Background
Hereditary hemorrhagic telangiectasia (HHT), also known as Rendu-Osler-Weber syndrome [
1,
2], is a vascular disorder with autosomal dominant inheritance. The latest epidemiological data reveal that HHT affects approximately 1 in every 5,000 individuals [
2]. The clinical symptoms, known as the Curaçao criteria [
3], diagnose an HHT patient when at least 3 of the 4 criteria are present: epistaxis (nose bleeds), mucocutaneous telangiectases, arteriovenous malformations (AVMs) affecting mostly the lung, liver and brain, and an autosomal dominant pattern of familial inheritance. Hereditary Hemorrhagic Telangiectasia is caused by mutations in at least one of the 3 genes involved in the transforming growth factor-beta (TGF-β) signaling pathway [
4].
Endoglin (
ENG, chromosome 9q34),
Activin A receptor type II-like 1 (
ACVRL1/ACVRL1/ALK1, chromosome 12q13), and
MADH4/SMAD4 (chromosome 18q21) mutations cause HHT1 (OMIM 187300), HHT2 (OMIM 600376), and the combined Juvenile Polyposis/HHT (JP/HHT) syndrome (OMIM 175050), respectively [
5‐
7]. There are two further unidentified genes that can cause HHT: HHT 3 between 141.9 and 146.4 Mb on chromosome 5q and HHT4 on chromosome 7p between D7S2252 and D7S510.130 [
8,
9]. Recently, BMP9 mutations have been shown to give rise to HHT5, although the contribution of BMP9 mutations to HHT is estimated to be very low (<1%) [
10].
The genes that are mutated in HHT encode proteins that mediate signaling by the TGF-β superfamily. In the TGF-β signaling cascade, the type II receptor cooperatively recruits and transphosphorylates the type I receptor by direct contact with TβRI [
11]. In endothelial cells, upon ligand binding, TβRII can associate with two different TGF-β type I receptors: ALK-5 or ALK-1 [
12]. Endoglin is an auxiliary receptor that modulates both complexes in opposite manners. Thus, whereas Endoglin promotes signaling through ALK-1, it inhibits the ALK-5 pathway [
13]. In turn, ALK-1 and ALK-5 activate distinct R-Smad pathways, resulting in opposing endothelial cell responses in proliferation, migration, and pro- or anti-angiogenic gene expression.
These mutations range from single base-pair changes to large deletions of multiple exons and are of all types, including substitutions, duplications, and deletions. There are no common mutation “hotspots” in either gene, and mutations have been observed across all coding regions.
Considering substitutions, missense mutations are the most common type observed in
ENG and
ACVRL1, and mutations have been identified in all exons of both genes, including exon/intron boundaries and splice-site junctions. However, the proportion of mutations causing a frameshift or stop codon in the protein (i.e., indels and non-sense mutations) are more frequent in
ENG than in A
CVRL1 [
14‐
16].
Although many ENG mutations have been identified in the extracellular region of the protein, which is the largest part of the protein, very few mutations have been identified in the transmembrane and cytoplasmic domains [
16]. Large deletions or duplications of one or more exons account for 6–10% of all
ENG and
ACVRL1 mutations [
17]. Large deletions in the
Endoglin gene, encompassing promoter and several exons or the whole gene, have previously been described by our group [
18]. Mutations in the 5′UTR region of ENG (c.-9G > A and c.-127C > T) have also been found to cause HHT. They were determined to be pathogenic by creating an alternative, out-of-frame transcription start codon, but the possibility of altering binding sites for transcriptional factors could not be discarded. Interestingly, (c.-9G > A) is a hypomorphic variant that can be detected in a homozygous state.
These mutations emphasize the need for including the
ENG 5′UTR region in routine molecular diagnostic testing for HHT [
19]. However, to date, few mutations affecting a site in the promoter of either
Endoglin or
ACVRL1/ALK1 have been reported. A mutation in the regulatory site present in intron 6 (c.772 + 27G > C) of
ACVRL1 has been described in an HHT2 Chinese family [
20].
Although the 5′-flanking region of the
Endoglin gene lacks consensus TATA and CAAT boxes, it contains GC-rich regions and consensus motifs for Sp1, ets, GATA, and TGF-β (Smads), and estrogen-responsive elements. The upstream −400/+341 region is able to display tissue-specific activity in human endothelial cells. Analysis of various deletion constructs demonstrated the existence of a basal promoter region within the −81/+350 fragment [
21].
