Background
Neuroblastoma is a paediatric cancer derived from the sympathoadrenal lineage and is thought to originate from undifferentiated neuroblasts [
1]. Treatment has advanced over the last decade or more and now includes immunotherapy and differentiation therapy alongside conventional chemotherapy, radiotherapy and surgery. Overall, survival for patients with high risk neuroblastoma tumours is poor (< 50%), thus crucially indicating a need to develop additional therapies [
2,
3]. Whilst many agents tested in vitro look promising, remarkably few are as successful in preclinical models or eventually patients. The most common model used for screening potential drugs is the mouse xenograft model where neuroblastoma cells are introduced either subcutaneously or orthotopically. Mouse models are expensive and time consuming hence there is a need for additional models. These models should be rapid, cost effective and NC3Rs compliant in order to contribute to the identification of novel therapies which have the potential to progress to successful preclinical/clinical trials and ultimately have a significant impact on the disease.
The chick chorioallantoic membrane (CAM) has been used for many years to support the growth of tumours including neuroblastoma [
4]. It has been especially attractive as a model for studying angiogenesis due to the accessibility and visibility of the blood vessels drawn in to support tumour growth. Drugs to investigate and manipulate angiogenesis have been supplied in various formats including within plastic rings and gelatin sponges [
5]. The ability of cells to form tumours on the CAM has also been used to investigate tumour biology such as the ability of tumour cells to invade and metastasise into the embryo [
6‐
8] and most recently the CAM tumour model is increasingly finding a use as a platform to analyse the effectiveness of anticancer drugs on invasion and metastasis [
9‐
11].
One characteristic feature of neuroblastoma is its unusually high rate of spontaneous regression and this may be connected to the susceptibility of tumour cells to differentiate. Indeed tumours with a differentiating histology and markers of mature neurons such as TrkA are low risk whilst tumours with undifferentiated histology are high risk [
12,
13]. A small number of genetic mutations have been identified in neuroblastoma tumours, the first and best characterised is amplification of a variable sized amplicon containing the MYCN gene [
14]. A number of neuroblastoma cell lines (typically MYCN-amplified (MNA)) have been shown in culture to slow or cease cell division and begin to extend axons in response to retinoic acid (RA). We have previously shown similar differentiation responses by the MNA cell lines Kelly and SK-N-BE2(C) triggered by the embryonic environment of the chick [
15]. Thus differentiation therapy is a promising approach for treating high risk neuroblastoma and whilst some tumours and cell lines remain resistant to RA, MNA cell lines generally respond well.
Here we have used ATRA in culture as a proof of principle to validate suitable assays and timescale of response of tumours formed on the chick CAM. We show that ATRA reduces cell proliferation and increases differentiation of MNA Neuroblastoma tumours within 3 days thus establishing the CAM tumour model as a suitable in vivo model for screening new differentiation therapies.
Methods
Cell culture
SK-N-BE(2)C (human NB, ECACC No. 95011817) and IMR-32 (human NB, ECACC No. 86041809) were grown in DMEM (Life Technologies), 10% Foetal Bovine Serum (Biosera, East Sussex, UK), 100 U/ml penicillin,100 μg/ml streptomycin (Sigma, P0781) and 1% Non-Essential Amino Acids (Sigma, M7145). They were maintained at 37 °C with 5% CO
2 in humidified incubator. Passaging was carried out using 0.05% Trypsin/EDTA (Sigma Aldrich) as required. Cell lines were transduced with green fluorescent protein (GFP) lentivirus as described previously [
7,
15].
