Introduction
Influenza A viruses cause a highly contagious respiratory infection, and both seasonal and pandemic strains remain a persistent health issue for humans. Influenza pandemics occurred three times in the 20th century (1918, 1957 and 1968) and in 2009 the novel H1N1 influenza (swine flu) became the first influenza pandemic of the 21st century. Equally troubling are the continued human infections with the highly pathogenic H5N1 avian influenza (bird flu) in Asia, Europe, and Africa. This subtype has not yet gained the ability to readily transmit from human to human, but research has demonstrated this virus is able to evolve increased transmissibility in the ferret model [
1,
2]. The lack of preparation for the rapidly spreading novel H1N1 and continued threats of a possible avian influenza outbreak make it painfully evident that more knowledge of the basic molecular activities required for influenza replication is needed so that new antiviral targets can be identified and therapies developed.
Influenza is a negative strand RNA virus with eight vRNA segments. The influenza RNA dependent RNA polymerase (RdRP) is a three-subunit complex comprised of PA, PB1, and PB2, which transcribes and replicates viral RNA in the nucleus. The viral RdRP binds an RNA panhandle formed by complimentary interaction between the 5’ and 3’ ends of the viral genome [
3,
4]. NP encapsidates each vRNA template and also makes direct protein contacts with the viral RdRP [
5]. Together, the viral RdRP, NP and each vRNA segment form functional viral ribonucleoprotein complexes (vRNPs) responsible for transcription and replication of the viral genome in the nucleus of the host cell.
The mechanisms of transcription by the viral RdRP are well characterized. Influenza viral mRNAs are similar to host messages as they contain both a 5’ cap and 3’ polyA tail, but these modifications are not acquired through host cellular processing. The 5’ cap is stolen from nascent cellular mRNAs via a ‘cap-snatching’ mechanism [
6]. The influenza RdRP interacts with host RNA polymerase II C-terminal domain [
7], placing the viral RdRP within the environment of nascent cellular mRNAs, which acquire the 5’ cap modification early during transcription. The PB2 subunit of the influenza RdRP recognizes and binds cellular capped mRNAs [
8] while the PA subunit uses its intrinsic endonuclease activity to cleave the 5’ capped RNA [
9,
10]. The resulting cellular capped RNA fragment is used by the PB1 subunit of the influenza RdRP as primer for polymerization and viral mRNA synthesis. Polyadenylation of the 3’ end of the viral mRNA occurs by a ‘stuttering’ mechanism, wherein the viral RdRP slips along five to seven uracil residues approximately 17 to 22 nucleotides from the 5' end of each vRNA template, resulting in the polymerization of a poly A tail [
11,
12]. Influenza gene expression further requires the splicing of two viral mRNAs and the nuclear export of spliced mRNAs (NS2 and M2), intron containing mRNAs (NS1 and M1), and intronless mRNAs (NP,PA, PB1, PB2, HA, and NA). Evidence suggests a model wherein the resident RdRP of the vRNP is responsible for transcription, while a soluble RdRP is responsible for replication from the vRNA template [
13].
NP does not directly participate in the transcriptional activities described above, but NP is essential for efficient transcription in the host cell as part of the functional vRNP. Replication actively requires NP as NP encapsidates both the vRNA and cRNA replication products, and NP is required for synthesis of template sized RNA
in vitro[
14]. However, NP is more than a structural RNA binding protein. NP is intricately involved in promoting viral RNA replication: NP is required for anti-termination at the polyA addition site during vRNA to cRNA replication [
15], NP and the RdRP stabilize nascent cRNA and vRNA replication products [
16], and although NP is not essential for RNA replication on short templates [
17], NP protein interaction with the viral RdRP enhances unprimed RNA initiation
in vitro[
18]. The cRNA is then used as template to produce more vRNA. Viral RNA replication leads to increased vRNA templates available fo transcription, amplifying production of viral mRNAs. Thus, in addition to coating the RNA template, NP plays an integral role in viral RNA replication and proper viral gene expression.
NP is a multi-functional protein that interacts with a number of viral and host proteins at various times during infection (for review see [
19]). The N-terminus of NP contains an unconventional nuclear localization signal at amino acids 3-13 (nNLS- SxGTKRSYxxM) critical for both NP and vRNP nuclear localization [
20,
21]. Recombinant virus encoding mutations within the unconventional NLS were attenuated with NP localized primarily to the cytoplasm, resulting in decreased viral gene expression [
22]. The N-terminus also interacts with host RNA processing factor UAP56, as NP amino acids 1-20 were sufficient to bind UAP56 [
23]. UAP56 is a member of the DEAD-box family of RNA dependent ATPases and RNA helicases [
24], and is involved in cellular mRNA remodeling during mRNA processing and nuclear export [
25]. Experiments with purified NP and UAP56 proteins
in vitro indicate that UAP56 functions as a chaperone to promote free NP binding to nascent viral RNA replication products resulting in enhanced viral RNA synthesis [
23,
26]. The goal of this study was to address the role of N-terminal NP interactions in the context of the host cell. To accomplish this, we designed a plasmid encoding the conventional NLS from SV40 T-antigen (PKKKRKV) in place of the N-terminal 20 amino acids of NP (del20NLS-NP).
