Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose

African green monkey kidney fibroblasts (CV-1) were purchased from the American Type Culture Collection (ATCC). CV-1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic–antimycotic solution. Human pancreatic cancer cell lines PANC-1, MIA PaCa-2, BxPC-3, SU.86.86 and AsPC-1 were purchased from ATCC. Capan-1 was a kind gift from Dr. T. Ku’s lab (City of Hope, Duarte, CA, USA). All pancreatic cancer cell lines were cultured in Roswell Park Memorial Institute medium (RPMI) 1640 supplemented with 10% FBS and 1% antibiotic–antimycotic solution. Media and supplements were purchased from Corning (Corning, NY). All cells were maintained in a humidified incubator at 37 °C and 5% CO₂. Cell lines were authenticated by Genetica^® DNA Laboratories.

Cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, VACV strains Western Reserve, International Health Department, Elstree, CL, Lederle-Chorioallantoic (LC) and AS were purchased from ATCC. CV-1 cells were used for both amplification and titration of these orthopoxviruses.

Chimerization of orthopoxviruses was achieved by co-infecting CV-1 cells with all the aforementioned strains of orthopoxvirus. Following the co-infection, one hundred individual plaques were picked and subjected to a total of three rounds of plaque purification in CV-1 cells to obtain 100 clonally purified chimeric orthopoxviruses. High-throughput screening was used to compare the cytotoxic efficacy of these chimeric clones and the parental strains against the NCI-60 panel. CF33 was selected as the chimeric isolate that demonstrated superior cell killing in the NCI-60 panel when compared to all parental viruses and other plaque-purified isolates.

To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). The two fragments were joined together using the method of gene splicing by overlapping extension [9]. The resulting fragment was digested with NdeI and EcoRI and cloned into plasmid pGPT to yield p33NC-TK. The flanking sequences of TK in the shuttle vector were confirmed by sequencing. p33NC-TK contains the left and right flanking sequences of TK separated by SacI, SalI, BamHI, NheI and NotI, and Escherichia coli guanine phosphoribosyltransferase (gpt) gene driven by the VACV early promoter p7.5E as a transient dominant selectable marker.

The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′. The PCR fragment was digested with SacI and BamHI and cloned into plasmid p33NC-TK to yield p33NCTK-H5-Emerald. The sequence of the Emerald expression cassette was confirmed by sequencing. To generate a shuttle vector containing the firefly luciferase expression cassette with the VACV H5 promoter, the firefly luciferase cDNA was PCR-amplified from the plasmid pCDNA3.1(+)/Luc2 = tdT (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGGTCGACCACC ATGGAAGATGCCAAAAACATTAAGAA GGGCCCAGC-3′ and 5′-GCGGGATCCATAAA AATTAATTAATCACACGGCGAT CTTGCCGCCCTTCTTGGCCTTAATGAG-3′. The PCR fragment was digested with SalI and BamHI and cloned into the same-cut p33NCTK-H5-Emerald replacing Emerald to yield p33NCTK-H5-Fluc2. The sequence of the firefly luciferase cDNA was confirmed by sequencing.

CV-1 cells were infected with CF33 at a multiplicity of infection (MOI) of 0.1 for 1 h and then transfected with p33NCTK-H5-Fluc2 by use of jetPRIME in vitro DNA & siRNA transfection reagent (Polyplus-transfection Inc., New York, NY). Two days post infection, infected/transfected cells were harvested and the recombinant viruses were selected and plaque purified as described previously [10].

PANC-1, MIA PaCa-2, BxPC-3, SU.86.86, AsPC-1 and Capan-1 were seeded in 96 well plates (3 × 10³ cells per well) and infected with CF33 or CF33-Fluc at MOIs 1, 0.1, 0.01 in triplicate. A daily cell viability assay was performed by adding 20 μL of CellTiter 96^® AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI) to all wells. Absorbance was measured after 1 h of incubation at 495 nm using a plate reader for 8 days (Tecan, Männedorf, Switzerland). Experimental results were standardized to a media only and mock-infected control in each cell line. This experiment was repeated to ensure validity. The ability of CF33-Fluc to replicate in PANC-1, MIA PaCa-2, BxPC-3, SU.86.86, AsPC-1 and Capan-1 was evaluated by a previously described viral growth assay at an MOI of 0.01 for time points 24, 48, and 72 h in duplicate and repeated [11].

