Background
While early detection and improved treatments have helped manage certain types of cancer incidence and death rates [
1], this vast group of diseases still accounts for approximately 15% of all deaths worldwide each year [
2]. Rapid replication of abnormal cells and resistance to available anticancer treatments are two prominent factors underlying cancer aggressiveness [
3]. As every patient’s cancer is distinctively different, defining the underlying mechanisms may implicate tumor-specific molecular agents. Identification of such players could lead to novel targets for tailored therapies unique to each individual.
The mechanisms underlying cancer have been widely studied, with much emphasis placed on mitochondria [
4]. Since Otto Warburg first showed that tumor cells exhibit increased glycolytic adenosine triphosphate (ATP) production and reduced oxidative phosphorylation [
5], the mitochondrion has undergone thorough investigation to elucidate the alterations promoting cancer. It is well known that constant reactive oxygen species (ROS) exposure induces mutations in mitochondrial DNA, which lead to cancer initiation and metastasis [
6]. While elevated ROS levels cause substantial intracellular damage, tumor cells are capable of rebalancing ROS production and elimination by activating antioxidants [
7]. By balancing ROS levels, tumor cells can undergo unhindered, continual proliferation. Moreover, cancer cells display elevated inhibition of mitochondrial-mediated cell death, regardless of ROS accumulation [
8]. Modification of the mitochondrial permeability transition pore (MPTP) in malignant cells has been shown to render cells more resistant to anticancer therapies [
9], however, the mechanism underlying this resistance is not fully understood.
HSD10 (17β-hydroxysteroid dehydrogenase type 10), also known as ABAD (amyloid-β-binding alcohol dehydrogenase) and MHBD (2-methyl-3-hydroxybutyryl-CoA dehydrogenase), is a mitochondrial enzyme that catalyzes the oxidation of a wide variety of alcohols, fatty acids, and steroids [
10]. Our group originally identified HSD10 as a single chain, ≈27 kilodalton polypeptide capable of binding amyloid-β [
11,
12]. HSD10 is crucial for the maintenance of cellular homeostasis, and overexpression has been shown to provide a protective effect in cells undergoing nutritional stress [
13]. HSD10 belongs to the short-chain dehydrogenase/reductase superfamily 17β-hydroxysteroid dehydrogenase (HSD17B). These alcohol oxidoreductases catalyze the dehydrogenation of 17-hydroxysteroids [
14]. Several HSD17B family members have been implicated in breast [
15-
17], endometrial [
18], and colorectal cancers [
19], suggesting that this group of enzymes is important in different types of cancer. HSD10 was shown to be elevated in certain prostate carcinomas and osteosarcomas [
20,
21], indicative of a potential role in cancer. Furthermore, HSD10 may promote tumorigenesis and aggressiveness, as elevated HSD10 levels were observed in prostate-to-bone metastases compared to non-malignant prostate and primary prostate tumor tissue [
22]. While HSD10 remains underexplored in all cancer types, the current data in bone and prostate cancers strongly suggest that HSD10 may be utilized in cancer cells for protection against cell death and enhancement of unrestricted growth.
Based on these observations, we postulate that HSD10 overexpression enhances cancer cell growth and resistance to cell death. To examine the tumorigenic capability of HSD10, we selected the rat adrenal gland (pheochromocytoma) tumor cell line, PC-12. Here, we provide evidence that HSD10 mediates pheochromocytoma cell growth in cell culture and in a mouse model. Furthermore, we have identified a novel HSD10 binding partner, Cyclophilin D (CypD), a regulatory component of the MPTP, which may provide increased resistance to cell death in tumor cells. Now that we have demonstrated the effect of overexpressing HSD10 in non-malignant tumor cells, our future efforts will focus on evaluating the role of HSD10 in multiple types of cancer.
