Background
Methods
Selection of isolates
Study sites
Genomic DNA isolation and PCR amplification
Amplified region | Primer sequence # | Amplification condition |
---|---|---|
pfcrt gene (codons 32-119)
| Primary 20: PFCRT 1F 5'CCGTTAATAATAAATACAGGC-3' PFCRT 1R 5'CTTTAAAAATGGAAGGGTGT 3' Nested 16: PFK76T 5'-5'GGCTCACGTTTAGGTGGA3' PRK76T 5'TGAATTTCCCTTTTTATTTCCAAA 3' | 94°C 5 min; 94°C 30 sec, 56°C 1 min, 60°C 90 sec (40X), 60°C 3 min. 94°C 5 min; 94°C 30 sec, 52°C 45 sec, 72°C 45 sec sec (35X), 72°C 5 min. |
pfcrt gene (codons 181-222)
| Primary 20: PFCRT 1F 5'CCGTTAATAATAAATACAGGC-3' PFCRT 1R 5'CTTTAAAAATGGAAGGGTGT 3' Nested 48: PFA220S 5'CTTATACAATTATCTCGGAGCAG3' PRA220S 5'ATAATAAAAACAAAGTTTAAGTGT 3' | Same as for above primary 94°C 5 min; 94°C 30 sec, 51°C 45 sec, 72°C 45 sec sec (35X), 72°C 5 min. |
pfmdr-1 gene (N86Y)
| Primary 16: MDR1F 5'ATGGGTAAAGAGCAGAAAGA3' MDR1R 5'AACGCAAGTAATACATAAAGTCA3' Nested 47: MDR1FN 5'AGATGGTAACCTCAGTATCA3' MDR1RN 5'TTACATCCATACAATAACTTG3' | 94°C 5 min; 94°C 30 sec, 54°C 45 sec, 72°C 45 sec sec (35Χ), 72°C 5 min. 94°C 5 min; 94°C 30 sec, 49°C 45 sec, 72°C 45 sec sec (35X), 72°C 5 min. |
Sequence analysis
Statistical analysis
Results
Regional distribution of pfcrt and pfmdr-1 mutations
no. of isolates (%) in high P.falciparum prevalent areas | no. of isolates (%) in low P.falciparum prevalent areas | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
pfcrt haplotype
a
| Assam | Orissa | Jharkhand | West Bengal | Chhattisgarh | Maharastra |
total
| Gujarat | Goa | Tamil Nadu | Rajasthan | Uttar Pradesh |
total
|
CVMNK-A | 0 | 11(20.37) | 7(20.58) | 0 | 11(68.75) | 5(35.72) | 34(21.25) | 0 | 0 | 0 | 1(3.85) | 0 | 1(0.78) |
CVIET-S | 15(57.69) | 17(31.48) | 20(58.82) | 4(25) | 0 | 0 | 56 (35) | 0 | 1(3.85) | 0 | 0 | 0 | 1(0.78) |
S VMNT-S | 11(42.30) | 25(46.29) | 6(17.64) | 12(75) | 4(25) | 9(64.28) | 67(41.87) | 33(100) | 25(96.15) | 25(100) | 25(96.25) | 17(100) | 125(98.42) |
CVMDT-S | 0 | 0 | 1(2.94) | 0 | 0 | 0 | 1(0.62) | 0 | 0 | 0 | 0 | 0 | 0 |
CVMNK-S | 0 | 0 | 0 | 0 | 1(6.25) | 0 | 1(0.62) | 0 | 0 | 0 | 0 | 0 | 0 |
S VMNT-A | 0 | 1(1.85) | 0 | 0 | 0 | 0 | 1(0.62) | 0 | 0 | 0 | 0 | 0 | 0 |
