Background
Acute viral myocarditis (AVMC), a common inflammatory myocardial disease, is one of the leading causes of acute-onset heart failure and sudden death among young patients [
1,
2]. Some patients with AVMC may progress into chronic myocarditis, causing continuous destruction of cardiomyocytes and the initiation of remodeling process [
3]. Coxsackievirus B3 (CVB3), a member of the Picornaviridae family, has been identified as the most common pathogen for AVMC [
4]. Although a multitude of studies have demonstrated that the major pathogenesis of AVMC is excessively uncontrolled inflammatory responses triggered by myocardial damage following viral infection, the direct attack of the virus on cardiomyocytes is also considered a critical component for AVMC development and progression [
5,
6]. Accumulating evidence has revealed that both T helper (Th) 1 and Th17 cells play a crucial role in the early immune reaction to CVB3 infection [
7‐
9]. However, up to now, the treatment of AVMC is still mostly restricted to supportive measures as there is no specific treatment for the disease. It is essential to clarify the fundamental mechanisms responsible for AVMC.
Interleukin (IL)-38 (IL-1F10), a newly identified cytokine of the IL-1 family, is located in the IL-1 family cluster on chromosome 2 next to the genes encoding IL-1 receptor antagonist (IL-1Ra) and IL-36Ra, and shares nearly 41% homology with IL-1Ra and 43% homology with IL-36Ra [
10]. Similar to other IL-1 family members, IL-38 lacks a signal peptide and has no caspase-1 consensus cleavage site [
10,
11]. It mediates its biological effects via the specific receptor IL-36R, a partial receptor antagonist of IL-36. Therefore, IL-38 plays an antagonistic role in the pro-inflammatory effects of IL-36 cytokines, including IL-36α, IL-36β, and IL-36γ [
12]. IL-38 is an abundant, ubiquitously expressed cytokine, which can be secreted by fibroblast-like synoviocytes, peripheral blood mononuclear cells (PBMCs), keratinocytes, epithelial cells, and various immune cells, such as B cells, natural killer (NK) cells, macrophages, and dendritic cells (DCs) [
11,
12]. Abnormal expression of IL-38 has been found in many inflammatory diseases, including rheumatoid arthritis (RA), allergic asthma (AA), and systemic lupus erythematosus (SLE) [
13‐
15]. In addition, elevated serum IL-38 levels at baseline can be used to predict virological response in telbivudine-treated patients with chronic hepatitis B [
16]. Moreover, Gao and Conti have reported that IL-38 is a potential therapeutic cytokine that inhibits inflammation in viral infections, including those caused by the influenza virus and Coronavirus-19 [
17,
18]. These findings indicate that IL-38 may play an important role in the pathogenesis of diseases associated with viral infection. However, the expression and functional role of IL-38 in AVMC are still largely unknown.
To tentatively tap this field, we investigated the expression of IL-38 and IL-36R in vivo in mice with AVMC. The percentages of splenic Th1 and Th17 cells, the expression levels of Th1/Th17-related master transcription factors (T-bet and RORγt) and cytokines, and cardiac viral replication were determined. Additionally, neutralizing Anti-IL-38 Antibodies (Abs) were given to AVMC mice to further explore the effect of IL-38 on myocarditis.
Methods
Mice
Specific pathogen-free grade wild-type male BALB/c mice aged 6 weeks (production license: SCXK (Zhe) 2019-0001) were purchased from the Zhejiang Vital River Laboratory Animal Technology Co., Ltd. (Zhejiang, China). Mice were housed under standard pathogen-free conditions at the Experimental Animal Center (Fujian Academy of Medical Sciences, Fuzhou, Fujian, China). All studies were approved by the Animal Experimentation Ethics Committee of Shengli Clinical Medical College of Fujian Medical University (SYXK: 2016-0004). The experimental methods were performed in accordance with the approved guidelines.
CVB3 infection
The CVB3 (Nancy strain, a kind gift from Prof. Weifeng Wu of Guangxi Medical University) was produced in monolayers of HeLa cells (ATCC, CCL-2) and stored at −80 °C. The virus titer, determined based on a standard plaque-forming unit (PFU) assay on HeLa cells, was 1 × 108 PFU/ml. Male BALB/c mice aged 6 weeks were infected by intraperitoneal (i.p.) injection of 200 μl phosphate-buffered saline (PBS) containing 2 × 105 PFU of CVB3 to establish the AVMC models.