Morphology analysis and cell proliferation assays
1 × 104 of BE(2)C cells and IMR32 cells were plated onto coverslips in a 24 well plate, incubated for 18-24 h. Medium containing either 10 μM RA, 4 μM of MLN8237 or DMSO alone 0.06% or 0.04% final concentration was added and cells were analysed after 72 h of incubation. To assess the morphology of cells, images of cells were obtained using an inverted microscope (Leica DMIRB) prior to fixation. For immunocytochemistry, coverslips were removed from wells and fixed with 4% paraformaldehyde for 10 min, blocked with 1% BSA, 0.1% Triton X100 in 0.12 M phosphate pH 7.4 for 30 min and stained overnight at 4 °C with 1:50 dilution of Ki67 (Abcam ab16667) followed by 1:500 Goat anti rabbit Alexa 594 (Life Technologies) for one hour at room temperature both diluted in blocking buffer. Cell nuclei were stained with DAPI. Proliferating cells were quantified by Ki67 staining and normalised to the total number of nuclei stained by DAPI. At least three fields per coverslip and 3 coverslips per experiment were counted and a minimum of 300 cells per condition.
Chick embryo CAM assays
Fertilised white leghorn chicken eggs were obtained from Lees Lane Poultry, Wirral, or Tom Barron, Preston, UK. Eggs were incubated at 38 °C and 35–40% humidity and windowed at E3 as described previously [
15]. GFP-labelled cells were initially seeded onto the CAM as tumourspheres, in matrigel or as a cell suspension. A cell suspension of 2 × 10
6 in 5 μl of DMEM seeded onto a slightly injured CAM was found to be most efficient [
7]. The CAM was injured by laceration with a pipette tip or traumatisation using a strip of sterile lens tissue causing small bleed [
16]. Traumatisation was found to be the most reproducible method and was used for all experiment. To further enhance the efficiency of tumour formation 5 μl of 0.05% trypsin 0.5 mM EDTA was added immediately prior to the addition of cells. For confocal analysis, 10% GFP with 90% unlabelled cells were used to facilitate observing any morphological changes inside the tumours. Eggs were resealed and incubated until E11 [
17].
Drugs administration
Embryos were treated either topically to the CAM or by injection into the allantoic cavity between E11 and E13. ATRA was used at 10 μM and 100 μM for 3 days at E11, E12 and E13 or 40 μM was used at E11 and E13. Concentration was determined based on the volume of an egg of 45 ml. 2.8 μl, 11.25 μl or 28 μl DMSO diluted to 200 μl in PBS was injected into control embryos. Embryos were dissected on E14 and tumours analysed.
Quantitative PCR
In vitro samples: Each cell line was seeded at a density of 2 × 10
6 per 75cm
2 flask and after 24 h, medium was replaced with fresh medium containing either ATRA (10 μM) or MLN8237 (4 μM) or DMSO. Every 48 h the medium was replaced with fresh medium containing RA, MLN8237 or DMSO. After 3 or 6 days, RNA was extracted using RNA mini Kit (QIAGEN) according to manufacturer’s instructions. qPCR was carried out on CFX Connect (Biorad) thermocycler using iTaq Universal SYBR green mix (Biorad) 0.5 μM primers and up to 2 μl cDNA for 35 cycles. An annealing temperature of 60 °C was used for all primer pairs and three technical replicates and three biological replicates were carried out for each sample. qPCR data analysis was carried out using Bio-Rad CFX Manager 3.0 software. Normalised relative expression of target genes was calculated using the ΔΔCq analysis mode. A list of the primers used is provided in Table
1.
