Background
Lung cancer was the most common cause of death from cancer worldwide [
1]. Non-small cell lung cancer (NSCLC) accounts for approximately 80% of all cases of lung cancer. The most common types of NSCLC are adenocarcinoma, squamous and large cell [
2]. Due to the lack of early diagnostic methods, many patients usually lose the opportunity of surgical treatment [
3]. Till lately there were no consensus guidelines for the management of NSCLC. The overall survival and quality of life in patients with advanced NSCLC remains highly unsatisfactory despite the chemotherapy and radiotherapy could provide many options.
Oncolytic Newcastle disease viruses (NDV) can selectively replicate and destroy tumor cells. The inherent oncolytic property of NDV has been reported to derive from defective Interferon signaling pathways in tumor cells [
4], while normal cells with an effective antiviral response hamper viral replication, which provides a mechanism for using NDV as a safe and effective tumor therapeutic vaccine [
5]. The oncolytic NDV have been used clinically as a promising experimental therapy for over 50 years. To date, three strains of NDV, MTH-68, NDV-HUJ and PV701 are being used in phase I/II clinical trials for tumor treatment, suggesting that NDV is a safe and effective therapeutic agent for cancer therapy [
6‐
9].
NDV, also known as avian paramyxovirus serotype 1, is a nonsegmented, negative-strand RNA virus of the family Paramyxoviridae with a natural avian host range. The genome of NDV is approximately 15 kb in length that encodes 6 structural proteins, nucleoprotein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin-neuraminidase (HN) and the large protein (L) [
10]. Based on the pathogenicity for avian species, NDV isolates are categorized into velogenic, mesogenic or lentogenic. The virulence of NDV is primarily determined by the F0 cleavage site. The F proteins of mesogenic and velogenic strains typically contain a polybasic cleavage site ((R/K)RQ(R/K)R↓F) [
11], whereas lentogenic NDV strains characteristically have one basic residue at the -1 and -4 positions in the cleavage site (G/E)(K/R)Q(G/E)R↓L) [
12,
13].
In previous experiments, we have shown that the NDV D90 strain isolated from natural sources could induce apoptosis of human lung adenocarcinoma cell line A549
via a caspase-dependent pathway, significantly inhibit the expression of Bcl2 protein and show anti-proliferative effect but had no significant effect on normal cells
in vitro[
14]. However, there was no report for therapeutic effect of NDV D90 strain
in vivo. In this study, we developed a reverse genetics system based on the NDV D90 strain and generated a recombinant NDV strain expressing enhanced green fluorescent protein (EGFP). Furthermore, we investigated the characteristics of the recombinant NDV D90 strains, including replication ability and anti-tumor activity
in vitro and
in vivo. Our results showed that both the rescued NDV D90 strain (rNDV-D90) and rNDV-GFP had tumor therapeutic efficacy
in vitro and
in vivo. The reverse genetic system for NDV D90 strain could provide a platform to develop a gene delivery system for tumor virotherapy, and afford the opportunity to develop improved therapeutic vectors engineered for increased antitumor efficacy.
Discussion
NSCLC is one of the leading causes of deaths from cancer worldwide, therefore, improvements in diagnostics and treatments are urgently needed [
15]. Oncolytic viruses have the potential to break immunological tumor tolerance, and generate antitumor immunity. Therefore, oncolytic viruses represent a promising novel immunotherapy strategy, which may be optimally combined with existing therapeutic modalities [
16]. In this study, a rescued virus rNDV-D90 by reverse genetics system based on the complete sequence of oncolytic NDV-D90 strain that we isolated from natural source was generated. Furthermore, we showed that rNDV-D90 could stably carry and express an EGFP gene positioned between the P and M gene of NDV. Importantly, the rNDV-D90 and rNDV-GFP showed the similar growth and oncolytic characteristics in lung cancer cell line A549 and tumor growth inhibition in nude mice as well as the parental NDV-D90 virus.
Naturally occurring oncolytic viruses include the double-stranded RNA reovirus and single-stranded RNA NDV and vesicular stomatitis virus, while human DNA viruses, including adenoviruses, vaccinia virus and herpes simplex viruses (HSV) have been genetically modified in a variety of ways to provide tumor selectivity [
16]. Due to significant virulence associated with the use of some human pathogens, animal viruses were explored as a promising therapeutic agent for tumor. Replication of NDV seems to be restricted in other species, including human cells [
4]. Unlike HSV-1 or adenovirus, NDV does not have significant adverse effects in human, suggesting that NDV is attractive as a potential therapeutic vaccine [
17]. Although oncolytic virotherapy has developed rapidly, the oncolytic properties of these viruses need improvement to achieve maximal oncolytic effect.