We report here the characterization of del20NLS-NP using transfection to express reconstituted vRNPs in human embryonic kidney cell line (293 T). We find that del20NLS-NP is expressed, localized, and binds nucleotides as wild type NP (WT-NP). However, RNA expression from influenza vRNA templates in the presence of del20NLS-NP is significantly decreased compared to WT-NP. Increasing vRNA template length exacerbates the RNA expression defect. To assess vRNP formation we analyzed cell protein extracts for NP containing high molecular weight complexes using 1D blue native gel electrophoresis and found substantial decrease in high molecular weight complexes containing del20NLS-NP compared to WT-NP. These results contribute evidence that aside from the importance for nuclear localization, the N-terminus of NP is required for efficient formation of vRNPs.
Conclusion
We have two main conclusions. First we validate the significance of the N-terminus of NP aside from vRNP and NP nuclear import [
20‐
22]. We did this by replacing the N-terminus of NP with the conventional NLS from SV40-T antigen to generate a nuclear localized N-terminal NP deletion mutant. Using reconstituted vRNP assays, we characterized del20NLS-NP, which maintained nucleotide binding but displayed diminished influenza RNA expression, exacerbated by vRNA template length. 1D blue native gel electrophoresis of total protein extracts from transfected 293 T cells expressing reconstituted vRNPs with GFP-NS1ss vRNA templates found little del20NLS-NP in higher molecular weight complexes, compared to WT-NP. Our results support a defect in functional vRNP formation with del20NLS-NP, resulting in decreased RNA and protein expression from the vRNA template. From characterization of this nuclear localized NP mutant we can conclude the N-terminus of NP plays a role in functional vRNP formation, independent of any role in vRNP nuclear localization.
The second conclusion asserts the usefulness of del20NLS-NP as a tool to characterize regulation of influenza gene expression. The fact that this NP mutant displays partial function facilitates study of the influence of NS1, NS2/NEP, and other factors on influenza RNA and protein expression. Unlike WT-NP, del20NLS-NP provides clear observable differences in viral protein expression in the presence or absence of additional factors in reconstituted vRNP assays. This conclusion is underscored by our confirmation that NS1 functions to enhance influenza mRNA translation [
34,
35]. Further, NS1 mutant analysis reveals the NS1-CPSF30 interaction surface is important for this cytoplasmic function of NS1 and could prove an effective cytoplasmic antiviral target.
Methods
Cells
Human embryonic kidney (293 T) cell line was purchased from ATCC and maintained in a water-jacketed incubator at 37°C with 5% CO2 output.
Plasmids
pcDNA plasmids expressing Influenza A Udorn mRNA to encode PA, PB1, PB2, NP, NS, NS1ss, NS1ss R38A, NS1ss W187R, NS1ss G184R proteins, and pHH21 plasmids expressing untagged M, HA, PA, PB1, and NS vRNAs, were gifts from the Krug laboratory. The pcDNA plasmid expressing WT-NP encoding a C-terminal Flag epitope tag was constructed using PCR (primers from Operon). In addition to proper restriction enzymes sites, the 5’ primer encoded the start codon and the first amino acids of NP while the 3’ primer encoded the last amino acids of NP followed by a short glycine linker and the FLAG epitope tag (DYKDDDDK) prior to the stop codon. The del20NLS-NP was constructed in a similar manner using the same 3’ primer but in this case the 5’ primer encoded the conventional NLS from SV40 T antigen (PKKKRKV) in between the start codon and NP codon 21. The PCR products were digested with EcoRI and XbaI and ligated into pcDNA vector. pHH21 Flag-NS vRNA, Flag-M vRNA, GFP-M vRNA, GFP-NS vRNA, GFP-NS1ss vRNA and Flag-PA vRNA, were constructed by two step PCR. The first step resulted in two DNA fragments, one encoding the antisense for the 5’ UTR–start codon and tag (FLAG or GFP) fused with the 5’ portion of the viral gene, the second encoding an overlapping region of the 5’ portion of the viral gene through the 3’ end. The two DNA fragments were used as templates in the second PCR step with BsmB1 5’common UTR and BsmB1 3’common UTR primers to produce the entire fusion coding sequence. The DNA insert was digested with BsmB1 and inserted into pHH21 so that the vRNA was expressed from the plasmid. The pHH21 PB1- GluGlu vRNA plasmid was made in a similar fashion except the tag was engineered at the 3’ of the PB1 gene. The FLAG-M short vRNA plasmid was made by digestion of the pHH21-FLAG-M vRNA plasmid with NcoI and ligation of the larger DNA fragment, resulting in a construct missing ~250 nucleotides within the intron sequence. All newly constructed plasmids were sequenced at the CSUPERB Sequencing Facility at San Diego State University to confirm successful plasmid construction.