Induction of AVMC
A total number of 28 BALB/c mice were randomly assigned into two groups as follows: (1) Control group (n = 10) containing mice treated with i.p. injection of PBS (200 μl per mouse); (2) AVMC group (n = 18) comprising mice administered CVB3. The day of i.p. injection was defined as day 0. All surviving mice were sacrificed on day 7 after CVB3 infection. The heart, spleen, and blood were collected.
Neutralization of IL-38
To elucidate the role of IL-38 in vivo, Anti-IL-38 Abs were used to neutralize IL-38 in mice. We performed a dose–response experiment of Anti-IL-38 Abs in vivo based on the dose previously reported in the studies [
19,
20]. As shown in Additional file
1: Figure S1, mice were treated with three different doses of Anti-IL-38 Abs (25, 50, or 75 μg per mouse) by i.p. injection on day 0 and day 4 after CVB3 infection. It was observed that Abs dose of 50 or 75 μg per mouse per injection was more effective in neutralizing IL-38 expression in vivo than that of 25 μg per mouse per injection (both
P < 0.01), while there was no significant difference in effectiveness between the doses of 50 and 75 μg per mouse per injection (both
P > 0.05). Since the Abs dose of 50 μg per mouse per injection was sufficient to effectively neutralize IL-38 expression in vivo, this dose was used for subsequent experiments. A total of 55 BALB/c mice were randomly divided into four groups: 1) IL-38 neutralization (IL-38N) group [mice treated with i.p. injection of Anti-IL-38 Abs (50 μg per mouse, on day 0 and day 4, n = 15) after CVB3 infection]; 2) IgG group [mice treated with i.p. injection of IgG
2A isotype control (50 μg per mouse, on day 0 and day 4, n = 15) after CVB3 infection]; 3) PBS group [mice treated with i.p. injection of PBS (50 μg per mouse, on day 0 and day 4, n = 15) after CVB3 infection]; and 4) Sham group [untreated mice administered an i.p. injection of PBS on day 0 and day 4 (n = 10)]. Mouse Anti-IL-38 Abs and IgG
2A isotype control were obtained from R&D Systems, Minneapolis, MN, USA. The survival rates and bodyweight changes were monitored daily until day 7. The spleen and heart were removed aseptically to be measured on day 7 post CVB3 infection. Before mice were killed, the cardiac function was assessed and then serum was collected for the study.
Transthoracic echocardiography
The cardiac function of mice was evaluated non-invasively on day 7 by transthoracic echocardiography using a Vevo2100 Ultrasound System (Fujifilm VisualSonics, Bothell, WA, USA) equipped with a 40 MHz transducer-phased-array transducer. Mice were anesthetized with i.p. administration of sodium pentobarbital (1%, 50 mg/kg) and immobilized in a supine position. The parameters of heart function were recorded in two-dimensional mode, and left ventricular parasternal long-axis views were obtained in M-mode imaging at the papillary muscle level. Ventricular parameters, including left ventricular end-systolic diameter (LVESD), left ventricular end-diastolic diameter (LVEDD), fractional shortening (FS), and ejection fraction (EF) were measured and analyzed using a standard formula as described previously [
21]. The sonographer was unaware of the group allocations.
Histopathological examination
Heart ventricular tissues fixed in 10% phosphate-buffered formalin were embedded in paraffin, and sections (5 μm thick) were stained with hematoxylin and eosin (H&E) to quantify the severity of inflammation. Histopathological changes were viewed using a Leica DM2000 LED microscope (Leica, Wetzlar, Germany). Cardiac pathological scores were graded by two independent researchers in a blinded manner according to the following scoring method: 0, no inflammation; 1, 1–5 distinct mononuclear inflammatory foci with involvement of 5% or less of the cross-sectional area; 2, > 5 distinct mononuclear inflammatory foci, or involvement of over 5% but not over 20% of the cross-sectional area; 3, diffuse mononuclear inflammation involving over 20% of the area, without necrosis; and 4, diffuse inflammation with secondary necrosis and acute inflammation [
22].