Reverse genetics has been explored as an approach to improve the oncolytic activity of NDV [
18]. For the purposes of studying the oncolytic mechanism and enhancing the oncolytic effect, we attempted to establish the reverse genetics system based on NDV D90 strain. As the same as the parental D90 strain, the rNDV-D90 strain was a mesogenic strain (the mean death time of embryos was 86.61 h) that contains a polybasic cleavage site ((R/K)RQ(R/K)R↓F) (Data was not shown). It was reported that the replication of recombinant NDV was delayed by insertion of a foreign gene, which was inserted in the gene junction [
19]. We here introduced a foreign gene in the noncoding region between the P and M genes to generate the recombinant virus rNDV-GFP. The rNDV-GFP virus expressed high levels of exogenous protein (Figure
2C) and showed the similar replication characteristics as well as the parental virus and rNDV-D90 in CEF cells (Figure
3), which demonstrated that the noncoding region between the P and M genes could be a suitable position for NDV D90 strain to carry foreign genes and provides the basis to design recombinant vector vaccines.
Various reports have shown that anti-tumor mechanism induced by NDV is dependent on induction of apoptosis [
14,
20‐
22]. In the lung cancer cell line A549, the rNDV-D90 and rNDV-GFP viruses showed the similar replication ability as well as the parental D90 virus
via growth curve (Figure
4A). The results of MTT assay (Figure
4B) and DAPI-staining analysis (Figure
4C) demonstrated that both the rescued NDV and recombinant virus with the insertion of exogenous gene had strong oncolytic effect in lung cancer cells. These data suggested that the recombinant viruses retained the oncolytic characteristics in lung cancer cells
via apoptosis.
The early reports have shown that oncolytic NDV strains are capable to induce tumor cell apoptosis
in vivo[
5,
23,
24]. However, some recombinant NDV that induced apoptosis in tumor cells did not show significant differences in tumor size, body weight between the treated mice and the control mice [
25]. Furthermore, the tumor therapy
in vivo was not progressed using the parental D90 virus in previous study. In this study, we investigated whether the parental and recombinant viruses could be effective therapeutic agents to suppress tumor growth in NSCLC model of nude mice. In the whole experiment, the body weights of mice that were treated with viruses NDV-D90, rNDV-D90 or rNDV-GFP did not significantly change, suggesting that recombinant viruses are sufficient safe not to cause side effect. As shown in Figure
5B, rNDV-D90 and rNDV-GFP as well as the parental D90 virus resulted in significant inhibition of tumor growth compared with PBS control. Furthermore, there was no difference in anti-tumor efficacy among the parental NDV D90, rNDV-D90 and rNDV-GFP (
P > 0.05), suggesting that the insertion of foreign gene could not reduce the oncolytic efficacy of NDV
in vivo. In addition, NDV induces apoptosis by both intrinsic and extrinsic caspase-dependent pathways of apoptosis [
22]. The intrinsic and extrinsic pathways both end at the point of the execution phase as a final pathway of apoptosis [
26]. The pathway is initiated by the cleavage of caspase-3 and results in DNA fragmentation, degradation of cytoskeletal and nuclear proteins [
26]. In this study, we performed an IHC study of apoptosis in nude mice with lung cancer A549 tumors xenografted. The lung cancer cells undergoing apoptosis were observed by IHC using an antibody against the active form of caspase-3, suggesting that NDV inhibits tumor growth
via caspase-dependent apoptotic pathway
in vivo. Despite complete regression of these tumors was not observed in tumor-bearing mice treated with the NDV D90 or recombinant viruses, the oncolytic properties of rNDV-GFP provide the basis to design recombinant vector for enhancing therapeutic efficacy by further reverse genetic modifications of NDV. Additional modification to rNDV-D90 will allow for the possibility of generating more effective agents compared with rNDV-D90.
Methods
Ethics statement
This study was carried out in strict accordance with animal ethics guidelines and approved protocols. All animal studies were approved by the Animal Ethics Committee of Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (SYXK (H) 2006–032).
Cells and virus
BSR-T7/5 cells stably expressing the phage T7 RNA polymerase [
27], chicken embryo fibroblast (CEF) cells and the human lung adenocarcinoma A549 cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen, USA) supplemented with 10% fetal calf serum at 37°C in a humidified 5% CO2 incubator. The NDV D90 strain was prepared as reported previously [
14].
Construction of recombinant plasmids
Viral RNA was extracted using the TRIzol-LS reagent (Invitrogen, USA) according to the manufacturer’s instructions. The RT reaction was performed as the previous described [
28]. The complete genomic sequence of the D90 strain was obtained by sequencing (Beijing Genomic Institute, China) using twelve primer pairs, which are available upon request.