Antibodies
Anti-Udorn and anti-NS1 antibody were kind gifts from the Krug laboratory and used at a 1:1000 dilution for Western blotting. Anti-FLAG antibody was purchased from Stratagene and used as per manufacturer’s suggestion. Anti-Glu-Glu, anti-Nxf1, anti-Hsp90, and anti-Tubulin were purchased from Abcam and used as per manufacturer’s suggestion. Secondary HRP coupled anti-Rabbit, anti-Mouse, and anti-Goat were purchased from Pierce and used at a 1:10,000 dilution.
DNA transfection
293 T cells were grown to approximately 70% confluency in either 10 cm or 6-well plates depending on experiment. Plasmid DNA was purified using Qiagen QIAprep spin plasmid purification kits as per the manufacturer’s protocol. DNA with pcDNA plasmids to express either WT-NP, del20NLS-NP, or vector, alone or in the presence of PB1, PB2, PA, and along with the appropriate pHH21 plasmid(s) to express vRNA templates, was mixed with Mirus transfection reagent at a 1:3 ratio of DNA to reagent and cells were transfected as per the manufacturer’s protocol. 48 hours post transfection cells were washed with 1X PBS, collected, and pelleted by centrifugation.
Isolation of cytoplasmic and nuclear proteins
Cell pellets were washed twice with 5 volumes of the cell pellet in Reticulocyte Standard Buffer (RSB: 10 mM Tris HCl pH 7.5, 10 mM KCl, 1.5 mM MgCl2). Cells were then resuspended in RSB at 10× the volume of the cell pellet and incubated on ice for 10 minutes. NP-40 was added at a final concentration of 0.2 % to disrupt plasma membranes. Visual inspection of the cells before and after addition of NP-40 ensured that the plasma membranes were disrupted, but that the nuclei remained intact. Nuclei were pelleted by centrifugation at 300 g for 8 minutes at 4°C. The cytoplasmic extract was collected and the nuclear pellet was resuspended in Dignam buffer C without glycerol (20 mM HEPES pH 7.9, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA) to release nuclear molecules. Both cytoplasmic and nuclear extracts were clarified from debris by high-speed centrifugation for 10 minutes at 4°C. An equal amount of 20 mM HEPES pH 7.9, 0.2 mM EDTA was added to the nuclear extract to reduce the total NaCl and MgCl2 concentrations. All buffers used contained protease inhibitors (Pierce).
Isolation of total protein and RNA
To isolate total protein extracts, cell pellets were resuspended in 10 volumes of the cell pellet in RIPA Lysis Buffer (25 mM HCl pH 7.6, 150 mM NaCl, 1% deoxycholate, 0.1% SDS) with protease inhibitors. Cells were lysed and genomic DNA sheared using Fisher Scientific Sonic Dismembrator for 10 pulses at 30%, output 3-4.
Total RNA was isolated using Trizol (Invitrogen) according to the manufacturer’s protocol. RNA was quantified and evaluated for purity by taking OD260 and OD280 readings in duplicate on the NanoDrop ND1000 Nanospectrophotometer (Thermo Fisher Scientific).
SDS-PAGE and Western Blot analysis
Protein extracts were separated by SDS-10%PAGE. Proteins were transferred to nitrocellulose using a Fisher semi- dry blot apparatus and probed with primary and HRP-conjugated secondary antibodies as indicated. Pierce ECL reagents were used to detect HRP conjugated secondary antibody. Blots were developed using the Chemi-Hi setting on the ChemiDoc XRS (BioRad) System and digital images were obtained using Quantity One software.
GFP detection
GFP was visualized with a Nikon Eclipse TS100 (Nikon Intensilight C-HGFI for fluorescence) inverted microscope and images captured with the Nikon DS-Qi1Mc camera with NS Elements software.