Immunohistochemistry
For immunohistochemistry, the streptavidin–biotin complex method was applied. The staining was performed using a Streptavidin–Biotin Complex kit (Boster, Wuhan, Hubei, China) according to the manufacturer's instructions. The obtained sections of heart ventricular tissues were deparaffinized using xylene, followed by rehydration using alcohol and washing with PBS. The sections were microwaved in citrate buffer for 15 min to retrieve antigen and then treated with 3% hydrogen peroxide for 10 min to block endogenous peroxidase. The sections were treated with 10% goat serum (Boster) for 30 min at room temperature to block the binding of nonspecific Abs. Rabbit anti-mouse IL-38 polyclonal antibody (1: 200, Bioss, Beijing, China) was added to the sections, and incubation was performed overnight at 4 °C. Histochemical reactions were then developed using 3, 3-diaminobenzidine (Sigma-Aldrich, St. Louis, MO, USA) as the chromogenic substrate for peroxidase. Negative controls replaced the primary antibody with nonimmune goat serum, with all other steps performed as above. The semi-quantitative analysis of IL-38 deposition was performed using Image-Pro Plus 6.0 software (Media Cybernetics, Bethesda, MD, USA). For each slide, 5 randomly chosen fields at 400× magnification were photographed and analyzed by two independent pathologists uninformed of the experimental grouping to measure the integrated optical density (IOD).
Flow cytometric analysis
The spleen from each mouse was removed aseptically and dispersed through nylon mesh to generate a single-cell suspension. After red blood cells removal by Red Blood Cell Lysing Buffer (Sigma-Aldrich), the splenic mononuclear cells were washed twice in RPMI 1640 (Invitrogen, Carlsbad, CA, USA) and resuspended in RPMI 1640 medium with 10% FBS (Invitrogen). Cells were stimulated with phorbol myristate acetate (25 ng/ml, Sigma-Aldrich) and ionomycin (1 μg/ml, Sigma-Aldrich) for 5 h at 37 °C in the presence of GolgiPlug (1 μl/106 cells, BD Biosciences, Breda, the Netherlands). After stimulation, cells were collected, washed, and stained with phycoerythrin cyanine-5-conjugated anti-mouse CD4 (eBioscience, San Diego, CA, USA). Cells were stained intracellularly with anti-IFN-γ, or IL-17 mouse Abs conjugated with Alexa Fluor®488, or phycoerythrin after fixation and permeabilization according to the manufacturer's instructions (eBioscience), and then measured by flow cytometry using a FACSCalibur flow cytometer (BD Biosciences). The data were analyzed using the FCS Express 7 Research Edition software (DeNovo Software, Glendale, CA, USA).
Quantitative real-time PCR (RT-qPCR)
Total RNA was extracted from cardiac tissue using TRIzol reagent (Invitrogen), followed by transcription into cDNA with a PrimeScript™ RT reagent kit (TaKaRa, Dalian, Liaoning, China) according to the instructions provided by the manufacturer. Primers for IL-38, IL-36R, IFN-γ, IL-17, TNF-α, IL-6, T-bet, RORγt, CVB3, and the housekeeping gene β-actin were designed with the Primer Premier 5.0 software (Premier Biosoft, Palo Alto, CA, USA) and are shown in Table
1. RT-qPCR was performed in an ABI 7500 Sequence Detection System (Applied BioSystems, Foster City, CA, USA) using a SYBR® Premix Ex Taq™ II kit (TaKaRa) for detection. The thermal cycling conditions were: initial denaturation at 94 °C for 3 min, followed by 40 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s. The relative expression of target genes was normalized to β-actin mRNA expression and quantified by the 2
−ΔΔCT method [
23]. Reactions were performed in a 25 μl volume, and each sample was run at least in duplicate.
Table 1
Primers used in RT-qPCR
IL-38 | Forward: GTGAACATCGAGGACCTATACAAG |
| Reverse: TCAGTATGGGTGGAGGGTTC |
IL-36R | Forward: TGCTTCTGCTTTTCGTGGCAGCA |
| Reverse: GCCCCGTTTGTTTCTGGCGG |
IFN-γ | Forward: CTCAAGTGGCATAGATGTGGAAG |
| Reverse: GCTGGACCTGTGGGTTGTTGA |
IL-17 | Forward: CTGTGTCTCTGATGCTGTT |
| Reverse: TGGAACGGTTGAGGTAGT |
TNF-α | Forward: AGTCCGGGCAGGTCTACTTT |
| Reverse: TTGGACCCTGAGCCATAATC |
IL-6 | Forward: CCAGAAACCGCTATGAAGTTCC |
| Reverse: TTGTCACCAGCATCAGTCCC |
T-bet | Forward: AGCAAGGACGGCGAATGTT |
| Reverse: GTGGACATATAAGCGGTTCCC |
RORγt | Forward: TGCGACTGGAGGACCTTCTAC |
| Reverse: TCACCTCCTCCCGTGAAAAG |
CVB3 | Forward: CGGTACCTTTGTGCGCCTGT |
| Reverse: CAGGCCGCCAACGCAGCC |
β-actin | Forward: AATTCCATCATGAAGTGTGA |
| Reverse: ACTCCTGCTTGCTGATCCAC |
Plaque-forming assays and viral titers were performed using standard methods. A portion of heart tissue was weighed and then homogenized in 2 ml of sterile PBS, followed by three freeze/thaw cycles to lyse the cells and release the virus. After spinning at 450×g for 10 min, the supernatants were sequentially 10-diluted in RPMI 1640 medium. Virus-containing supernatants were overlaid on HeLa cell monolayers and incubated for 1 h at 5% CO2, 37 °C, in six-well plates. Cells were then washed 3 times with PBS and covered with 2 ml 0.4% agar containing RPMI 1640 and 10% FBS. To allow counting of the plaques, the cell monolayers were fixed and stained after 3 days of incubation. The viral titers were calculated as PFU per organ weight (in grams).