Methods
Materials
Reagents were obtained from the following sources: RPMI-1640 medium, Hank’s balanced salt solution (HBSS), 0.25% Trypsin-EDTA, heat-inactivated horse serum, fetal bovine serum (FBS), G418 supplement, Lipofectamine 2000, Mito Tracker Red, Mito Tracker Green, tetramethylrhodamine methyl ester (TMRM) from Invitrogen Co. (Grand Island, NY); Bicinchoninic Acid (BCA) protein assay from Pierce Chemical Company (Rockford, IL); CellTiter 96 Non-Radioactive Cell Proliferation Assay from Promega Co. (Madison, WI); Lentiviral Packaging Mix, Tert-Butyl hydroperoxide (TBH), Coenzyme Q1, Coenzyme Q2 from Sigma-Aldrich Co. (St. Louis, MO); Hydrogen peroxide (H2O2), Super Signal West Pico Chemiluminescent Substrate from Thermo Fisher Scientific Co. (Waltham, MA); ATP Bioluminescence Assay Kit HS II, In Situ Cell Death Detection Kit, Fluorescein from Roche Applied Science Co. (Indianapolis, IN); Signal transduction antibodies from Cell Signaling Technology Co. (Danvers, MA). All other chemicals used were of the highest purity commercially available.
Generation of stably transfected PC-12 cells overexpressing HSD10
The rat pheochromocytoma (adrenal gland tumor) cell line PC-12 (ATCC® CRL-1721, Manassas, VA) was used for stable transfection of HSD10 as formerly described [
13]. In brief, PC-12 cells (10
5 cells) were transfected with pcDNA3/(human) wild-type HSD10, or pcDNA3 alone (vector) previously linearized with
SmaI, using Lipofectamine 2000 [
23]. 48 hours after transfection, cells were plated at 1:10–1:20 dilution in 100-mm dishes supplemented with 1 mg/ml G418. After 1–2 weeks, single clones were isolated, and cells were separated with trypsin, subjected to limiting dilution, and replated in medium containing 1 mg/ml G418 for 2–4 weeks. After, cells were maintained in RPMI-1640 medium supplemented with 10% horse serum, 5% FBS, and 1 mg/ml G418 in a humidified 37°C, 5% CO
2 environment.
Generation of lentiviral transfected PC-12 cells under-expressing HSD10
HEK 293 T cells (ATCC® CRL-11268; 2.5 × 105 cells/well in a 6-well plate) were transfected with HSD10 shRNA (HSD17B10 MISSION® shRNA Bacterial Glycerol Stock, Human, SHCLNG NM_004493.2-751s21c1 TRCN0000318938, Sequence: CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTTG; Sigma-Aldrich) or control shRNA (MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid DNA, SHC202; Sigma-Aldrich) using Lipofectamine 2000 and Lentiviral Packaging Mix. Cell media was harvested at 36 and 72 hours post-transfection. PC-12 cells (105 cells/well in a 12-well plate) were infected with HSD10 shRNA and non-mammalian shRNA media over 10 days with continual passaging, and then were maintained in RPMI-1640 medium supplemented with 10% horse serum and 5% FBS in a humidified 37°C, 5% CO2 incubator, with shRNA viral media added to cell cultures once a week.
Characterization of transfected PC-12 cell lines
All PC-12 cell lines, between passages 1–8, were characterized using immunoblotting to determine HSD10 expression level, immunofluorescence staining to verify HSD10 expression level and localization, and growth curves.
Immunoblotting
Whole cell lysates were prepared from harvested cells. Cells were washed twice with pre-chilled phosphate buffered saline (PBS), followed by detachment with a scraper and sonication. Lysates were measured for protein concentration using the BCA protein assay. Proteins from the lysates were separated on NuPAGE® Novex® Bis-Tris 10% and 12% gels (Invitrogen) by SDS-PAGE. Gels were transferred to 0.45 μm nitrocellulose membranes (Thermo Fisher Scientific) and probed with rabbit anti-HSD10 IgG (generated in our laboratory [
11], 1:3000) and mouse anti-Actin (1:8000). HSD10 was visualized using a chemiluminescence mixture and FluorChem HD2 imaging system (ProteinSimple, Santa Clara, CA).