PANC-1 and MIA PaCa-2 cells were seeded in 6-well plates and infected next day with CF33 at an MOI of 5 or mock-infected with the virus diluent. Sixteen hours post-infection, the cells were harvested using 5 mM EDTA and washed three times with PBS. Cells were then stained with Alexafluor-488 conjugated anti-calreticulin antibody (ab196158; Abcam, Cambridge, MA) or an isotype antibody (ab199091; Abcam, Cambridge, MA) for 1 h. Stained cells were washed 3 times with FACS buffer, fixed with 4% paraformaldehyde and analyzed on a BD Accuri C6 flow cytometer.

PANC-1 and MIA PaCa-2 cells were seeded in 6-well plates and infected next day with CF33 at an MOI of 5. Sixteen hours post-infection, supernatants were collected and ATP concentration was measured by the ATP Determination kit (Cat# A22066; Invitrogen, Carlsbad, CA) following manufacturer’s instructions.

PANC-1 and MIA PaCa-2 cells were seeded in 6-well plates and infected next day with CF33 at an MOI of 5. Supernatants were collected from infected wells at the indicated time points and concentrated using a column with 3 kDa size cutoff. The concentrated supernatants were loaded (25 μL/well) and ran on a 12% SDS-PAGE. HMGB1 was detected using a rabbit anti-HMGB1 antibody (Cat# ab18256; Abcam, Cambridge, MA) at 1:500 dilution followed by an HRP-labeled goat anti-rabbit secondary antibody (Cat# ab205718; Abcam Cambridge, MA) at 1:5000 dilution.

All animal studies were conducted under a City of Hope Institutional Animal Care and Use Committee (IACUC)-approved protocol (IACUC #15003). Forty-one 6-week old Hsd:Athymic Nude-Foxn1 ^nu female mice (Envigo, Indianapolis, IN) were purchased, acclimatized and bilateral flank tumors were generated by injecting 1.25 × 10⁶ PANC-1 (per injection site) in 100 µL PBS containing 50% matrigel. Mice were grouped into three well-matched groups based on their tumor size: PBS injected alone (n = 10), 10³ plaque-forming units (PFU) of CF33 (n = 6), or 10⁴ PFU of CF33-Fluc (n = 17). A left-sided intratumoral injection was given when volume of left tumor reached 240 mm³ in each mouse. A tenfold higher dose was given in the CF33-Fluc group to ensure visualization on luciferase imaging. Two mice in the PBS group and four mice from the CF33-Fluc treatment group were euthanized on days 3, 13 and 27. Bilateral tumors and organs (heart, lung, liver, spleen, kidney, ovary, brain) were harvested. Tissues were divided into two halves, one half was snap frozen for the purpose of virus titration and the other half was formalin-fixed for immunohistochemical analysis. The remaining mice were euthanized on day 49. In a separate experiment, 8 mice were implanted with 2 × 10⁶ MIA PaCa-2 cells to obtain bilateral flank tumors as described for the PANC-1 model. Mice received a left sided intratumoral injection of PBS alone (n = 3) or 10⁵ PFU of CF33 (n = 5) in 50 µL PBS when tumor volume reached 400 mm³. All MIA PaCa-2 xenograft-bearing mice were euthanized at the termination of the experiment on day 43.

For the evaluation of anti-tumor efficacy, tumors were measured twice weekly and tumor volume was calculated using V (mm³) = (1/2) × A² × B where A is the shortest and B is the longest diameter. Percent tumor change was calculated from the date of intervention. Virus shedding was determined by performing standard plaque assays on urine, stool and blood samples. Stool and urine from four PANC-1 bearing mice, injected with 10⁴ PFU of CF33-Fluc, was collected twice per week for 1 month post-treatment and blood was collected at the time of euthanasia.

Firefly luciferin solution was prepared by dissolving 1 g of XenoLight d-luciferin—K⁺ Salt Bioluminescent Substrate (PerkinElmer, Waltham, MA) in 35 mL of PBS. Intraperitoneal delivery was performed in a control mouse and all mice injected with CF33-Fluc and the mice were imaged using Lago X optical imaging system (Spectral Instruments Imaging, Tucson, AZ) after 7 min. Luciferase imaging was performed twice weekly and prior to animal euthanasia.