Cytokine assay
The serum samples were obtained by centrifugation. The level of IL-38 in mouse serum was detected by using a Mouse IL-38 ELISA kit (SND-M144, Chuzhou Shinuoda Biological Technology Co., Ltd., Anhui, China), and the levels of IFN-γ, IL-17, TNF-α, and IL-6 in serum were detected by Mouse ELISA kits (ExCell Biology Inc., Shanghai, China) according to the instructions provided by the manufacturer. The lowest detectable concentrations of IL-38, IFN-γ, IL-17, TNF-α, and IL-6 were 7.5, 4, 7, 7, and 7 pg/ml, respectively. No significant cross-reactivity or interference was observed. All samples were measured in triplicate, and the mean value was calculated.
Statistical analysis
Data are expressed as mean ± SD. Statistical analysis of data was performed by unpaired 2-tailed t-test or one-way ANOVA, as indicated. The difference in cardiac pathological scores was performed by the Mann–Whitney U test. Survival was estimated using the Kaplan–Meier method, and the difference in survival was compared by the log-rank test. Correlation between variables was determined by the Spearman rank test. All data were analyzed with GraphPad Prism 8 software (GraphPad Software, La Jolla, CA, USA). P < 0.05 was considered statistically significant.
Discussion
IL-38 has been considered as an IL-1 family antagonist for its high homology to IL-36Ra and IL-1Ra [
10]. Most studies conclude that IL-38 exerts anti-inflammatory effects in several autoimmune diseases, including RA, AA, and SLE [
13‐
15]. On the contrary, several other studies have shown that IL-38 can act as a pro-inflammatory factor, and it can modestly enhance candida-induced IL-22 and IL-17 expression in human PBMCs at a higher concentration [
12,
25]. Truncated IL-38 and mature IL-38 have an anti-inflammatory effect, whereas full-length IL-38 needs to be cleaved in an apoptosis environment to exert its anti-inflammatory effect [
26]. However, it has also been reported that knocking out IL-38 does not cause changes in pro-inflammatory cytokines and has no effect on imiquimod-induced psoriasis in mice [
27]. Therefore, IL-38 can have pro-inflammatory or anti-inflammatory properties that are likely dependent on its concentration, form, and local environment. Its functional role in CVB3-induced AVMC, if any, is hence unclear. In this study, we provide, for the first time, evidence of significant elevation in cardiac mRNA expression and protein levels of IL-38, and serum IL-38 protein in AVMC. Cardiac mRNA expression of IL-36R, the specific receptor of IL-38, was also markedly up-regulated after CVB3 infection. Moreover, it is noteworthy that the increased IL-38 levels in myocardium and serum were negatively correlated with the severity of AVMC, suggesting that IL-38 may act as a protective agent against AVMC. Further research on IL-38 will help shed new light on the pathogenesis of AVMC.
Based on the observation that the levels of IL-38 and IL-36R were elevated in AVMC, and that the IL-38 levels showed a negative correlation with the severity of AVMC, we tentatively explored the potential role of IL-38 in a mouse model of AVMC with the use of Anti-IL-38 Abs in vivo. Our experimental results demonstrated that neutralization of IL-38 exacerbated the severity of AVMC, as verified by the lower survival rate, impaired cardiac function, continuous bodyweight loss, and higher values of HW/BW and cardiac pathological scores. Aberrant IL-38 expression has been reported in many organs and tissues, such as skin, spleen, placenta, tonsil, thymus, and salivary gland [
11]. However, reports concerning the expression and function of IL-38 in inflammatory myocardial diseases remain scarce so far. Previous studies have shown that IL-38 can be a predictor of successful reperfusion and a diagnostic and prognostic marker in patients with myocardial infarction (MI) [
28]. Recently, Wei and colleagues demonstrated that inflamed cardiomyocytes and infiltrated macrophages are the main cellular source of IL-38, and that IL-38 plays a protective effect in ventricular remodeling in mice with MI [
29]. These findings, together with ours, suggest that IL-38 may be a novel therapeutic target for the treatment of inflammatory myocardial diseases.