Immunofluorescence staining
Cells (2 × 104 cells/well) were grown in 8-well chamber slides until 70% confluent, and then incubated with 100 nM Mito Tracker Red for 30 minutes, followed by fixation in 4% paraformaldehyde and 0.1% Triton X-100 for 30 minutes. Fixed cells were incubated with rabbit anti-HSD10 IgG (1:200, generated in our laboratory) at 4°C overnight. The same concentration of non-immune IgG was used as a control. Secondary antibody (Alexa Fluor 488 anti-rabbit IgG, 1:2000, Invitrogen) was applied to the cells followed by confocal microscopy (Leica Microsystems, Buffalo Grove, IL). The intensity of fluorescence (ex: 581 nm, em: 644 nm for Mito Tracker Red; ex: 499 nm, em: 520 nm for HSD10) was recorded to determine HSD10 expression and mitochondrial localization.
Growth curves
Cells were plated in 100-mm dishes at a density of 2.5 × 105 cells/dish. One dish was chosen each consecutive day to be counted. The cells in the dish were detached with Trypsin, centrifuged, and resuspended in 1 ml of DMEM media, followed by counting using a hemocytometer.
Mitochondrial function and cell death assays
Mitochondrial membrane potential and bioenergetics were determined as previously described [
24,
25] in the PC-12 altered cell lines at passages 1–8.
Fluorescence staining of TMRM to examine mitochondrial membrane potential
Cells (2 × 104 cells/well) were grown in 8-well chamber slides until 70% confluent, and then incubated with 150 nM Mito Tracker Green (Invitrogen) and 100 nM TMRM (non-quench mode) for 30 minutes, followed by washing twice with HBSS media. Cells were imaged live by confocal microscopy and the intensity of fluorescence (ex: 490 nm, em: 516 nm for Mito Tracker Green; ex: 490 nm, em: 550 nm for TMRM) was recorded to determine the uncollapsed proton gradient.
Measurement of cellular ATP
Cellular ATP levels were measured using Bioluminescence Assay Kit HS II following the manufacturer’s instructions as we previously described [
25]. Briefly, cells (30 × 10
4 cells/well) were grown in 6-well plates until fully confluent. Cells were washed twice with ice-cold PBS, followed by the addition of 50 μl/well of ATP Lysis Buffer. Cells were harvested, incubated on ice for 20 minutes, and then centrifuged. Protein content of the supernatant was determined using the BCA protein assay. Proportional amounts of sample were added to a 96-well ATP plate (25 μl/well). The reaction solution was brought to 50 μl/well with the addition of ATP Dilution Buffer. ATP levels were determined using an LMax II 384 Microplate Reader and SoftMax Pro (Molecular Devices, Sunnyvale, CA).
The CellTiter 96 Non-Radioactive Cell Proliferation Assay kit was used to measure metabolic activity. Cells (104 cells/well) were plated in 96-well plates 48 hours prior to the experiment. For cellular resistance experiments, H2O2 (0.1, 0.25, 0.5, 0.75, and 1 mM) and TBH (0.1 and 0.25 mM) were added to cells 24 hours prior to incubation with 15 μl/well of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) dye solution for 4 hours. Successively, 100 μl/well of solubilization solution was added to stop the reaction, and then the plates were incubated for 1 hour. The change in absorbance at 570 nm was recorded using a 96-well Synergy HT Multi-Mode Microplate Reader (BioTek Instruments, Winooski, VT). A reference wavelength of 650 nm was taken to reduce background.
