig. 3A). Next, the total nucleocapsid protein (NP) RNA level of rSG10*-F/L537A was investigated with a multiplicity of infection (MOI) of 0.01. The results showed that the total NP RNA level of rSG10*-F/L537A was significantly lower than that of rSG10* in DF1 cells (after 12 hpi) and BSR T7/5 cells (after 24 hpi) (Fig. 3B). Cells were collected at different time points after infection, and the expression level of F protein was detected by western blotting. The results showed that the expression of F protein in rSG10*-F/L537A was lower than that in rSG10* at the early stage of infection (Fig. 3C). To further investigate whether the decrease in F protein expression caused by LL-motif mutation affected syncytium formation, we determined the size of the syncytium in BSR T7/5 cells infected with recombinant virus at different time points. The results showed that syncytial formation after infection with rSG10*-F/L537A was impaired compared with rSG10* (Fig. 3D). Together these results indicated that the rSG10*-F/L537A mutant inhibited viral replication and protein expression after a low-dose infection, and further affected the formation of syncytium.

Previous research has shown that the CT region of the F protein plays an important role in the viral budding of paramyxoviruses. Therefore, to explore whether the attenuated pathogenicity of rSG10*-F/L537A was because of the reduced budding of rSG10*-F/L537A, the viral budding efficiency was investigated. After cells were infected with viruses at a MOI of 0.1, the viral protein levels in the cells and the levels of protein incorporated into viral particles in the cell supernatants were determined by ultracentrifugation and western blotting. The results showed that the F and NP protein levels of rSG10* and rSG10*-F/L537A were similar in the whole cell lysates, while in the purified virus supernatants, the levels of the F and NP proteins in rSG10*-F/L537A were lower than those in rSG10* with almost a 50% decrease observed (Fig. 4A). To further demonstrate the effect of the F/L537A mutation on viral budding, the extracellular and intracellular viral titers were quantified for cells infected with viruses at an MOI of 0.1 by determining the medium tissue culture infective dose (TCID₅₀). The results showed that there was no significant difference in the intracellular virus titer between rSG10* and rSG10*-F/L537A; however, the extracellular virus titer of rSG10*-F/L537A was lower than that of rSG10* (Fig. 4B). Overall, these results suggested that mutation of the LL motif affected viral budding, resulting in a phenotype with impaired budding.

To further investigate the mechanism of the viral budding deficiency caused by the LL-motif mutation, we examined the effects of the LL-motif mutation on viral replication, protein expression, and viral particle assembly. To eliminate the influence of viral spreading after budding, we used an MOI of 3 for infection to observe a single infection cycle of the virus [27]. We then examined the total RNA and protein expression levels of the viral NP gene at specific time points of infection. The results demonstrated that the viral gene replication and protein synthesis capabilities of rSG10* and rSG10*-F/L537A were similar after infection with high doses of the virus (Fig. 4C). We also examined the effect of the F/L537A mutation on the viral assembly process. After virus infection, the cell lysates were immunoprecipitated with a polyclonal antibody against the F protein, and then the levels of NP and HN proteins were detected by western blotting. The results showed that there was no significant difference in the assembly between rSG10* and rSG10*-F/L537A (Fig. 4D, E). These data suggested that the LL motif mutation-related budding deficiency was not caused by an impairment of the viral replication, protein synthesis, or assembly.

The F protein is synthesized in the endoplasmic reticulum and processed in the Golgi matrix before being transported to the plasma membrane. Therefore, we investigated whether LL-motif mutations affected the expression of F proteins on the cell surface. We first conducted in vitro transfection as described above. After transfection with LL-motif mutant plasmids, the expression level of F protein on the cell surface was detected by western blotting. As shown in Fig. 5A, the expression of F protein induced by the F/L536AL537A mutant at the cell surface was significantly decreased (p ≤ 0.001), while the expression levels with the F/L537A and F/L536A mutants were also decreased to some extent. Next, the F protein expression on the cell surface was also determined after viral infection. After infection, rSG10*-F/L537A induced less F protein expression at the cell surface at 28 and 32 hpi, compared with rSG10*, but the intracellular expression levels were similar (Fig. 5B). In addition, we investigated the expression of F protein on the cell membrane after virus infection by flow cytometry, and the mean fluorescence intensity (MFI) was calculated. The results showed that after the cells were infected with rSG10*-F/L537A, the number of F protein-positive cells and the MFI value were much lower than the values for rSG10*, which was consistent with the trend shown by western blotting (Fig. 5C). In conclusion, these results suggested that the LL-motif mutants resulted in impaired F protein expression on the cell membrane compared with the wild type.