In the present study, we describe, for the first time, a pathogenic mutation that causes HHT type 1 by affecting a single base pair nucleotide change at the c.-58G > A position of the proximal promoter of Endoglin, which is embedded in this basal promoter region.
Methods
Patient samples
Blood samples were collected at different hospitals and sent to our institute. They were received on the day after blood extraction. Informed consent was obtained from each patient. HHT diagnosis was based on the clinical Curaçao criteria [
3]. Each sample was anonymously treated and identified with a code number.
Ethics statement request
The human blood samples and clinical data reported in this manuscript were obtained with prior approval from the appropriate ethics committees of the CSIC for the research conducted in the Centro de Investigaciones Biológicas (CIB, Madrid), the CEIC (Clinical Research Ethics Committee) of the Cantabrian Health Service for patients at the Hospital of Sierrallana (Torrelavega, Santander, Cantabria), and the Medical Genetics department of the Hospital Valdecilla (Santander, Cantabria). Research was carried out in compliance with the Helsinki Declaration (
http://www.wma.net/en/30publications/10policies/b3/index.html), keeping the results strictly confidential, with numerical codes for patient identification.
http://www.wma.net/en/30publications/10policies/b3/index.html.
DNA extraction and mutation analysis
Genomic DNA was extracted from peripheral blood, using the
QIAamp kit (Qiagen, Gmbh, Germany). The coding exons from
Endoglin, the 9 translated exons from
ACVRLK1/ALK1, including exon 1 (transcribed but not translated), the exon intron boundaries (50 bp), and the proximal promoters of both genes were amplified by PCR and then sequenced using specific primers. MLPA was also performed for both genes to detect any changes in copy number. The primer sequences and PCR conditions have already been reported [
4,
14]. PCR products, which were excised and cleaned from the gel (Millipore, Germany), were sequenced in forward and reverse orientation on an Applied Biosystems sequencer using the dye terminator sequencing kit according to the manufacturer’s instructions. Sequences were compared with the following references for
ACVRL1/ALK1: OMIM 601284 Gene ID: 94; Genomic ID: NG_009549.1; c-DNA ID: NM_000020.2; and Protein ID: NP_000011. For
ENG, the references were OMIM 131195 Gene ID: 2022; Genomic ID: NG_009551.1; c-DNA ID: NM_001114753.1; and Protein ID: NP_001108225.12. The following database was used for HHT:
http://arup.utah.edu/database/HHT/. Next, if no changes were found in the DNA sequence comparisons, MLPA [
22] was performed according to the manufacturer’s instructions using the P093 Salsa MLPA HHT/PPH1 probe set (MRC-Holland, Amsterdam, The Netherlands). DNA sequences and MLPA analyses were performed by Secugen S.L (Madrid, Spain). In the index case analyzed in this manuscript, only a change G > A, in position −58 bp of
Endoglin promoter was observed; it was considered a variation of the gene and had an unknown effect (VUS).
Site-directed mutagenesis
Site-directed mutagenesis was carried out from a construct encompassing 350 bp upstream of the transcription initiation start of ENG, including a 150-bp transcribed untranslated region before the codon start with the luciferase reporter gene in the pXP2 vector (−350/+150 ENG pXP2). Mutagenesis was performed using the Quick Change Site-Directed Mutagenesis kit from Agilent Technologies, according to the manufacturer’s instructions. These procedures were followed by DpnI digestion to eliminate the original wild type DNA template. Oligonucleotides used for the mutagenesis were: ENG -58Mut:
Fwd: 5′- CCACAGCCCTGCCACTGGACA-3′
Rev: 5′-TGTCCAGTGGCAGGGCTGTGG-3′
Cell culture
Human microvasculature endothelial cells, HMEC-1, were grown on 0.2% gelatin (Sigma-Aldrich) in PBS-coated plates in MCDB-131 medium (Gibco) supplemented with 10% FCS (Gibco), 1 ng/ml of EGF and 1 μg/ml of hydrocortisone (Sigma), 2 mM L-glutamine (Gibco) and 100 U/ml of penicillin and streptomycin (Gibco).
Transfections and luciferase assays
Superfect® Transfection Reagent (Qiagen), was used for transient transfection according to the manufacturer’s instructions. A total of 1 μg from Luciferase Plasmid Reporters DNA [either wild type or mutated (−350/+150 ENG pXP2)] and 20 ng of pSV40-βgal reporter plasmid (for transfection normalization) were incubated in Opti-MEM (Gibco) with Superfect for 15 min at room temperature. The DNA-transfection reagent complexes were added to cells that were 80% confluent in P-24 wells. Transfection was allowed to proceed for 24 h at 37 °C and 5% CO2.