Measurement of enzyme activities associated with respiratory chain complexes
Briefly, cells (10
6 cells/dish) were grown in 150-mm dishes until fully confluent. For measurement of complex I-IV enzymatic activities in response to oxidative stress, 0.75 mM of H
2O
2 was added to cells and incubated for 1, 6, 16, and 24 hours before collection. Cells were washed twice with pre-chilled PBS, and then harvested, centrifuged, and suspended in 100 μl of isolation buffer containing 225 mM D-mannitol, 75 mM sucrose, and 2 mM K
2HPO
4. A working solution of 25 mM potassium (K) buffer (3 M KCl, 1 M Tris–HCl, pH 7.4, and 0.5 M EDTA) was used for complex I, II, III, and IV assays as described [
25]. An Ultrospect 3100 Pro-spectrophotometer (Amersham Biosciences, Piscataway, NJ) was used to measure the change in absorbance for all complexes. Background levels were measured in the absence of cell suspensions. All complex enzyme activities are expressed as nanomoles of substrate oxidized per mg
−1 protein min
−1 ml
−1 (nmol/mg protein/min/ml).
Complex I (NADH-ubiquinone oxidoreductase)
Cell lysate (30–50 μg of protein/ml) was added to a cuvette containing 0.5 ml of reaction buffer (5 mM MgCl2, 2 mM KCN, 0.13 mM NADH, and 2 μg/ml Antimycin; diluted in K buffer). The reaction was started by the addition of Coenzyme Q1 (2 μl of 65 μM solution). At 180 seconds, 2 μl of Rotenone (2 μg/ml) was added to the cuvette. The change in absorbance at 340 nm, resulting from the oxidation of NADH, was measured using a kinetic program with 20 second intervals and a total of 18 readings.
Complex II (succinate-ubiquinone oxidoreductase)
Cell suspensions (30–50 μg of protein/ml) were added to a 1.5 ml microcentrifuge tube containing 0.5 ml of reaction solution 1 (5 mM MgCl2 and 20 mM succinate; diluted in K buffer), and then incubated in a 37°C water bath for 10 minutes. After transferring the cell solution to a cuvette, the reaction was started by the addition of 8 μl of reaction solution 2 (2 μg/ml Antimycin, 2 μg/ml Rotenone, 2 mM KCN, and 50 μM Dichlorophenlindophenol). At 180 seconds, 2 μl of Coenzyme Q2 (65 μM) was added to the cuvette. The change in absorbance at 600 nm, resulting from the reduction of Dichlorophenlindophenol, was measured using a kinetic program with 20 second intervals and a total of 18 readings.
Complex III (ubiquinol-cytochrome c oxidoreductase)
The reaction was started by the addition of 2 μl of Coenzyme Q2 (65 μM) to a cuvette containing 0.5 ml of reaction buffer (5 mM MgCl2, 2 mM KCN, 15 μM cytochrome c, 2 μg/ml of Rotenone, and 0.6 mM Dodecyl-β-d-maltoside; diluted in K buffer). At 60 seconds, a cell suspension (30–500 μg of protein/ml) was added to the cuvette. The change in absorbance at 550 nm, resulting from the reduction of cytochrome c, was measured using a kinetic program with 20 second intervals and a total of 12 readings.
Complex IV (cytochrome c oxidase)
Cell lysate (30 μg of protein/ml) was added to a cuvette containing 0.475 ml of assay buffer (10 mM Tris–HCl, pH 7.0, and 120 mM KCl), and the reaction volume was brought to 0.525 ml with enzyme dilution buffer (10 mM Tris–HCl, pH 7.0, and 250 mM sucrose). The reaction was started by the addition of 25 μl of ferrocytochrome c substrate solution (0.22 mM). The change in absorbance at 550 nm, resulting from the oxidation of cytochrome c, was measured using a kinetic program with a 5 second delay, 10 second intervals, and a total of 6 readings.
Citrate synthase
Cells in 100-mm dishes were washed twice with ice-cold PBS, and cells were harvested, centrifuged, and suspended in 100 μl of isolation buffer containing 1 M Tris, pH 7.4, and 3 M KCl. The reaction was started by the addition of cell lysate (10–30 μg of protein/ml) to a cuvette containing 150 μl of assay buffer (100 mM Tris, pH 7.4, 0.17 mM Oxaloacetic acid, 0.2 mM Acetyl CoA). The change in absorbance at 232 nm was measured using a kinetic program with 60 second intervals and a total of 8 readings.