To construct the helper plasmids, the open reading frames (ORFs) of NP, P, and L were amplified from the NDV-D90 cDNA using specific primers including Kozak consensus sequences (Table
1). The NP and P genes were cloned between the
EcoR I and
Xba I; the L gene between
Sal I and
Not I (Table
1 primers). The plasmids pCI-NP, pCI-P, and pCI-L were generated and confirmed by sequencing, respectively.
Table 1
Primer sequences used in the study
D90-F4-F | ATAAACTAGTACGCGT GGTtTCAGGCTTATATGCAG |
D90-F4-R | ATGCCATGCCGACCCACCAAACAGAGATTTGGTGAATG |
D90-F1-F | AATACGACTCACTATAGGACCAAACAGAGAATCTGTGAG |
D90-F1-R | ACGCGTACTAGTTTATAA AGTGCCTGGATGGTCAGCTG |
D90-F2-F | CATCCAGGCACTTTATAA TTTAGCTGGTGGCAATATG |
D90-F2-R | TAATACGCGTACTAGT AAGGGAACGATCCTAAATTC |
D90-F3-F | TCGTTCCCTTACTAGT TGAGATCCTCAAGGATGATAG |
D90-F3-R | GCCTGAAACCACGCGTCGAGTGCAAGAGACTAACAATC |
EGFP-F | GCGTCACACGGAATCCCGCGGAGTTAGAAAAAATACGGGTAGAACGCCACCatggtgagcaagggcgaggagctg |
EGFP-R | CGCGAGGGGGGGCCCCCGCGGttacttgtacagctcgtccatgccg |
NP-F-Kozak | TATTGAATTC GCCACCATGTCGTCTGTTTTCGACGAATAC |
NP-R | TATATCTAGA TCAGTACCCCCAGTCAGTGTC |
P-F-Kozak | TATTGAATTC GCCACCATGGCCACTTTTACAGATGC |
P-R | TATATCTAGA TCAACCATTtAGCGCAAGGCG |
L-F-Kozak | TATTGTCGAC GCCACCATGGCGGGCTCCGGTCCCGAAAG |
L-R | TATAGCGGCCGC TTAAGAGTCATTATTACTGTAATATC |
The plasmid pBR-THT, derived from pBR322 vector (Takara, China) containing the sequences of the T7 promoter, hepatitis delta ribozyme (HdvRz), and T7 termination signal was constructed. To construct the full-length genomic cDNA plasmid, a 90-nucleotide linker containing multiple restriction enzyme sites was introduced into plasmid pBR-THT-linker, using an In-Fusion PCR cloning kit (Clontech, USA). Four cDNA fragments, F1, F2, F3 and F4, coding for the complete sequence of the D90 virus genomic RNA, were generated by RT-PCR. These fragments were sequentially cloned into the plasmid pBR-THT-linker using an In-Fusion PCR cloning kit (Clontech, USA) (Figure
1A). Primer sets used to amplify the cDNA fragments were shown in Table
1. The
Kpn I restriction enzyme site in the L gene was eliminated through one nucleotide mutation (A13996T) to serve as a genetic marker. The resulting full-length cDNA plasmid was designated pBR-D90.
To construct a full-length plasmid containing the EGFP gene, the full-length D90 cDNA clone pBR-D90 was used as a backbone to construct a recombinant cDNA clone containing the EGFP gene between the P and M genes as an additional transcription unit. A unique
Sac II restriction enzyme site was introduced into the region between the P and M genes of the pBR-D90 infectious clone by overlap PCR. The EGFP gene was amplified using the primer pairs (Table
1) from pEGFP-N1 (Clontech, USA). The ORF of EGFP gene was engineered to contain the NDV gene-start and gene-end signal sequences and inserted into the
Sac II restriction enzyme site in pBR-D90 adhering to the “rule of six” (Figure
1B) [
29,
30]. The positive clone was confirmed by sequencing and designated as pBR-D90-GFP.
Rescue of the recombinant viruses
To rescue the recombinant virus rNDV-D90 and rNDV-GFP, BSR-T7/5 cells were cultured to 70% confluence in a six-well plate and transfected with total 8 μg mixtures of the indicated plasmids including pBR-D90 or pBR-D90-GFP, pCI-NP, pCI-P, and pCI-L at the ratio of 4:2:1:1 using LipofectamineTM 2000 (Invitrogen, USA) according to the manufacturer’s instructions. At 6 h post-transfection, the cells were washed three times with phosphate buffered saline (PBS) and cultured in opti-MEM medium (Invitrogen, USA). After 3 days, the culture supernatant was harvested and inoculated into the allantoic cavities of 9- to 11-day-old embryonated SPF eggs until the AF showed NDV-specific HA activity. The rescued rNDV-D90 was serially passaged 15 times in 9- to 11-day-old embryonated SPF eggs.