Harvested tumors were fixed in formalin for 48 h, paraffin embedded and 5 µm thick sections were obtained. Standard hematoxylin and eosin (H&E) staining was performed. On adjacent tumor sections, immunohistochemical staining was performed. The IHC sections were deparaffinized followed by heat-mediated antigen-retrieval. Briefly, for antigen-retrieval tumor sections were hydrated and steamed for 40 min in IHC-TEK Epitope Retrieval Solution (IHC World, Ellicott City, MD). Following antigen-retrieval, tumor sections were permeabilized with methanol and were blocked using TNB Blocking buffer (PerkinElmer, Waltham, MA) for 20 min. The sections were then incubated with rabbit anti-vaccinia virus antibody diluted 1:100 in TNB blocking buffer (Cat# ab35219; Abcam, Cambridge, MA), overnight in a humidified chamber at 4 °C. The following day, tumor sections were washed and incubated with Alexa Fluor-488-conjugated goat anti-rabbit (Cat# ab150077, Abcam, Cambridge, MA) for 1 h at room temperature. Finally, the sections were counterstained with 4′6-diamidino-2-phenylindole (DAPI) and were imaged using EVOS FL Auto Imaging System (Thermo Fisher Scientific, Waltham, MA).

A pool of chimeric orthopoxviruses was generated by co-infecting CV-1 cells with cowpox virus strain Brighton, raccoonpox virus strain Herman, rabbitpox virus strain Utrecht, and VACV strains WR, IHD, Elstree, CL, Lederle-Chorioallantoic and AS at an MOI of 0.01 per virus. Our pilot experiments indicate that CV-1 cells are susceptible to all the orthopoxviruses used in this study. One hundred chimeric orthopoxvirus plaques were picked from CV-1 cells infected with the chimeric orthopoxvirus pool. These 100 plaques were further plaque-purified two more times to yield 100 clonally purified individual chimeric virus isolates.

Tumor cell-killing activity of 100 chimeric orthopoxvirus isolates, together with nine parental virus strains were evaluated and compared in a panel of the NCI-60 cell lines. Each cell line was infected with each virus at an MOI of 0.01. Cell viability was measured at 96 h post infection using MTS assays. The MOI in this high throughput screening experiment was intentionally kept low, and optimized to compare cell killing in adherent cell lines (the majority of cell lines in the NCI-60 panel are adherent cells) so potent new virus isolates can stand out. This amount of virus, however, was too low to see any significant and consistent cell killing in suspension cell lines. Therefore, the results from six leukemia cell lines were not included in the analysis for the purpose of virus comparison. Among 100 new chimeric orthopoxvirus isolates, isolates CF17 and CF33 demonstrated significantly better cell killing (p < 0.001) in the NCI-60 solid tumor cell lines than all nine parental orthopoxvirus strains (Fig. 1), indicating that virus chimerisation can generate a backbone virus that is better than its parental viruses. Both CF17 and CF33 caused significant cell death in the majority of the NCI-60 solid cancer cell lines even at the low MOI of 0.01. CF33 was chosen for further study.

Initial genomic sequence analysis of CF33 revealed that the overall sequence matched more closely to VACV genomes. However, in the absence of published sequences for four out of the nine parental viruses (VACV strains IHD, CL, Lederle-Choriallantoic and AS), we are not able to pinpoint which parts of CF33 came from which parental viruses. Compared to the genomic sequence of VACV strain WR, CF33 contains multiple insertions, deletions and numerous point mutations throughout its genome, thus, it is impossible at this time to pinpoint what sequence variations make the CF33 virus superior to the parental viruses. In future, we plan to perform in-depth sequence analysis for better understanding of the mechanisms through which CF33 out-performs its parental viruses.

Both CF33 and CF33-Fluc killed all 6 pancreatic cell lines tested in vitro in a dose-dependent manner. Figure 2a–c shows the dose-dependent cancer cell death from CF33-Fluc across all cancer cells tested. Notably, less than 50% pancreatic cancer cell survival occurred across all cell lines at an MOI of 1 by 72 h post-infection. Even at lower MOIs, efficient cell killing was noted in all cell lines. All cell lines, except MIA PaCa-2 and Capan-1, had less than 10% survival by 96 h post-infection at MOI 1. MIA PaCa-2 and Capan-1 had less than 10% survival at 144 h post-infection at MOI 1. All 6 cell lines supported the proliferation of CF33-Fluc at an MOI of 0.01. Most pronounced increases in PFU/million cells were noted in BxPC-3 and PANC-1 cell lines with an approximate 10⁴ fold increase of CF33-Fluc by 2 days post-infection. A correlation of the lethal dose for 50% cell kill (LD50) at 72 h and viral proliferation at 24 h was observed in PANC-1, SU.86.86, AsPC-1, and Capan-1 (R² = 0.932, Fig. 2d).