Reverse transcription – PCR
Prior to reverse transcription RNA OD was taken in duplicate to ensure use of equal concentrations of total RNA, and RNA was analyzed by gel electrophoresis to ensure no RNA degradation. RNA was first treated with RNase-free DNase (Promega) to degrade any contaminating plasmid DNA. 1 μg total RNA was subject to reverse transcription using oligo dT. Promega reverse transcription system was used as per the manufacturer’s protocol with the modification of increasing the reverse transcription time to 59 minutes to facilitate complete first strand cDNA synthesis. Reverse transcription reactions were aliquot from a master mix to ensure all samples received equivalent AMV-RT enzyme. Primers used in semi-quantitative PCR were as follows: M detection: (5’M) GCCTTCTGACCGAGGTCG, (3’M) CGATCAAGAATCCAC NS detection: (5’NS) GGATTCCAACACTGTG, (3’NS) CGATGTTTAGACCG HA detection: (5’HA) GTCGCTCTGGAGAACCAACATACAA, (3’HA) ACAAGGGTGTTTTTAATTACTAATA PB1-Glu-Glu detection: (5’PB1) GGGAAAGGATACATGAACGAAAGT, (3’GluGlu) CTCCATTGGCATGTACTC PCR products were separated on 1% agarose gels. Gels were analyzed with the UV setting on the ChemiDoc™ XRS (BioRad) System and digital images were captured using Quantity One software.
Isolation of total protein extract for native gel and IP assays
Cell pellets were resuspended in 1 mL of sonication buffer (10 mM Tris HCl pH 7.5, 100 mM NaCl, 2.5 mM MgCl2, 0.5% Triton X-100). Cells were lysed using a Fisher Scientific Sonic Dismembrator for 30 pulses at 30%, output 3-4. Sonicated materials were loaded onto 1 mL of 30% sucrose cushion (30% sucrose, 10 mM Tris HCl pH 7.5, 10 mM NaCl, 2.5 mM MgCl2) and centrifuged at 4000 g for 15 minutes at 4°C to clarify the total protein extract. Total protein extract was used for 1D blue native gel electrophoresis or immuno purification.
Immuno purification
Total protein extracts were incubated with anti-FLAG antibody (Stratagene) (1:50) for 1 hour at 4°C at which point PA/G sepharose beads washed in sonication buffer with protease inhibitors were added and incubation was continued at 4°C overnight. The samples were then spun for 1 minute at 1000 g at 4°C. For gel shift assays beads were washed 6 times. After washes in sonication buffer, beads were resuspended in 0.00125 mM 3X FLAG Peptide and incubated overnight at 4°C. Samples were then centrifuged at 1000 g for 1 minute. Supernatant, containing purified proteins, was collected. Samples were separated by SDS-PAGE and stained with Coomassie Blue.
Gel shift
Purified protein preparations were incubated with 50 nucleotide long single stranded DNA modified with 5’ biotin for detection, and corresponding to the sequence of the 5’ and 3’ ends of the viral RNA (Biotin-AGCAAAAGCAGGGTGACAAAGACATGATAAAAAACACCCTTGTTTCTACT). After the incubation period the complexes were separated on a TBE (native) 8% PAGE, transferred to a nitrocellulose membrane using a Fisher semi-dry blot apparatus, and biotin labeled DNA was detected by incubation of the membrane with HRP conjugated streptadivin. Pierce ECL reagents were used to visualize HRP conjugated streptadivin. Blots were developed using the Chemi-Hi setting on the ChemiDoc™ XRS (BioRad) system and digital images were obtained using Quantity One software.
1D blue native gel electrophoresis
Total protein extracts were separated on 6% PAGE TBE (native) facilitated by coomassie blue [
40]. Gel was run at 4°C until denatured molecular markers of at least 72 kDa ran off the gel. Further characterization is required to obtain the exact size(s) and molecular identity of other components present in the WT-NP containing higher molecular weight complexes observed. Proteins were transferred to nitrocellulose using a Fisher semi-dry blot apparatus. Blots were probed with primary and HRP-conjugated secondary antibodies as indicated. Pierce ECL reagents were used to detect HRP conjugated secondary antibody. Blots were developed using the Chemi-Hi setting on the ChemiDoc™ XRS (BioRad) system and digital images were obtained using Quantity One software.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare no competing interests.
Authors’ contributions
AS wrote the initial draft as his Biology Master’s thesis; this was copied, edited to include additional experiments and discussion, and formatted for Virology Journal by LLN. CFGJ contributed to manuscript editing. AS characterized del20NLS-NP location and nucleotide binding. AS and CFGJ characterized del20NLS-NP activity by assessment of gene expression from vRNA at the protein level using Western blot and RNA level using RT-semi-quantitative PCR, in the presence and absence of NS1. JR proposed use of 1D blue native gel with results shown by LLN. LLN conceived and designed the project, allowing for input from all student authors, oversaw all student researchers, prepared all figures in the acceptable file format, and wrote the final draft of the manuscript. All authors read and approved the final manuscript.