pfmdr mutation
b
| |||||||||||||
N86 wt | 6(24) | 28(51.85) | 18(52.94) | 12(75) | 13(81.25) | 14(100) | 91(57.23) | 32(96.96) | 26(100) | 24(96) | 21(80.76) | 17(100) | 120(94.48) |
N86Y mt | 19(76) | 26(48.14) | 16(47.05) | 4(25) | 3(18.75) | 0 | 68(42.76) | 1(3.03) | 1(4) | 5(19.23) | 7(5.51) | ||
Combined genotype
a
| |||||||||||||
CVIETS -N | 3(12) | 8(14.81) | 11(32.35) | 0 | 0 | 0 | 22(13.83) | 0 | 1(3.85) | 0 | 0 | 0 | 1(0.78) |
CVIETS -Y | 12(48) | 9(16.66) | 9(26.47) | 4(25) | 0 | 0 | 34(21.38) | 0 | 0 | 0 | 0 | 0 | 0 |
S VMNT A -N | 0 | 1(1.8) | 0 | 0 | 0 | 0 | 1(0.62) | 0 | 0 | 0 | 0 | 0 | 0 |
S VMNTS -N | 3(12) | 10(18.51) | 1(2.9) | 12(75) | 1(6.25) | 9(64.28) | 36(22.64) | 32(96.96) | 25(96.15) | 24(96) | 20(76.92) | 17(100) | 118(92.91) |
S VMNTS-Y | 7(28) | 15(27.77) | 5(14.7) | 0 | 3(18.75) | 0 | 30(18.86) | 1(3.03) | 0 | 1(4) | 5(19.23) | 0 | 7(5.51) |
CVMNKA-N | 0 | 9(16.66) | 7(20.58) | 0 | 11(68.75) | 5(35.71) | 32(20.12) | 0 | 0 | 0 | 1(3.85) | 0 | 1(0.78) |
CVMNKA-Y | 0 | 2(3.7) | 0 | 0 | 0 | 0 | 2(1.25) | 0 | 0 | 0 | 0 | 0 | 0 |
CVMDTS -Y | 0 | 0 | 1(2.9) | 0 | 0 | 0 | 1(0.62) | 0 | 0 | 0 | 0 | 0 | 0 |
CVMNKS -N | 0 | 0 | 0 | 0 | 1(6.25) | 0 | 1(0.62) | 0 | 0 | 0 | 0 | 0 | 0 |
Distribution of haplotypes
Distribution of pfcrt and pfmdr-1 mutations in relation to in vivo CQ efficacy
CQ RESPONSE | ASSAMa | ORISSA | JHARKHAND | W.BENGAL | GUJARAT | GOA | TAMIL NADU | RAJASTHAN | TOTAL | |
---|---|---|---|---|---|---|---|---|---|---|
ACPR
|
pfcrt haplotype
b
| |||||||||
CVMNK-A | 0 | 11(45.83) | 7(41.17) | 0 | 0 | 0 | 0 | 1(3.85) | 19(17.92) | |
CVIET-S | 5(41.66) | 3(12.50) | 6(35.29) | 1(14.28) | 0 | 0 | 0 | 0 | 15(14.15) | |
S VMNT-A | 0 | 1(4.16) | 0 | 0 | 0 | 0 | 0 | 0 | 1(0.94) | |
S VMNT-S | 7(58.33) | 9(37.50) | 4(23.52) | 6(85.71) | 6(100) | 8(100) | 6(100) | 25(96.25) | 71(66.98) | |
pfmdr
mutation
c
| ||||||||||
N86 wt | 1(9.09) | 18(75.00) | 13(76.47) | 6(85.71) | 6(100) | 8(100) | 6(100) | 21(80.76) | 79(75.23) | |
N86Y mt | 10(90.90) | 6(25.00) | 4(23.52) | 1(14.28) | 0 | 0 | 0 | 5(19.23) | 26(24.76) | |
Combined genotype
b
| ||||||||||
CVMNKA N | 0 | 9(37.50) | 7(41.17) | 0 | 0 | 0 | 0 | 1(3.85) | 17(16.19) | |
