Background
Nucleotide-binding oligomerization domain (NACHT), leucine rich repeat (LRR) and pyrin domain (PYD) 7 containing protein, NLRP7, is a member of the NLR family which serves as intracellular sensors of innate immunity to regulate inflammation and cell apoptosis [
1]. The
NLRP7 transcripts have been identified in a large number of human tissues, including liver, lung, placenta, spleen, thymus, peripheral blood leukocytes, testis, and ovaries [
2]. NLRP7 has a well-studied role in regulating immune responses [
3‐
5]. In 2006, the
NLRP7 gene was also identified as a maternal locus associated with recurrent hydatidiform mole (HM), recurrent miscarriage (RM), and recurrent preeclampsia [
6]. Since then, many groups have identified mutations as well as genetic variants of
NLRP7 in women who experienced recurrent HM and RM [
7‐
10]. HM is an abnormal human pregnancy with no embryo and cystic degeneration of placental villi. It is an imprinting disorder caused by lack of maternally acquired DNA methylation at germline differentially methylated regions [
11,
12]. A report showed that NLRP7 protein affects trophoblast lineage differentiation by interacting with YY1 protein within the nucleus to alter gene methylation in human embryonic stem cells [
13].
NLRP7 is thus a maternal-effect gene involved in imprinting acquisition in the oocyte [
14,
15].
RM is the occurrence of at least two consecutive early pregnancy losses. Various factors have been identified for RM, such as impaired decidualization of the endometrium, uterine anomaly, chromosomal abnormalities, endocrine dysfunction, thrombophilia, immune disorders, lifestyle factors and maternal infections. In up to 50% of cases, the cause of RM remains undetermined [
16‐
18]. A study showed that women who experienced RM without HM have non-synonymous variants of
NLRP7 [
19]. We also found the
NLRP7 gene to be significantly associated with RM [
20]. These findings suggest that HM and RM may share the same genetic etiology in some cases, and
NLRP7 is a strong candidate gene in this context.
In humans, the rising progesterone level after ovulation induces the decidualization of stromal cells, which transform from fibroblast-like cells into epitheloid-like cells and secrete a variety of phenotypic antigens, such as IGFBP-1 and PRL [
21]. The decidualized stromal cells acquire unique biochemical and cellular properties to prepare a receptive environment for the implantation of the developing embryo, proper placentation, and pregnancy maintenance [
22,
23]. Given defective decidualization has been implicated in miscarriage and preeclampsia [
24,
25], in this study we sought to explore the link between the
NLRP7 gene and decidual function using an in vitro decidualization model.
Methods
Reagents
Rabbit anti-human NLRP7 antibody (IMG-6357A) was obtained from Novus Biologicals (Littleton, CO). Rabbit anti-human Lamin B antibody (sc-6216-R), mouse anti-human α-tubulin antibody (sc-5286), and mouse anti-human β-actin antibody (sc-47,778) were procured from Santa Cruz Biotechnology (Santa Cruz, CA). HRP-conjugated goat anti-rabbit antibody (GTX77060) and HRP-conjugated goat anti-mouse antibody (GTX213111–01) were acquired from GeneTex (Irvine, CA). A Human IGFBP-1 DuoSet ELISA kit (DY871) and normal goat serum (DY005) were purchased from R&D Systems (Minneapolis, MN). Antibody diluent with background reducing component (S3022) was procured from Agilent Technologies (Santa Clara, CA). Alexa Fluor 488-conjugated goat anti-rabbit antibody (A11008), Subcellular Protein Fractionation kit (78840), and Fast SYBR Green Master Mix (4385612) were obtained from ThermoFisher Scientific (Waltham, MA). The 3-Amino-9-ethylcarbazole (AEC) Chromogen/Substrate Bulk Kit (ACJ500) was purchased from ScyTek Laboratories (Logan, UT). MPA (M1629), 8-Br-cAMP (B5386), and mounting medium Glycerol Gelatin (GG1) for immunohistochemistry were procured from Sigma-Aldrich (St. Louis, MO). Mounting medium DAPI Fluoromount-G (0100–20) for immunofluorescence was obtained from SouthernBiotech (Birmingham, AL). Human NLRP7 full-length cDNA clone (SC323251) was obtained from OriGene. Lentiviral vectors pLAS2w.RFP-C.Pneo and pLAS2w.Pneo were procured from the National RNAi Core Facility, Academia Sinica (Taipei, Taiwan). A Cignal™ progesterone receptor (PR) reporter kit (CCS-6043 L) was acquired from QIAGEN (Germantown, MD). The Dual-Glo Luciferase assay system (E2920) was purchased from Promega (Madison, WI). A Direct-zol RNA MiniPrep kit (R2050) was acquired from Zymo Research (Irvine, CA).