TUNEL staining
The In Situ Cell Death Detection Kit, Fluorescein (Roche) was used as described. Cells (2 × 104 cells/well) were grown in 8-well chamber slides until 70% confluent. Following incubation for 24 hours with 0.75 mM H2O2, the cells were fixed in 4% paraformaldehyde for 1 hour. Fixed cells were permeabilisated for 2 minutes on ice, followed by incubation with 75 μl TUNEL reaction mixture for 1 hour at 37°C. After washing twice with PBS followed by 5 minutes of nuclear staining with DAPI, the cells were imaged via confocal microscopy and the intensity of fluorescence (ex: 488 nm, em: 565 nm for TUNEL; ex: 358 nm, em: 461 nm for DAPI) was recorded to determine cells undergoing apoptotic cell death.
Cyclophilin D studies
Immunoblotting, co-immunofluorescence, and co-immunoprecipitation assays were performed in the PC-12 altered cell lines at passages 1–8 to investigate the role of CypD.
Co-immunofluorescence staining
Cells (2 × 104 cells/well) were grown in 8-well chamber slides until 70% confluent, and then fixed in 4% paraformaldehyde and 0.1% Triton X-100 for 30 minutes. Fixed cells were incubated with mouse anti-HSD10 (1:100, generated in our laboratory) and rabbit anti-CypD (1:200, generated in our laboratory), mouse anti-HSD10 (1:100) and rabbit anti-SODII (1:1000), or mouse anti-Hsp60 (1:1000) and rabbit anti-CypD (1:200) overnight, and then incubated with secondary antibodies (Alexa Fluor 488 anti-rabbit and Alexa Fluor 594 anti-mouse (1:2000, Invitrogen). DAPI was applied to the cells for 5 minutes followed by confocal microscopy. The intensity of fluorescence (ex: 499 nm, em: 520 nm for HSD10; ex: 343 nm, em: 442 nm for CypD; ex: 494 nm, em: 518 nm for SODII; ex: 495 nm, em: 519 nm for Hsp60; ex: 358 nm, em: 461 nm for DAPI) was recorded to determine HSD10 and CypD expression and localization to the mitochondrial markers, SODII and Hsp60.
Co-immunoprecipitation
Briefly, cells (106 cells/dish) were grown in 150-mm dishes until fully confluent. Cells were washed twice with pre-chilled PBS, and then harvested, centrifuged, and suspended in 250 μl Co-Immunoprecipitation (Co-IP) buffer containing 150 mM NaCl, 50 mM Tris–HCl, pH 7.4, 1 mM EDTA, 0.5% NP-40, and 100X protease inhibitor (EMD Millipore). Cells were frozen and thawed in 250 μl Co-IP buffer for 10 cycles, followed by brief sonication and 30 minutes of lysis on ice. After centrifugation at 8000 × g for 5 minutes at 4°C, lysates were measured for protein concentration using the BCA protein assay and subjected to co-immunoprecipitation with antibodies. Samples with 500 μg protein extracts within 500 μl Co-IP buffer were incubated overnight with pull-down antibodies (rabbit anti-HSD10, generated in our laboratory; mouse anti-CypD, Abcam; rabbit IgG or mouse serum), while rotating at 4°C. The immunocomplexes were pulled out using Protein A/G-sepharose beads for 2 hr. Next, the immunoprecipitates were washed three times with Co-IP buffer, collected by brief centrifugation, and dissolved in denaturing sample buffer. Immunoblotting was used to reveal the immunoprecipitated proteins as previously described, and the antibodies used were mouse anti-CypD (1:8000), rabbit anti-HSD10 (1:3000), and mouse anti-Actin (1:8000).
Animal studies
All animals were housed under pathogen-free conditions according to AAALAC guidelines. All animal-related experiments were performed in full compliance with institutional guidelines and approved by the Animal Care and Use Committee of the University of Kansas. Two-month old female severe combined immunodeficient (SCID) mice were purchased from Jackson Laboratory (Bar Harbor, ME).