Cells were lysed in 1× lysis buffer from Promega. Relative units of luciferase (Promega luciferase reagent) were measured in a Glomax luminometer (Promega), and β-galactosidase units as measured by Galacto-light (Tropix) were used to normalize transfection efficiency. Each condition was repeated in triplicate. Treatments with TGF-β1 (Preprotech) proceeded for 24 h with 10 ng/ml. The control reporters of TGF-β, CAGA-luc, and BRE-luc were used in parallel as reporter controls of the TGF-β response.
RNA gene expression
Isolation of MNCs, culture and RNA extraction
From 5 ml samples of peripheral blood from patients, the total fraction of MNCs (mononuclear cells) was isolated in a Ficoll gradient (Lymphocyte Separation Medium, Lonza). The MNC fraction was plated and cultured for 24 h in DMEM medium containing 10% fetal bovine serum (FBS, Gibco). Total RNA from these activated MNCs was isolated using the NucleoSpin RNA purification kit from Macherey-Nagel (GmbH&Co).
Quantitative RT-PCR
For quantitative analysis of ACVRL1/ALK1 and ENG transcripts, total RNA was reverse-transcribed using the Reverse Transcriptase AMV cDNA Synthesis kit (Roche). The resulting cDNA was used as a template for real-time PCR performed using the SYBR Green PCR system (BioRad), with the following primers. ACVRL1/ALK1: Fwd 5′-ATCTGAGCAGGGCGACAGC-3′ and Rev 5′-ACTCCCTGTGGTGCAGTCA-3′; ENG Fwd 5′-GCCCCGAGAGGTGCTTCT-3′ and Rev 5′-TGCAGGAAGACACTGCTGTTTAC-3′. As an internal control, mRNA levels of 18S were measured using these primers: Fwd 5′-CTCAACACGGGAAACCTCAC-3′ and Rev 5′-CGCTCCACCAACTAAGAACG-3′. Amplicons were detected using an iQ5 system (BioRad). Each experiment was performed in triplicates.
Gel shift assay (EMSA) of proximal ENG mobility
Nuclear extracts from confluent HMEC-1 cultures were obtained using a Nuclear Extract kit (Active Motif). The amount of protein was determined by the Bradford technique (Bio-Rad), and 10 μg of total nuclear extract was used for incubation with the 5′ biotinylated oligonucleotide probe from Sigma Aldrich. Complementary oligonucleotides encompassing the −69 to −56 region of
Endoglin promoter were annealed by heating 95 °C for 3 min, slowly cooling down to RT, and then incubating overnight at 4 °C.
Biotinylated wt fwd −69/-56 | 5′- GGTGCCCGCCCGCAGCCCTGCCAC -3′ |
Biotinylated wt rev −69/-56 | 5′- GTGGCAGGGCTGCGGGCGGGCACC -3′ |
The gel shift assay was carried out following the protocol of Gelshift™ Chemiluminescent EMSA. Briefly, 20 ng annealed probe was incubated with 10 μg nuclear extract in the presence of 2 μg of polydI-dC as non-specific competitor. Specific competition assays occurred with an excess (100-fold) of wt cold unlabeled annealed probe and the same amount of mutated cold unlabeled probe. Protein-DNA binding was allowed to proceed for 30 min at 4 °C; then, samples with loading buffer were loaded in a 6% non-denaturing polyacrylamide gel in 0.5× TBE and electrophoresed for 1 h at 4 °C and 150 V. Next, the DNA-protein complexes and free probe were transferred to a nylon membrane by electroblotting. DNA-protein complexes were crosslinked by UV to the nylon membrane. The membrane was processed by blocking and was then incubated with the streptavidin-HRP conjugate for 30 min. After being washed, the membrane was developed by the Super signal chemiluminescent Kit (Thermo-Scientific), according to the manufacturer instructions, and visualized with a Molecular Imager, Chemi-Doc.
Statistics
Data were subject to statistical analysis, and the results are shown as the mean ± SD. Differences in mean values were analyzed using Student’s t-test. In the figures, the statistically significant values are marked with asterisks (*p < 0.05; **p < 0.01; and ***p < 0.005).
Discussion
HHT is caused by mutations in the transforming growth factor-beta (TGF-β) signaling pathway genes
ENG,
ACVRL1/ALK1, and
SMAD4 [
5‐
7], and the more recently identified
BMP9 [
9].