CVMNKA Y | 0 | 2(8.33) | 0 | 0 | 0 | 0 | 0 | 0 | 2(1.90) | |
S VMNTS N | 0 | 6(25.00) | 1(5.88) | 6(85.71) | 6(100) | 8(100) | 6(100) | 20(76.92) | 53(50.47) | |
S VMNTS Y | 6(54.54) | 3(12.50) | 3(17.64) | 0 | 0 | 0 | 0 | 5(19.23) | 17(16.19) | |
S VMNT A N | 0 | 1(4.16) | 0 | 0 | 0 | 0 | 0 | 0 | 1(0.95) | |
CVIETS N | 1(9.09) | 2(8.33) | 5(29.41) | 0 | 0 | 0 | 0 | 0 | 8(7.61) | |
CVIETS Y | 4(36.36) | 1(4.16) | 1(5.88) | 1(14.28) | 0 | 0 | 0 | 0 | 7(6.66) | |
ETF
|
pfcrt haplotype
| |||||||||
CVIET-S | 2(40) | 4(66.66) | 2(100) | 1(50) | 0 | 1(11.11) | 0 | 0 | 10(40.00) | |
S VMNT-S | 3(60) | 2(33.33) | 0 | 1(50) | 1(100) | 8(88.88) | 0 | 0 | 15(60.00) | |
pfmdr mutation
| ||||||||||
N86 wt | 4(80) | 2(33.33) | 1(50) | 1(50) | 1(100) | 9(100) | 0 | 0 | 18(72.00) | |
N86Y mt | 1(20) | 4(66.66) | 1(50) | 1(50) | 0 | 0 | 0 | 0 | 7(28.00) | |
combined genotype
| ||||||||||
S VMNTS N | 2(40) | 1(16.66) | 0 | 1(50) | 1(100) | 8(88.88) | 0 | 0 | 13(52.00) | |
S VMNTS Y | 1(20) | 1(16.66) | 0 | 0 | 0 | 0 | 0 | 0 | 2(8.00) | |
CVIETS N | 2(40) | 1(16.66) | 1(50) | 0 | 0 | 1(11.11) | 0 | 0 | 5(20.00) | |
CVIETS Y | 0 | 3(50.00) | 1(50) | 1(50) | 0 | 0 | 0 | 0 | 5(20.00) | |
LTF
|
pfcrt haplotype
| |||||||||
CVIET-S | 8(88.88) | 10(41.66) | 12(80) | 2(28.57) | 0 | 0 | 0 | 0 | 32(29.35) | |
S VMNT-S | 1(11.11) | 14(58.33) | 2(13.33) | 5(71.42) | 26(100) | 9(100) | 19(100) | 0 | 76(69.72) | |
CVMDT-S | 0 | 0 | 1(6.66) | 0 | 0 | 0 | 0 | 0 | 1(0.91) | |
pfmdr mutation
| ||||||||||
N86 wt | 1(11.11) | 8(33.33) | 4(26.66) | 5(71.42) | 25(96.15) | 9(100) | 18(94.73) | 0 | 70(64.22) | |
N86Y mt | 8(88.88) | 16(66.66) | 11(73.33) | 2(28.57) | 1(3.84) | 0 | 1(5.26) | 0 | 39(35.77) | |
combined genotype
| ||||||||||
S VMNTS N | 1(11.11) | 3(12.50) | 0 | 5(71.42) | 25(96.15) | 9(100) | 18(94.73) | 0 | 61(55.96) | |
S VMNTS Y | 0 | 11(45.83) | 2(13.33) | 0 | 1(3.84) | 0 | 1(5.26) | 0 | 15(13.76) | |
CVIETS N | 0 | 5(20.83) | 5(33.33) | 0 | 0 | 0 | 0 | 0 | 10(9.17) | |
CVIETS Y | 8(88.88) | 5(20.83) | 7(46.66) | 2(28.57) | 0 | 0 | 0 | 0 | 22(20.18) | |
CVMDTS Y | 0 | 0 | 1(6.66) | 0 | 0 | 0 | 0 | 0 | 1(0.91) |