Novel mutations in PANK2 and PLA2G6 genes in patients with neurodegenerative disorders: two case reports

An 8- year- old Iranian girl was admitted to Namazi Hospital (Shiraz, Iran) in 2015 with clinical diagnosis of dystonia. She was apparently normal before the age of 4 years but after that she developed bone fracture, muscle rigidity, abnormal movement, lack of coordination, chorea, and dystonia with seizure attacks. She was intellectually normal but she had speech problem due to the use of medications including Sirdalud (Tizanidine), Gabax, trihexidine, and NA Valporate.

Multiplanar multisequential MRI were taken through the brain with usual protocol which demonstrated normal signal intensity of both cerebral hemispheres with no sign of mass, hemorrhage, and ischemic infarction. Hydrocephalus and shift of midline structure were not found. Posterior fossa structures including cerebral hemispheres showed normal signal intensity without any mass, hemorrhage, and ischemic infarction. 7the-8the nerve root complexes appeared normal and pituitary gland was also normal without the sign of gross mass. Also, extra-axial mass, hematoma, and fluid collection were not observed. It is worth noting that generalized cortical atrophy was considerable which was more than that of expected for the patient’s age. In addition, mucosal thickening was noted at both ethmoidal maxillary sinuses due to sinusitis. Moreover, mild inflammatory change at right mastoid air cells and the “eye-of-the-tiger” sign in MRI were remarkable (Fig. 1). But, M.R.I of the cervical spine without contrast showed normal features. Paraclinical examinations were also requested which showed increased level of alkaline phosphatase (ALP) (191 U/L) and creatine phosphokinase (CPK) (456 U/L).

The proband died at the age of 9 years with the severe abnormalities mentioned above. Now, her family would arbitrarily prefer to use the identified mutation for prenatal diagnosis which may help them to have a healthy child.

One and half- year-old boy from Afghanistan with muscle weakness at the onset of disease (a case of neuromuscular disease) was admitted to comprehensive children's development in Emam Reza Hospital (Shiraz, Iran) in 2014. Diagnostic evaluations were brain MRI and abdominal and pelvic ultrasonography. There were no intellectual impairments and hepatosplenomegaly at the age of one and half year. At the age of two, he showed neurodevelopmental regression (speech, motor and cognition) and floppy infant (hypotonia) but there were no deep tendon reflexes (DTR) and seizure. The ultrasonography showed normal features but MRI revealed only a minimal change of periventricular white mater which could be due to mild delayed myelination. Up to now, he has not been on any treatments. Two of his sisters died at the age of 4 and 6 years with similar phenotypes but with more severe neurodevelopmental abnormalities starting at the age of 8 months, in which they were not able to speak completely and they could not cry with any voices but only it could be recognized with tears on their eyes.

Comprehensive laboratory examinations were also requested, including hematology, biochemistry, hormone, and urine analysis. The positive and abnormal findings for this patient were the decreased level of hemoglobin (Hb) (11.8 g/dL), hematocrit (HCT) (34.5%), mean corpuscular volume (MCV) (68.73 fL), mean corpuscular hemoglobin (MCH) (23.51 pg), and increased level of CPK (1124 U/L), lactate dehydrogenase (LDH) (542 μ/L), and aspartate aminotransferase (AST, SGOT) (64 U/L) enzymes. In addition, genetic tests for Spinal Muscular Atrophy (SMA) and Duchenne Muscular Dysrtrophy (DMD) disease showed negative results and therefore Whole Exom Sequencing (WES) was suggested to the family.

WES was utilized for amplification and sequencing of all exons of protein-coding genes as well as some of other important genomic regions. The DNA samples were sequenced, using Illumina HiSeq2000 machine and standard Illumina protocol for pair-end 99-nucleotide sequencing. WES detail of coverage and number of reads are listed in Table 1. Briefly, NGS was performed to sequence close to 100 million reads on Illumina HiSeq2000 Sequencer. In general, test platform examined >95% of the targeted regions with sensitivity of above 99%. In this test, point mutations and micro-insertion/deletions and duplication (<20 bp) can be simultaneously detected. Bioinformatics analysis of the sequencing results was performed using BWA aligner [31], GATK [32] and annovar [33] open access software as well as public databases and standard bioinformatics software such as CADD-Phred, SIFT, PolyPhen, GERP, PhastCons, LRT, Mutation Assessor, Mutation Taster, and other programs.