Cells
The T-HESCs were purchased from ATCC (CRL-4003TM). T-HESCs were cultured in DMEM/F12 medium without phenol red (D2906, Sigma) supplemented with 10% charcoal/dextran treated fetal bovine serum (SH30068.03, HyClone), 1.5 g/L sodium bicarbonate, 1% ITS+ Premix (354,352, BD), and 500 ng/mL puromycin. T-HESCs were grown in an incubator at 37 °C under a 5% CO2 atmosphere at constant humidity. To generate an in vitro decidualization model, T-HESCs were cultured in 2% charcoal/dextran treated FBS medium with or without 1 μM MPA and 0.5 mM 8-Br-cAMP [
26]. After three days, the culture medium was renewed with the same treatment. On day 6, the decidualization was confirmed by observing the enlarged rounded cell shape under a microscope and measuring the expressions of IGFBP-1 and PRL by quantitative reverse-transcription PCR (qRT-PCR) or the IGFBP-1 protein in the supernatant by ELISA.
Quantitative reverse-transcription PCR (qRT-PCR)
RNA samples of T-HESCs treated with or without MPA and 8-Br-cAMP were isolated by the Direct-zol RNA MiniPrep kit, with 2 μg of each sample being subjected to reverse transcription into cDNA. The expressions of IGFBP-1, PRL, and NLRP7, as well as glyceraldehyde 3-phosphate dehydrogenase (GAPDH), were quantified using a StepOnePlus real-time PCR apparatus (Thermo Fisher Scientific, LA, USA). Primers used for this study included: PRL forward primer: 5′ TCATCTGGTCACGGAAGTACGT 3′; PRL reverse primer: 5′ GCCCTCTAGAAGCCGTTTGG 3′; IGFBP-1 forward primer: 5′ ATGGCTCGAAGGCTCTCCAT 3′; IGFBP-1 reverse primer: 5′ TCCTGTGCCTTGGCTAAACTC 3′; NLRP7 forward primer: 5′ CTTCTGTGCGGATTCTTTGTGA 3′; NLRP7 reverse primer: 5′ TTTTTAATCTCCACTTTCTGCAGATG 3′; GAPDH forward primer: 5′ TGAAGGTCGGAGTCAACGGATT 3′; GAPDH reverse primer: 5’CCTGGAAGATGGTGATGGGATT 3′. PRL and IGFBP-1 primers were designed by using Primer Express® Software for Real-Time PCR (Version 3.0) from Applied Biosystems. NLRP7 and GAPDH primers were obtained from the literature [
27,
28]. The qRT-PCR was performed using Fast SYBR Green Master Mix following the manufacturer’s instructions. Briefly, the PCR conditions were as follows: Step 1: 95 °C for 20 s for enzyme activation; and, Step 2: 40 cycles consisting of 95 °C for 3 s for denaturing, and 60 °C for 30 s for annealing/extending. A melt curve analysis was carried out on the products of the amplification reaction to ascertain the melting temperatures of these. The conditions were as follows: Step 1: 95 °C for 15 s; Step 2: 60 °C for 1 min; and, Step 3: 95 °C for 15 s. The amplicons were detected and quantified using SYBR Green dye. StepOne Software v2.3 (Applied Biosystems) was used to quantify the levels of expressions.