Control and HSD10-overexpressing PC-12 cells were grown in 150-mm dishes until fully confluent. Cells were collected and inoculated into SCID mice via mammary fat pad injection after shaving of the area and alcohol preparation of the skin, using a sterile 22-gauge needle with 0.1 ml cell suspension of 1 × 10
6 cells with manual restraint [
26]. Mice were weighed and tumor size was measured using a caliper twice per week for a total of 32 days. Tumor volume was calculated using the formula: (length x width
2)/2 [
27]. Mice were imaged with an In-Vivo Multispectral FX PRO imaging system (Carestream, Woodbridge, CT) on day 30 of the experiment, 24 hours post-injection of 15 nmol of IRDye 800CW 2-deoxyglucose (2-DG, Li-Cor Biosciences, Lincoln, NB) optical probe [
28] given via tail vein injection. An excitation filter of 760 nm and emission filter of 830 nm was applied for Near Infrared imaging to visualize tumor growth.
Statistics
Paired t tests were used for statistical comparison of empty vector with HSD10 overexpression groups, and control shRNA with HSD10 shRNA groups. Unpaired t tests were used to analyze all animal data. All data was analyzed using StatView 5.0.1 Windows software (SAS Institute, Cary NC) and results are reported as mean ± SE. P < 0.05 was considered significant.
Discussion
We have demonstrated for the first time that PC-12 pheochromocytoma cells overexpressing HSD10 grow significantly faster in cell culture and form larger tumors at a faster rate in SCID mice. We theorize that HSD10 promotes enhanced cell growth through altered mitochondrial function, as we observed enhanced complex IV enzyme activity and ATP production in PC-12 cells overexpressing HSD10. Knockdown of HSD10 negatively impacted PC-12 cell growth and mitochondrial function. All ETC. complex activities were considerably reduced, resulting in decreased ATP generation. This diminished energy production is likely responsible for the reduced growth rate observed in cell culture. We also evaluated the possibility that HSD10 may confer protection in cancer cells. Upregulation of HSD10 permitted PC-12 cells to maintain a higher functional capacity with reduced cell death induction under chemical-induced oxidative stress situations. Taken together, these findings provide evidence that HSD10 mediates cancer cell growth and resistance to death-inducing environments.
Upregulation of MPTP components correlates with increased cancer cell proliferation and resistance to MPTP-induced cell death [
33,
34]. Therefore, in order to uncover the mechanism underlying HSD10-mediated cancer cell growth and resistance, we determined whether interactions existed between HSD10 and MPTP components, such as the MPTP regulatory component, CypD. During environmental stress, CypD translocates from the matrix to the inner mitochondrial membrane (IMM) where it then initiates the opening of the MPTP, consequently leading to cell death [
35]. Suppression of MPTP-induced cell death observed in tumor cells is thought to occur due to CypD molecular interactions which prevent IMM translocation, as inhibition of CypD protects malignant cells from necrosis [
36]. During tumorigenesis, overexpression of CypD inhibits cell death induction in tumor cells due to interactions with cell death proteins, such as anti-apoptotic Bcl-2 [
37] and hexokinase II [
38].
In our studies, CypD expression remained the same in PC-12 HSD10 overexpression cell lines; however, CypD expression was greatly reduced in HSD10 shRNA cells. Furthermore, HSD10 and CypD exhibited enhanced co-localization within mitochondria and increased formation of HSD10-CypD complexes in PC-12 cells overexpressing HSD10. Applying this data together, Figure
6I demonstrates our model for the mechanism of action for HSD10-mediated cancer cell growth and resistance to cell death. As shown on the upper half of the figure, cancer cells overexpressing HSD10 have reduced MPTP-mediated cell death due to enhanced interactions between HSD10 and CypD thereby preventing CypD translocation to the IMM. As depicted on the lower half of Figure
6I, cancer cells with reduced HSD10 levels are more vulnerable to MPTP-induced cell death as fewer molecules of HSD10 are able to bind and retain CypD in the matrix.