For confirmation of novel mutations, whole blood samples from family members of the probands were collected in EDTA tubes and then genomic DNA was extracted from the peripheral blood lymphocytes by QIAamp DNA Blood Mini Kit (Germany) according to the manufacturer’s instructions. After that, the genomic DNA concentration was measured by NanoDrop (ND1000, USA) and stored at −20 °C until use. PCR was then performed for the probands and their parents using following primers: F-PANK2:GTGTTGTCCTGGAACTGTCTG and R-PANK2 CCCACCCCAAATGACTACATTTA (PCR product: 563 bp) to amplify exon 5 of PANK2 and F-PLA2G6: GCCAATAAGACCTCCAATC and R-PLA2G6: GTCACTTTTACCTCCCACTC (PCR product: 515 bp) to amplify exon 2 of PLA2G6. Then, amplified DNA was subjected to Sanger sequencing using both forward and reverse primers according to ABI BigDye Terminator Cycle Sequencing Kit (Applied Biosystems®, USA). Sanger sequencing data was analyzed using NCBI BLAST and CodonCode Aligner software. Multiple sequence alignment analysis extracted from Polyphen website was also used to compare the amino acid sequence of human PANK2 and PLA2G6 proteins with corresponding proteins across all Kingdoms. Following bioinformatics software and websites were also used to identify the features of PANK2 and PLA2G6 and the consequences of mutations in the given position of the proteins: Polyphen, Mutation Taster, SIFT, STRING software (search tool for the Retrieval of Interacting Genes/Proteins: string.​embl.​de/) and DISOPRED3 (Intrinsic disorder predictor).

Sequences text files obtained from WES were aligned using BWA aligner tool and variants were identified using GATK and annotated utilizing annovar software. In total, more than 120 K annotated variants were identified with hetero/homo ratio of 1.6 to 1.8, which then were filtered based on their frequency, location, functional consequences, inheritance pattern, and more importantly clinical phenotype. In family I, a novel deleterious homozygous four-nucleotide deletion causing frameshift mutation (NM_153638: exon 5, c.1426_1429delATGA, p.M476 fs) was identified in PANK2 gene. Mutations and small deletions in PANK2 gene have been reported in patients with NBIA1(OMIM: 234,200). The disease is also called PKAN and apparently causes dystonia in affected individuals. Regarding the family II, a novel deleterious homozygous missense mutation was found in PLA2G6 gene (NM_001004426: exon 2: c.3 G > T: p.M1I). These identified mutations were not reported before and therefore, are classified as the variants of unknown significance (VUS). Following evidences can confirm that this PANK2 mutation results in PKAN: 1- WES using NGS revealed only this mutation to be the cause of PANK in the patient. 2- As shown in Fig. 2a, using Sanger sequencing, the mutation was confirmed in the proband and the inheritance pattern based on heterozygote mutation identified in her parents must be an autosomal recessive mode. 3-This four-nucleotide deletion (c.1426_1429delATGA) causes frameshift after codon 476 in PANK2 protein, leading to the premature translation termination which can make it highly likely to contribute to the observed phenotype in the patient. 4- Despite the mutation is in the 3′ end of the open reading frame of this protein, it is predicted that it can produce a completely nonfunctional truncated polypeptide since one of the reported transcript for this gene (ENST00000336066.​7, V9GYZ0) with the absence of all amino acids after position 279 is resulted in the nonsense mediated decay (Fig. 2b). Inaddition, using Clustal W Multiple Sequence Alignment (Fig. 2c), it can be seen that after codon 191 all amino acid are included in all functional isoforms of PANK2, representing the vital presence of these codons in the protein. 5- This mutation is close to similar mutations in PANK2 gene that have been reported to cause NBIA in the basal ganglia of the brain. 6- According to Mutation Taster online software, this variation is predicted to be a disease causing variant 7- The comparative amino acids alignment of PANK2 protein across all Kingdoms was also performed using multiple sequence alignment analysis extracted from Polyphen website and, as shown in Fig. 2d, residue in this region is highly conserved during evolution. As a result, these evidences can prove that this deletion mutation in PANK2 gene can be the genetic cause of PANK in family I.

Regarding the PLA2G6, following evidences can prove that its mutation in our patient results in PLAN: 1- c.3 G > T mutation is caused the first codon, ATG, to be shifted, leading to abnormal protein and making it highly likely to contribute to the observed phenotype in the patient. 2- This mutation is close to similar mutation in first codon of PLA2G6 gene (Met1Val) [28] that has been reported to lead to the NBIA (INAD1 form) 3- WES identified only this mutation to be the main cause of PLAN in the patient. 4- As shown in Fig. 3a, using Sanger sequencing, the mutation was confirmed in the proband and on the basis of identified heterozygote mutation in his parents, the inheritance pattern must be an autosomal recessive mode. 5- Mutation Taster, SIFT, and Polyphen online software predicted that this variation will be damaging 6- As can be seen in Fig. 3b, the comparative amino acids alignment of PLA2G6 protein across all Kingdoms using multiple sequence alignment analysis extracted from Polyphen website showed that this residue is highly conserved during evolution. 7- Intrinsic disorder profile for PLA2G6 predicted by DISOPRED3 revealed that amino acids in some region of protein including the first amino acids are considered disordered when the dark line is above the gray dashed line (Fig. 3c). This amino acids are also involved in protein binding and, therefore they are very important in its functional state (Fig. 3c). As a result, this mutation in PLA2G6 gene can lead to the PLAN in the family II.