Western blotting
The cell lysates were collected from T-HESCs treated with or without MPA and 8-Br-cAMP. The subcellular protein fractions were extracted by using the Subcellular Protein Fractionation kit. The total cell lysates or subcellular protein fractions were combined with 6X protein loading buffer (v/v = 5:1) and denatured in boiled water for 10 min. The treated cell lysates were then subjected to SDS-PAGE and thereafter transferred to PVDF membranes. After blocking, the membranes were incubated with the different primary antibodies, such as NLRP7, Lamin B, α-tubulin and β-actin at 4 °C overnight. Lamin B and α-tubulin were used as the nuclear marker and the cytosol marker, respectively. Bands were visualized using peroxidase-conjugated goat anti-mouse IgG and ECL plus reagents.
ELISA
The supernatants of T-HESCs treated with or without MPA and 8-Br-cAMP were collected for detecting the IGFBP-1 protein by ELISA. The analysis was performed according to the manufacturers’ protocols. The cytokine productions were normalized according to the concentrations of cell lysate of the adhered cells, which were mostly alive.
Immunohistochemistry
Endometrial samples were obtained from five legal abortions of first trimester pregnancies (between 8th and 12th week of gestation) with the permission of the ethical committee of the National Cheng Kung University Hospital. Endometrial samples obtained from five non-pregnant women who underwent diagnostic hysteroscopy served as the control. Donors signed an informed consent form approved by the Institutional Review Board of National Cheng Kung University Hospital (Tainan, Taiwan, Republic of China). The 4-μm tissue sections of the paraffin-embedded tissue underwent deparaffinization and rehydration. After blocking endogenous peroxidase activity by hydrogen peroxidase, the tissue sections were incubated with 5% normal goat serum in Tris-buffered saline, 0.05% Tween 20 (TBST) for 1 h. The tissue sections were then incubated with anti-human NLRP7 antibody diluted by the antibody diluent (1:50) at 4 °C overnight. After washing with the TBST, the tissue sections were incubated with HRP-conjugated goat anti-rabbit antibody diluted by the antibody diluent (1:200) at room temperature for 1 h. After washing with the TBST, the AEC substrate was added on the tissue sections. When red signals were observed, the tissue sections were washed with water and stained with the counter stain hematoxylin. The tissue sections were mounted using glycerol gelatin and observed with a microscope.
Immunofluorescence
T-HESCs were cultured on coverslip and treated with or without MPA and 8-bromo-cAMP on day 0 and day 3. on day 6, the cells were fixed and permeabilized using 3.7% formaldehyde and 0.5% Triton X-100, respectively. After blocking in 5% normal goat serum in TBST for 1 h, the cells were treated with anti-human NLRP7 rabbit antibody diluted by the antibody diluent (1:50) at 4 °C overnight. After washing, the cells were incubated with Alexa Fluor 488 conjugated anti-rabbit antibody diluted by the antibody diluent (1:400) at room temperature for 1 h. After washing with the TBST, the cells were mounted using the DAPI Fluoromount-G and the signals of NLRP7 and DAPI were observed using a confocal fluorescence microscope (FV1000, Olympus).
siRNA transfection and lentiviral infection
To down-regulate NLRP7 expression in T-HESCs, NLRP7 siRNA, 5′ GATGGCAAGAAACTGGCAGAA 3′ and negative control siRNA, 5′ UUCUCCGAACGUGUCACGUTT 3′ were used. T-HESCs were transfected with NLRP7 siRNA, denoted as T-HESCs (siNLRP7), and treated with or without MPA and 8-Br-cAMP on the same day. T-HESCs transfected with negative control siRNA, denoted as T-HESCs (siCtrl), served as the control group. On day 3, T-HESCs (siNLRP7) and T-HESCs (siCtrl) were transfected again with NLRP7 siRNA and control siRNA, respectively, and then treated with or without MPA and 8-Br-cAMP. On day 6, the cell pellets were collected for analyzing the expressions of NLRP7 and the supernatants were collected for detecting the expression of IGFBP-1.