In addition to the HSD10-CypD interaction, this study identified other interesting pathways. Typically, tumors exhibit increased cell proliferation and resistance to cell death. Similarly, HSD10-overexpressing PC-12 cells demonstrated an enhanced cell growth rate and resistance to cell death induced by oxidative stressors. This phenomenon is likely due to altered processes within mitochondria, as large amounts of HSD10 localized with mitochondria in HSD10-overexpressing cells. Although the Warburg effect of elevated glycolytic ATP production in cancer cells is widely recognized [
39], many groups have revealed that mitochondria in tumor cells are able to operate both respiratory pathways [
40]. As we observed elevated complex IV activity in HSD10-overexpressing cells, we postulate that HSD10 provides additional energy metabolites for the cells.
Among its many functions, HSD10 metabolizes β-hydroxybutyrate (BHB), which can be used as an energy source when blood glucose levels are low [
41]. Studies have shown that tumor animal models utilize BHB as an energy source. For instance, it has been observed that BHB concentrations increased in the tumors of nude rats as tumor blood flow decreased [
42]. Additionally, it was recently discovered that BHB is upregulated in caveolin-1 null mice and proposed that epithelial cancer cells directly take in stromal-derived BHB to drive tumor progression and eventual metastasis [
43]. With cancer cells already displaying heightened ATP production due to the two principal energy metabolism pathways, the addition of another source of energy via the enzymatic capability of HSD10 would increase ATP generation even further. This could lead not only to alterations in mitochondrial bioenergetics, but also to changes in mitochondrial signal transduction pathways, particularly resistance to cell death.
Most often, cancer cells have disrupted cell death pathways due to mutations that either inhibit pro-apoptotic proteins [
44] or elevate anti-apoptotic proteins [
45]. As depicted by the model in Figure
6I, the suppression of MPTP-mediated apoptosis is due to the sequestration of CypD by HSD10; our future efforts will focus on this pathway. Additionally, CypD has been shown to interact with anti-apoptotic proteins, including Bcl-2. It is possible HSD10 may bind to CypD and displace Bcl-2, allowing Bcl-2 to prevent apoptosis. Validation of the role of Bcl-2 in this mechanism will require additional studies. Also, as HSD10 is a versatile enzyme within cells, further inquiry into its potential role in the repression of oxidative stress-induced cell death would be an interesting undertaking.
Lastly, using an
in vivo xenograft mouse model, we showed that HSD10-overexpressing cells grew faster and larger over 32 days as opposed to vector control tumors. While there are limited
in vivo xenograft studies involving PC-12 cells, one group revealed that following implantation of PC-12 cells into the striatum of Sprague–Dawley rats, the number of cells remained unchanged without continued tumor growth [
46]. This study supports the minimal growth observed in our EV tumors and provides further support for the tumorigenic ability of HSD10 (Figure
4C-D).
The data presented here provides a promising platform for further research to elucidate the mechanism underlying HSD10-mediated cancer cell growth and cell death resistance. Our laboratory recently created small molecule inhibitors of HSD10 [
47]. As HSD10 overexpression grants pheochromocytoma cells enhanced cellular proliferative and cell death resistant capabilities, targeted inhibition of HSD10 in cancer cells may provide a novel treatment method. Furthermore, now that we have verified that HSD10 is important in adrenal gland tumor cell development, we intend to investigate its role in other human cancers. The effect of HSD10 in breast cancer development will be especially compelling as HSD10 is able to regulate estrogen steroidogenesis [
10]. Furthermore, fellow HSD10 family member HSD17B type 1 was discovered as a novel target for endocrine therapy in certain breast cancer patients [
48]. Evaluating the effect of HSD10 on human cancers would then provide more information as to its translational implications as a biomarker or treatment target.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
The concept was designed by SSY, and the experimental procedure was developed by EAC and SSY. All cell culture-based experiments were performed by EAC with assistance from FD and YW. All animal studies were done by EAC and RTM with assistance from LX. Data analysis was conducted by EAC and FD. The manuscript was written by EAC and SSY with guidance from RTM, FD, YW, and LX. All authors read and approved the final manuscript.