Overexpression of NIMA-related kinase 2 is associated with progression and poor prognosis of prostate cancer

The study was approved by the Research Ethics Committee of Guangzhou First People’s Hospital, Guangzhou Medical University, China. An informed consent was obtained from all of the patients. All specimens were handled and remained anonymous according to the ethical and legal standards.

For immunohistochemistry analyses, TMAs with detail clinical information were purchased from Shanghai Outdo Biotech Co, LTD (Cat#: HPro-Ade180PG-01), which includes 99 primary PCa tissues and 81 adjacent non-cancerous prostate tissues from patients without chemotherapy or radiotherapy before surgery. The Taylor dataset ( http://​www.​ncbi.​nlm.​nih.​gov/​geo/​query/​acc.​cgi?​acc=​GSE21032) contains microarray data for mRNAs from 149 primary PCa tissues and 29 adjacent noncancerous prostate tissues [ 19]. The dataset contains patient survival time and follow-up examination between from 1 to 175 months with a median of 51 months post-surgery. The date of prostatectomy was considered as day 1 for the survival analyses. The PSA recurrence was defined as three successive PSA rises (final value >0.2 ng/ml), single PSA >0.4 ng/ml, or use of secondary therapy administered for detectable PSA >0.1 ng/ml, which was considered as the biochemical recurrence-free endpoint. The overall survival that was determined from the date of surgery to the time of the last follow-up or death.

For cell viability assays, human PCa LNCaP cells were seeded in 96-well plates (2 × 10 ³/well) and cultured for 24, 48, and 72 h. Cells were then incubated with 20 μl CCK-8 solution (Cat No: C0038, Beyotime, China) for 4 h at 37 °C. The absorbance was measured at the wavelength of 495 nm with a spectrophotometer. Data were expressed as mean ± SD of three independent samples. For RNA interference experiments, cells were transfected with siRNAs using Lipofectamine RNAiMAX (Invitrogen) according to manufacturer’s instructions and harvested at 24, 48, and 72 h after the transfection for protein and RNA analyses. Sequences of NEK2 siRNAs and scrambled siRNA are listed in Table  1.

Total RNAs were isolated from cells and prostate tissues using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Reverse transcription was carried out using the ReverTra Ace reagents kit (TOYOBO, Osaka, Japan). Real-time RT-PCR was carried out with the MiniOpticon real-time PCR detection system (Bio-Rad, Hercules, CA, USA) using the SYBR Green master mix (TaKaRa, Otsu, Japan). The thermal cycling conditions comprised of one cycle at 94 °C for 4 min, 40 cycles at 94 °C for 15 s, 60 °C for 15 s, and 72 °C for 15 s. All data were analyzed using the Opticon Monitor software (ver3.1, Bio-Rad). The expression of NEK2 was calculated as relative expression level to the GAPDH internal control using the comparative cycle threshold (CT) method. The primer sequences for NEK2 are GCTTAGGTAGCCCTTTTCATTTACA and GCCTCAGGTCTATGAACCCAG. The primer sequences for GAPDH are CATGGGTGTGAACCATGAGAAGT and ACAGTAGAGGCAGGGATGATGTTCT.

Proteins were extracted 48-hours post-transfection for Western blot analyses. Proteins (40 μg) were fractioned on SDS-PAGE and transferred onto Hybond nitrocellulose membranes (GE Healthcare). The membranes were blocked with 5 % skim milk in PBS-Tween 20 and probed with anti-NEK2 (bs-5732R, Bioss Co Ltd., China) or anti-β-actin antibody (sc-47778, Santa Cruz, USA). The specifically bound antibodies were detected with horse radish peroxidase-conjugated secondary antibody and visualized with the SuperSignal West PICO Chemiluminescent Detection Kit (Pierce Biotechnology). β-actin was used as an internal loading control.

All nude mice with an average age of 6–8 weeks were purchased from the Guangdong Medical Laboratory Animal Center. The NEK2 silenced cells were injected on the left side flank and the control cells on the right side flank. Briefly, 2×10 ⁶ cells were suspended in 0.1 ml culture medium, and then mixed with Matrigel (BD Biosciences,NO.356234) at the ratio of 1:1. The injections were carried out in a sterilized hood. Five mice per group were used and the experiments were repeated three times. The tumor size was measured with caliper at three time points and the means were calculated. The tumor tissues were harvested at day 43 after the implantation for histology and biochemistry analyses.

The specimens were fixed in 10 % neutral buffered formalin and subsequently embedded in paraffin. The paraffin-embedded tissues were sectioned at 4 μm thickness and then deparaffinized with xylene and rehydrated for subsequence analyses. For immunohistochemistry staining, the sections were subjected to a brief proteolytic digestion and a peroxidase blocking, the sections were incubated overnight with the primary antibody against NEK2 at a dilution of 1:400, at 4 °C. After washing, the sections were then incubated with peroxidase labeled polymer and substrate–chromogen from DAKO EnVision System (Dako Diagnostics, Switzerland) to detect the specifically bound antibodies as suggested by the manufacturer. No primary antibodies were used as the negative controls. The sections were then lightly counterstained with hematoxylin. The staining was scored by two independent experienced pathologists, who were blinded to the clinicopathological data and clinical outcomes of the patients. The scores of the two pathologists were compared. Any discrepant scores were trained through re-examining the staining by both pathologists to achieve a consensus score. The number of positive-staining cells in ten representative microscopic fields was counted, and the percentage of positive cells was calculated. The staining was subjected to arbitrative categorized to 5 groups based on the percentage of positive cells for semi-quantitative analyses as following: 0 (0 %), 1 (1–10 %), 2 (11–50 %), 3 (51–80 %) and 4 (>80 %). The staining intensity was visually scored and stratified as follows: 0 (negative), 1 (weak), 2 (moderate) and 3 (strong). A final immunoreactivity scores (IRS) were obtained for each case by adding the percentage and the intensity score [ 20, 21].