The lentivirus system was used to up-regulate NLRP7 expression. The NLRP7 cDNA fragment was cloned into pLAS2w.Pneo vector to construct the NLRP7 expression vector. The pLAS2w.RFP-C.Pneo vector is a RFP expression vector that served as a control. The vectors were sent to the RNAi Core Facility of National Cheng Kung University Hospital to generate the NLRP7-expressed lentivirus (LV-NLRP7) and control RFP-expressed lentivirus (LV-RFP). Then, T-HESCs were infected with LV-NLRP7 or LV-RFP overnight and then selected by puromycin (0.5 μg/ml) for two weeks. The lentivirus-infected T-HESCs were treated with or without MPA and 8-Br-cAMP simultaneously. On day 6, the cell pellets were collected to analyze the expression of NLRP7 and the supernatants were collected to detect the expression of IGFBP-1.
PR activity assay
The Cignal™ PR reporter kit was used to measure the activity of progesterone receptor-induced signal transduction pathways. The PR reporter is a mixture of a PR-responsive luciferase construct and a constitutively expressing Renilla element (40:1). The control reporter is a mixture of a non-inducible firefly luciferase construct and constitutively expressing Renilla luciferase construct (40:1). T-HESCs cultured in 96-well plates (1 × 104 cells/well) were co-transfected with 100 ng PR reporter and 100 ng NLRP7-expressed vector or 100 ng RFP-expressed vector for 24 h. The cells co-transfected with the control vectors and NLRP7-expressed vector or RFP-expressed vector served as the negative control. After transfection, these cells were treated with 1 μM MPA and 0.5 mM 8-Br-cAMP for 24 h. The firefly and Renilla luminescence of the transfected cells were measure using a Dual-Glo Luciferase assay system (Promega, E2920) and plate-reading Luminometer (CentroPRO LB 962, Berthold Technologies). The ratio of firefly:Renilla luminescence in each well was calculated. The ratios of the PR reporter-transfected wells were normalized to those of the negative control reporter-transfected wells.
Statistics
The results of ELISA and qRT-PCR are represented as means ±SD. Differences between groups were assessed by ANVOA, with a p-value less than 0.05 considered statistically significant.
Discussion
NLRP7 is a cytosolic protein and has diverse functions in the areas of immunity and reproduction. Given that defective decidualization of the endometrium has been implicated in miscarriage and preeclampsia [
24,
25], our immunohistochemistry results show that NLRP7 is expressed in the first trimester endometrium. Therefore, we explored the link between NLRP7 and decidualization of endometrium in this study. A report showed that the level of PRL production, as well as intracellular cAMP levels of endometrial stromal cells, both increased after nine days of progesterone treatment only [
30]. Used in combination with cAMP analog treatment, this can sensitize the cells to progesterone and accelerate the decidualization [
31]. In this study, we established in vitro decidualization by the treatment of MPA and 8-Br-cAMP to induce the decidualization of T-HESCs in a short time frame [
26]. In the human endometrium, the morphologically epitheloid-like changes of stromal cells associated with decidualization are first apparent approximately nine days after ovulation [
32]. In this study, we found the epitheloid-like appearance of the decidualized T-HESCs and the NLRP7 expression was up-regulated during the decidualization process. Whether the expression of NLRP7 was regulated by the treatment directly or not awaits further investigation. NLRP7 knockdown suppressed decidualization according to the reduced IGFBP-1 level. Although it could be argued that the reduced IGFBP-1 expression was due to the off-target effect of siRNA, overexpressed NLRP7 also upregulated the IGFBP-1 expression as the stromal cells underwent decidualization. We speculate that while NLRP7 contributes to in vitro decidualization, NLRP7 itself is not sufficient to induce decidualization.