To identify recombinant NDV, the 5 th, 10 th and 15 th passages of the AF containing rNDV-D90 viruses were collected. Viral RNA from the rNDV-D90-infected chicken embryo AF was extracted and the RT reaction was performed. Primers 10-F and 10-R (Table
1) were used to amplify the part coding region of L protein where contains the genetic marker of rNDV-D90. The PCR products were confirmed the presence of the artificially introduced genetic markers by DNA sequencing.
Immunofluorescence assay
BSR-T7/5 cells or CEF cells were cultured in a 96-well plate and infected with rNDV-D90 at a multiplicity of infection (MOI) of 0.01. At 48 h post-infection, the cells were fixed with absolute ethyl alcohol, and then incubated using anti-chicken NDV polyclonal sera (1: 40 dilution) and the FITC-conjugated goat anti-chicken IgG antibody (1: 200 dilution) (Sigma, USA). Uninfected cells were as the negative control. The samples were visualized with EVOS fl fluorescence microscope (AMG, USA).
Live cell imaging
BSR-T7/5 cells or CEF cells were cultured in a 24-well plate and infected with rNDV-GFP at a MOI of 0.01. Cells were observed with EVOS fl fluorescence microscope (AMG, USA). Live cell imaging was recorded at 24 h and 48 h post-infection.
Growth characteristics of the recombinant viruses
The growth characteristics of the recombinant virus were evaluated on CEF cells and A549 cells, respectively. Confluent monolayers of CEF or A549 cells were infected with rNDV-D90, rNDV-GFP or the parental D90 strain in 6-well plates at a MOI of 0.01. Every 12 h post-infection, the cellular monolayers of CEF or A549 cells were harvested by freeze-thawing three times. Virus titers were determined as 50% tissue culture-infective dose (TCID50) per 0.1 ml. Each assay was repeated three times.
MTT assay
The viability of cells was assessed with a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell proliferation and cytotoxicity assay kit (Keygentic, China) with six replicates for rNDV-D90, rNDV-GFP, NDV-D90 or medium. At 12, 24, 36, 48, 60, 72 h post-infection, cell viability was determined by incubating the cells with MTT. Absorbance at 490 nm was determined with ELISA microplate readers (BioTek Instruments, Winooski, VT).
DAPI staining
A549 cells were infected with rNDV-D90, rNDV-GFP or NDV-D90 at a MOI of 0.01 for 24 h. Cells were stained with DAPI (Keygentic, China). DAPI staining was performed as described previously [
31]. In brief, prior to staining, the cells were fixed with 4% paraformaldehyde for 30 min at room temperature. DAPI was added to the fixed cells for 30 min, and then examined by fluorescence microscopy. Apoptotic cells were identified by condensation and fragmentation of nuclei.
Animal study
Six-week-old female athymic nude mice were purchase from Shanghai Slac Laboratory Animal Company and housed in a pathogen-free environment. All the mice were injected subcutaneously into the outer thigh with 5 × 106 A549 cells per mice. Solid tumors became visible after 10 days. The tumor sizes were determined as the product of the perpendicular diameters of the tumors. Mice were randomly divided into four groups. Each group contained 6 mice. On day 20 post-inoculation, the mice were treated by intratumoral injection of 1 × 107 TCID50 of NDV D90, rNDV-D90, rNDV-GFP or PBS in a total volume of 100 μl. The treatments were repeated every other day for a total of four treatments. Both tumor volume and body weight were measured at 2, 4, 6, 8, 10, 12, 15 and 21 day after the treatment initiation. All animals were euthanized 21 days after treatment was initiated. At that time, all animals reached the humane clinical endpoint for the study which was taken as the point when the tumor exceeded 10% of normal body weight or was greater than 1.5 cm diameter of the tumor.
Immunohistochemistry
The tumors were fixed in 10% neutral buffered formalin solution. They were dehydrated, embedded in paraffin, and cut into 5 μm sections. The primary polyclonal rabbit anti-cleaved caspase-3 (Asp175) antibody (Cell signaling, USA) was diluted at 1:300. Subsequently, the sections were incubated with anti-rabbit secondary antibody (Sigma, USA) was added to the sections. Following a PBS wash, DAB substrate was performed. The sections were analyzed via microscopy.
Statistical analysis
The statistical analysis was performed using two-way ANOVA analysis. P values less than 0.05 were considered statistically significant. Data were presented as mean values ± the standard deviation (SD).
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
ZC, PZ, FF and XL designed the experiments. ZC, XZ, LH and YL performed the experiments. ZC and XL analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.