Haploinsufficiency has been postulated to be the mechanism of pathogenesis leading to HHT. In this particular case, mutation (c.-58 G > A) in the promoter of Endoglin precluded Sp1 binding and the initialization of efficient transcription. Transcription proceeds normally only from the wild type allele. Therefore, the mutation described outlines a new way to generate Endoglin haploinsufficiency.
With the advent of next generation sequencing (NGS), a new era has begun in which HHT molecular diagnostics can be performed more quickly, easily, and inexpensively. McDonald and coworkers [
15] have set up multi-gene NGS panels for the rapid molecular diagnosis of HHT.
However, approximately 5-10% of individuals clinically identified as having HHT, according to the clinical
Curaçao criteria, currently have no known genetic cause [
15]. Should we look for additional causative genes or genetic modifiers beyond those already described? Alternatively, are deep intronic variants or changes in the regulatory (promoter, enhancer) regions of the already known
ENG, ACVRL1/ALK1, MADH4, and
BMP9 genes responsible for HHT, which accounts for the percentage of genetically undiagnosed patients?
Current clinical testing protocols, including whole exome sequencing (WES), only involve exons and intronic boundaries. To cover regulatory and deep intronic regions, the advent of targeted whole gene capture of the relevant loci, including introns and UTRs, would be desirable in this scenario. This issue was supported by Marchuk, and the results of the Arup group can serve as an alternative to looking for new HHT genes [
26].
Van Sant-Webb and colleagues demonstrated that some HHT patients with no known genetic cause may have a deleterious non-coding region variant in a known HHT gene [
27].
One could imagine that including longer upstream regions of the promoters (primarily ENG and ACVRL1/ALK1) and sequencing the introns would increase the feasibility to find variants affecting the splicing and regulation of the candidate genes, and the rate of genetic diagnosis would increase significantly. The importance of sequencing the entire ENG and ACVRL1/ALK1 (even SMAD4 or BMP9) genes, depending on the clinical symptoms, is clear before looking for additional genes.
Thus, the results shown in the present paper constitute an example of the last statement.
Although there have been 2 previous reports of 3 variants affecting the 5′UTR region of ENG of
Endoglin, two were pathogenic as a result of the generation of an alternative transcription start codon that was out of frame, without excluding transcription factor binding [
19]. This is the first work showing that a change in the proximal promoter of
Endoglin precludes Sp1 transcription factor binding around the −58 bp position in the minus strand. Sp1 was described as an essential factor for
Endoglin basal transcription [
23], in the absence of TATA box.
Altogether, this paper concludes that whole gene sequencing, not just coding regions, of ENG, ACVRL1/ALK1, and depending on the phenotype, even of Smad4 and BMP9, may reveal that non-coding regions play a larger role in HHT disease pathogenesis, which may help to cover the full range of genetic diagnoses in clinically diagnosed patients.
Conclusion
This manuscript constitutes the first work, to the best of our knowledge, demonstrating a mutation in the proximal promoter of Endoglin that affects the transcriptional regulation of Endoglin, downregulating it and leading to likely HHT pathogenic manifestations. The change of a single nucleotide precludes the binding of Sp1, which is an essential factor for Endoglin basal transcription, around the −58 bp location in the minus strand.
Many HHT patients with unknown genetic profiles may have mutations located in the regulatory regions of either Endoglin or ACVRL1/ALK1. This work emphasizes the need for increased coverage by sequencing of non-coding regions in the relevant loci, uncovering regions that have not been observed in exome sequencing.
It is very likely that in HHT we do not need to look for more genes but should instead consider the entire genomic sequence of ACVRL1/ACVRL1/ALK1 and ENG to identify changes in non-coding regions that may affect transcription, splicing and even translation.
Acknowledgments
This study has been supported by grants from Ministerio de Economia y Competitividad of Spain (SAF2011-23475 and SAF2014-52374-R) to L.M. Botella and Centro de Investigación Biomedica en Red de Enfermedades Raras (CIBERER). CIBERER is an initiative of the Instituto de Salud Carlos III (ISCIII) of Spain. V. Albiñana is the recipient of a contract from the Spanish Alianza of VHL and the HHT Spanish Patient Association. L. Recio-Poveda is the recipient of a contract from the HHT Spanish Patient Association, and M.P. Zafra was funded by IdiPAZ from Fundación Mutua Madrileña (Spain).