In human pregnancy, progesterone acts via the PRs to regulate the expression of target genes for decidualization [
33]. Microarray data showed that decidualization involves reprogramming of gene expression in human endometrial stromal cells [
34‐
37]. Upon progesterone binding, PRs recognize specific response elements located in the promoter region of target genes. Many co-activators or co-repressors are also recruited to the DNA-bound receptors to help modulate gene transcriptions. Besides, PRs can also directly activate multiple signaling pathways to regulate gene expressions [
38‐
40]. In this study, we further found that the overexpressed NLRP7 was able to promote the transcription activity of PR and the native NLRP7 relocalized to the nucleus after in vitro decidualization of endometrial stromal cells. Indeed, some of NLR family members have cytosolic recognition-independent functions. For example, the class II trans-activator, CIITA, was reported to associate with transcription factors and coordinate histone modifications in the promoter to regulate the MHC class II gene expression [
41,
42]. The NLR Family CARD Domain Containing 5, NLCR5, was found to bind and trans-activate the promoters of MHC class I genes [
43]. NLRP3 was demonstrated to act as a key transcription factor in the Th2 differentiation of CD4+ T cells [
44]. A recent study directly showed that the transiently expressed NLRP7 trapped and relocalized the nuclear transcription repressor ZBTB16 to the cytoplasmic juxtanuclear aggregate in HEK293T cells, and diffusely colocalized with the transient expressed KHDC3L in the cytoplasm and in the juxtanuclear aggregates [
45]. It is plausible to speculate that NLRP7 could be a transcription cofactor of PR and involved in the decidualization process. However, further study is needed to explore whether and how NLRP7 is involved in the decidualization process.
Alternative splicing creates different NLRP7 protein isoforms. There are six
NRLP7 transcript isoforms. Of these, five differ in the numbers of the C-terminal LRR domains and have around 963–1065 amino acids (MW ~ 105–118 kDa), and one isoform lacks the central NACHT domain and has 672 amino acids (MW ~74 kDa) [
29]. In the in vitro decidualization model, two NLRP7 protein isoforms were dominantly detected. The small one with a molecular weight close to 100 kDa seemed to be important for decidualization considering only this isoform was translocated into the nucleus. NLRP7 siRNA also only down-regulated the small isoform, and interfered with the decidualization process, while preserving the large isoform. Because the LRR domain of NLRP7 is responsible for the recognition of pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) or protein-protein interaction [
46,
47], the two isoforms that differ in the number of LRR domains may have distinct functions in the endometrial stromal cells. Data supporting the aforementioned hypothesis comes from two previous studies, in which NLRP7 proteins carrying mutations in the LRR regions caused dysregulated IL-1β expression in the LPS-stimulated monocytes or reconstituted NLRP7 inflammasome [
3,
5]. The target site of NLRP7 siRNA was located in the N-terminal PYD domain in order to suppress all isoforms. However, only the small form was affected by siRNA in this study. It was thus suggested that the secondary structure of RNAs or RNA binding proteins may interfere with an siRNA’s efficacy [
48]. Different
NLRP7 transcript isoforms may present with distinctive 3D structures to respond to small interfering RNA. Many mutations of NLRP7 have been reported in women with recurrent HM or RM [
10,
49]. However, the inflammasome functions of NLRP7 mutations and their effects on reproduction are not clear. Considering the canonical role of NLRP7 in immunoregulation, loss-of-function mutations of the NLRP7 gene could enable HM patients to tolerate growth of moles due to impaired immune surveillance [
5]. On the other hand, gain-of-function mutations of NLRP7 genes may render patients hyperactive to infections and lead to excessive or auto-inflammation [
3]. The inflammasome effects of the NLRP7 and the different isoforms of NLRP7 on the decidualization deserve further investigation.