Besides direct cell lysis, OVs are known to elicit potent anti-tumoral immune responses, mainly through release of tumor-associated antigens and ICD-related damage-associated molecular patterns (DAMPs) [12]. Calreticulin (CRT), ATP and HMGB1 are critical DAMPs in ICD. Surface-exposed CRT serves as an “eat me” signal for macrophages, neutrophils, and dentritic cells (DCs), whereas ATP acts as a “find me” signal for macrophages and DC precursors. HMGB1 promotes production of cytokines and antigen cross-presentation. Figure 3a shows that infection with CF33 resulted in a five or twofold increase in cell surface-exposed CRT in PANC-1 cells and MIA PaCa-2 cells at 16 h post infection, respectively. At the same time, the release of ATP by infected PANC-1 and MIA PaCa-2 was also significantly increased compared to mock-infected cells (Fig. 3b). The release of HMBG1 became detectable at 48 h post infection for both PANC-1 cells and MIA PaCa-2 cells (Fig. 3c). These results suggested that CF33-induced cell death could be highly immunogenic.

Significant regression was noted in xenografts injected with intratumoral CF33 at 10³ PFU in PANC-1 and 10⁵ PFU in MIA PaCa-2 when compared to PBS injected control (p = 0.0001 and p = 0.01, respectively, Fig. 4a, b). Toxicity to CF33 and CF33-Fluc was determined by net weight loss. No toxicity was noted in the PANC-1 group injected with a dose of 10³ PFU of CF33 or the attenuated CF33-Fluc at 10⁴ PFU when compared to the PBS-injected group (p = 0.25, p = 0.68, respectively, Fig. 4d). PANC-1 bearing mice had no detectable CF33 or CF33-Fluc in the stool, urine or blood at any point of collection.

Luciferase signal was noted in the injected tumors at the earliest measured time point of 1 day post-injection (Fig. 5a–c). Decrease in luciferase relative units correlated significantly with percent regression of injected tumor size (R² = 0.879, Fig. 5b). The right sided, or non-injected, distant tumor showed significant regression when compared to the PBS control tumor in both CF33 and CF33-Fluc groups (p = 0.006 and 0.007, respectively, Fig. 4c). Attenuation of the virus did not affect tumor regression in the non-injected tumor as no difference was noted when comparing CF33 or CF33-Fluc (p = 0.99). Luciferase signal was noted in the non-injected tumors after 8 days of treatment and luciferase activity increased in the non-injected tumors for the remainder of the experiment (Fig. 5a, c).

High CF33-Fluc titers were noted in the injected tumors at 3 days post-treatment (Fig. 5d). Titers above 10⁷ PFU/g tissue were seen in the injected tumors on days 3 and 13. On day 27, the highest titer was noted at 10⁸ PFU/g of injected tumors. The non-injected, distant tumors showed a serial increase in CF33-Fluc titers from 10³ PFU/g tissue at day 3 to nearly 10⁸ PFU/g tissue by day 27, which correlated to the increase in luciferase relative units (R² = 0.9972). CF33-Fluc was found in other organs (Fig. 5d). Notably, organs contained at least 10³–10⁴ times fewer viruses than the injected tumors. The limit of detection was dependent on organ weight and ranged from 1.2 × 10² to 1.1 × 10³ PFU/g.

H&E and DAPI fluorescence on sections of the control tumor over time show overgrowth of PANC-1 cells and confirm no viral green fluorescent staining (Fig. 6a). Infection of CF33-Fluc was confirmed at day 3 in the injected tumors through anti-viral green fluorescent staining. H&E shows early signs of tumor necrosis and confirms the presence of virus in only the injected tumor (Fig. 6b). By day 27, H&E showed nearly complete central tumor necrosis in the injected tumor when compared to control and IHC confirmed vaccinia virus in the non-injected, distant tumor. This is consistent with the findings from the luciferase imaging and tumor viral titers.