In the early stage of CVB3 infection, direct viral invasion causes cardiomyocytes necrosis/apoptosis, which induces the infiltration of immune cells and cytokines production to regulate the host immune response. Th1 cells are known to play a crucial immunoregulatory role in both the innate and adaptive immune responses to viral infections, based on the production of IFN-γ, a broad-spectrum antiviral cytokine [
7]. Recent studies indicate that Th17 cells, which secrete the characteristic cytokine IL-17, contribute to cardiac viral replication by inhibiting Th1 cells differentiation via IL-17 signaling and promote an autoimmune response in AVMC through the excessive release of pro-inflammatory cytokines [
8,
30]. The role of IL-38 in regulating Th1 and Th17 cells responses has not been identified in AVMC. It has been reported that IL-38 exerts a protective role by preventing the activation and function of Th1 and Th17 cells in most inflammatory and autoimmune diseases [
11]. However, Chu et al
. found that IL-38 treatment attenuates the severity of SLE due to a reduction in Th17 numbers, with no influence on Th1 cells in mice [
31]. Thus, it seems that the regulatory role of IL-38 on Th1 and Th17 cells is not entirely consistent across different disease models and requires further in-depth investigation. In this study, the infiltration of Th1 and Th17 cells, as well as the levels of related cytokines in myocardium and serum were increased in mice with AVMC. Additionally, the aggravating effect of neutralizing IL-38 on myocarditis was closely associated with Th1/Th17 cells imbalance and related cytokines production during the development of AVMC, which had not been reported before. T-bet and RORγt are the master transcription factors in directing differentiation of naïve CD4
+ T cells to Th1 and Th17 cells, respectively [
32]. The present study showed that IL-38 neutralization in vivo suppressed the expression of T-bet but promoted RORγt expression, suggesting that T-bet and RORγt may be the potential targets of IL-38 neutralization in inducing Th1/Th17 cells imbalance. In an in vitro study, Chai et al
. demonstrated that Th17 cells differentiation and IL-17 production have no significant changes after the treatment with Anti-IL-38 Abs, while IL-38 recombination protein can significantly decrease percentages of Th17 cells through the suppression of p-STAT3 (another important transcription factor of Th17 cells) [
33]. Since there is no expression of IL-38 in mouse CD4
+ T cells, but mouse CD4
+ T cells display surface expression of IL-36R (IL-38 specific receptor) [
10,
11], making them capable of receiving the biological signal of IL-38 released by a large number of infiltrated immune cells (e.g., B cells, NK cells, macrophages, and DCs) during the acute phase of infection, this may be an important mechanism by which Anti-IL-38 Abs participate in the regulation of Th cells differentiation in vivo. More specifically, neutralization of IL-38 in the IL-38N group could significantly promote CVB3 replication, which was consistent with the previous observation that IL-38 contributed to resistance to viral infection [
16‐
18], further highlighting an antiviral role for IL-38 in AVMC. We then conclude that IL-38 may play a role in regulating the balance between antiviral immunity and autoimmunity in CVB3-induced AVMC.
To our knowledge, this is the first report of IL-38 being involved in the pathogenesis of AVMC. However, the study has several limitations. First, all experiments were performed exclusively in male mice. Previous studies have shown that female mice are less susceptible to CVB3 infection and less prone to develop severe AVMC than male mice, mainly due to the protective effect of estradiol [
34]. Therefore, to simplify the current study, we chose to focus on male mice. Whether Anti-IL-38 Abs have the same effect on AVMC in female mice requires further assessment. Second, it has been shown that IL-38 binds to IL-36R and exerts its effects by antagonizing the activation of intracellular signaling pathways such as JNK/AP1, p38 MAPK, ERK1/2, and NF-κB [
14,
35], which have been widely confirmed to be involved in the pathogenesis of AVMC [
2,
5,
6]. Studies on the downstream signaling pathway of IL-38 will help reveal its regulatory mechanisms in AVMC in more detail. Furthermore, recent studies have shown that IL-38 treatment can effectively reduce fibrosis in different animal models [
29,
36]. The potential role of IL-38 in chronic myocarditis and dilated cardiomyopathy is still an interesting open issue.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.