Table 1
List of primers used for qPCR analysis
UBC | ubiquitin C | ATTTGGGTCGCGGTTCTTG | TGCCTTGACATTCTCGATGGT |
HPRT1 | hypoxanthine phosphoribosyltransferase 1 | TGACACTGGCAAAACAATGCA | GGTCCTTTTCACCAGCAAGCT |
GAPDH | glyceraldehyde-3-phosphate dehydrogenase | AATCCCATCACCATCTTCCA | TGGACTCCACGACGTACTCA |
ROBO2 | roundabout, axon guidance receptor, homolog 2 | GATGTGGTGAAGCAACCAGC | TGGCAGCACATCTCCACG |
STMN4 | stathmin-like 4 | CCTAGCAGAGAAACGGGAACA | GGCGTGCTTGTCCTTCTCTT |
KLF4 | Kruppel-like factor 4 | CGCCGCTCCATTACCAAGAGC CGGTCGCATTTTTGGCACTG | CGGTCGCATTTTTGGCACTG |
MYCN | Neuroblastoma-derived v-myc avian myelocytomatosis viral related oncogene | CACAAGGCCCTCAGTACCT | ACCACGTCGATTTCTTCCTCT |
In-vivo tumours: Tumours were harvested from the CAM, rinsed in phosphate-buffered saline (PBS), then transferred into RNAlater solution (QIAGEN), and stored at initially at 4 °C or −20 °C for longer term storage prior to RNA extraction. Tissue was first removed from the RNAlater and transferred to a clean RNase free falcon tube. Liquid nitrogen was used to freeze the tissue before a pestle and mortar was used to disrupt it. RNA was then extracted using RNA mini Kit (QIAGEN). qPCR was performed as described above.
Immunohistochemistry
Tumours which were harvested for paraffin embedding were fixed overnight in 10% neutral buffered formalin and embedded in paraffin using standard protocols. Prior to staining, the slides underwent deparaffination and high temperature antigen retrieval using a DAKO PT link. Following antigen retrieval, the slides were incubated in EnvisionTM FLEX Wash Buffer (1× working solution pH 7.67; DAKO, K8007) for 5 mins prior to loading onto the DAKO Autostainer (K8012). Sections were incubated for 30 min with Ki67 antibody (1:200) (DAKO M7240) in 5% BSA in Tris Buffered Saline followed by goat anti-mouse HRP (Abcam) and staining with 3,3′-diaminobenzidine. Haematoxylin staining was performed on all the slides and some slides were also stained with eosin to assist in distinguishing between tumour and chick nuclei. A total of 12 fields from 3 slides were counted per tumour and at least two tumours per condition were analysed.
Morphology analysis
Tumours required for confocal imaging were fixed in 4% paraformaldehyde for one hour, trimmed into small pieces <2mm3 and mounted into slides using DAKO mounting medium. The images were observed using the Leica DMIRE2 microscope at X40 objective to assess the morphology of cells within the tumours.
Statistical analysis
Statistical significance was computed using Student’s t-test or one-way ANOVA followed by a post-hoc tukey test using SPSS. All data are presented as mean + S.E.M. (standard error of the mean).
Discussion
The chick embryo has been used extensively to study development however its use for investigating cancer biology, especially its value for testing the efficacy of drugs, has been more limited to date [
9‐
11]. The chick embryo also complies with widely accepted guidelines designed to reduce animal numbers, refine and replace animal models (the 3Rs) [
28]. In our experiments we introduce cells onto the CAM at E7, the earliest time point at which the CAM is sufficiently developed, and complete experiments at E14. Hence these experiments, although in vivo
, are not considered animal experiments under UK legislation and thus replace the use of animals.
Many cell lines form tumours on the CAM however some do not [
25,
29] a feature we have also observed with Neuroblastoma cell lines. Tumour cells need to invade through the epithelial sheet of the CAM and this may require functioning MMPs to be secreted by the tumour cells. Whilst many Neuroblastoma secrete MMPs only SKNAS cells, of those tested, also expressed the biological activator [
30]. This provides an explanation for the greater efficiency of tumour formation by SKNAS cells [
7] and the rationale for the use of trypsin to enhance tumour formation for IMR32, Kelly and especially BE2C cells. Use of trypsin may enhance the use of the CAM tumour model by expanding the range of cell lines that will form tumours efficiently.
Drugs can be introduced to the embryo and extra embryonic tumours by topical addition, intravenous (IV) injection or injection into the allantois [
31]. We compared topical addition against IV injection using 5-ethynyl-2′-deoxyuridine (EdU) and found similar numbers of EdU labelled cells in the CAM tumour and the liver of the embryo within 24 h [
32]. Indeed given that drugs, by design, pass into and out of blood vessels it would be surprising if there was a significant difference between the two delivery methods. Since IV injections are technically more difficult we did not pursue this as a delivery method. For water-insoluble drugs such as ATRA we found that the allantoic sac provided the optimum method of delivering drugs since colloids have the opportunity to redissolve and be distributed through the egg aided by the movements of the embryo. One limitation in introducing drugs into embryos is their solubility. Water soluble drugs are not a problem however DMSO is a typical solvent for water-insoluble drugs and chick embryos will tolerate no more than 100 μl of DMSO [
27] and do not tolerate the introduction of 100% DMSO. We circumvented the insolubility of ATRA by forming a DMSO:PBS ATRA colloidal mixture and injecting this into the allantoic sac.
RA was used for our experiments since MLN8237 was less effective as a differentiation agent for culture BE2C and IMR32 cells despite reports of good results with tumours formed by the TH-MYCN mouse [
23] and xenografted mice [
24]. Tumour formation for BE2C cells can be reproducibly observed by fluorescent microscopy by E11 so ATRA injections commenced from E11. ATRA is used in culture at 10 μM replenished every 48-72 h whilst in mice a daily dose of approximately 100 μM (30 mg/kg) is delivered by oral gavage [
26]. Initial experiments were carried out using this higher dose about 10 fold greater than used in vitro
. Embryos tolerated this dose well and changes in differentiation markers were similar to cultured cells while the reduction in proliferation was somewhat less than observed in vitro. Nevertheless we were interested to determine the dose required to observe statistically significant effects of ATRA and whilst a daily dose of 10 μM ATRA showed the appropriate trend it required two doses of 40 μM ATRA at E11 and E13 to give statistically significant changes in proliferation and a change in cell morphology. This fourfold increase over the concentration used in culture may be due to sequestration of the ATRA by the receptors present in cells in the embryo [
33] thus potentially reducing the effective concentration. In addition, the cells within the tumour maybe less responsive than those in culture; perhaps reflecting the differing microenvironment [
34].
RA is already established as an effective drug for clinical use [
35] however some tumours and cell lines are resistant and for others the response is incomplete. Here we have established a method of enhancing tumour development on the CAM, delivering water-insoluble drugs to the tumours and three outcomes that confirm differentiation of cells (qPCR of differentiation markers, reduction in proliferation and change in cell morphology). Chick embryos develop rapidly with a window of only 7 days between a sufficiently developed CAM (E7) and the age embryos come under UK Home Office regulation (E14). Nevertheless tumours can form on the CAM and respond to drug treatments in this time window making the model highly time efficient. It is especially useful for analysing the cellular response to drug treatment as changes in gene expression, leading to different cell behaviours typically occur on a time scale of hours to days. These changes rather than, for example, changes in tumour size suit the short term nature of the model. We can now extend our results in order to rapidly and cost effectively test other putative differentiation agents alone or in combination with RA. Furthermore we have recently shown that neuroblastoma cells will metastasise into the embryo following preconditioning in hypoxia [
7]. It will be interesting to discover whether ATRA or other differentiation agents can reverse the effect of hypoxia and reduce or inhibit the metastasis of Neuroblastoma cells.
Conclusions
40 μM ATRA (4 times the concentration used in culture), injected into the allantoic sac of a chick embryo, reduces proliferation of neuroblastoma cells in tumours formed on the chick CAM within three days and changes cell morphology. 100 μM ATRA promotes changes in differentiation markers within three days. These results confirm that ATRA treatment of tumours formed on the chick CAM are comparable to those observed in mouse xenograft tumours [
36]. Thus we have established an efficient and robust protocol for using tumours formed on the chick embryo CAM to test novel therapies. The model is highly cost effect compared to the mouse xenograft model, is rapid and 3Rs compliant.
Acknowledgements
We are grateful to Dr. Helen Kalirai for assistance with the Ki67 staining and Hannah Greenwood for assistance with some of the preliminary experiments. We thank Dr Anne Herrmann and Dr Lakis Liloglou for useful discussions and assistance during this project.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.