Background
The endothelium is considered to be the largest organ in the body. It is strategically located between the wall of blood vessels and the blood stream and is the major regulator of vascular homeostasis. Endothelium maintains the balance between 1) vasodilation and vasoconstriction, 2) inhibition and promotion of smooth muscle cell proliferation and migration, 3) prevention and stimulation of the adhesion and aggregation of platelets, and 4) thrombogenesis and fibrinolysis [
1]. When the latter balance is disturbed, endothelial dysfunction occurs and causes damage to the arterial wall [
2]. The observations made in human coronary arteries of atherosclerotic patients suggest that endothelial dysfunction is an early marker of atherosclerosis. The term “endothelial dysfunction” has been associated not only with atherosclerosis or hypertension, but also with other physiological and pathophysiological process, including aging, coronary syndrome, diabetes, impaired glucose tolerance, hyperglycemia, obesity, hypercholesterolemia, and inflammation etc [
3]. A better understanding of various physiological and pathophysiological functions associated with endothelial cells will eventually lead to not only a better comprehension of these diseases but also improved preventive and therapeutic strategies.
Endothelial dysfunction is characterized by reduced dilator function, increased inflammatory cell and platelet adhesion, and increased coagulation activity [
4]. Reduced bioavailability of nitric oxide (NO) is a major contributor of endothelial dysfunction [
5]. Another potential trigger for endothelial dysfunction is inflammation. Inflammatory cytokines have been shown to impair endothelial function in animal models and isolated human veins [
6].
Although there may be several drivers of endothelial dysfunction, the accumulation of intracellular lipids including triglycerides, cholesterol, and free fatty acid has emerged as a key pathophysiological factor [
7‐
9]. Therefore, decreasing intracellular lipid levels in endothelial cells may be the key step for preventing or reversing endothelial dysfunction and related diseases, such as atherosclerosis, insulin resistance, and metabolic syndrome.
Steroidogenic acute regulatory protein (StAR) is one of the cholesterol transporters that initially found in steroidogesis tissues. It transfers cholesterol from the relatively cholesterol-rich outer mitochondrial membrane to the cholesterol-poor inner mitochondrial membrane for oxidation [
10], which is the rate-limiting step in steroidogenesis. Recently, StAR had been demonstrated to be expressed in liver, endothelial cells other than the steroidogenic tissue with similar function [
11]. Previous studies from our laboratory and others’ demonstrated that StAR is also expressed in human monocytes, human aorta [
12], murine aorta [
13], macrophages and endothelial cells [
14]. Overexpression of StAR increased the mRNA and protein levels of ABCA1 and ABCG1 in microvascular endothelial cells [
15], and decreased the cellular lipid levels and inflammation in macrophages [
16]. In vivo investigations showed that StAR overexpression dramatically reduced cholesterol and triglyceride levels in serum, liver and aorta [
17]. These evidences suggest that StAR plays a protective role in cardiovascular disease. However, the role of StAR in endothelial dysfunction remains unclear to date.
In the present study, the primary rat aortic endothelial cells (RAECs) were treated with palmitic acid (PA) as an
in vitro model for endothelial dysfunction [
18‐
20]. The effects of StAR overexpression on lipid metabolism, inflammation and NO bioavailability were investigated after infection with recombinant adenovirus encoding StAR in RAECs. We show here that StAR overexpression decreases intracellular lipid levels by reducing expression of genes involved in lipid metabolism. In addition, StAR overexpression inhibited PA-induced inflammation and attenuated impairment of NO bioavilability via regulating pAkt/peNOS/NO pathway. Overall our findings provided a strong support for StAR being as one of the key regulators for lipid metabolism and a protective molecule for endothelial dysfunctions in aortic endothelium.
Methods
Reagents
Culture media and reagents, fetal bovine serum, basic fibroblast growth factor and TRIZOL reagent were obtained from Invitrogen Life Technologies (Grand Island, NY). RevertAld™ First Strand cDNA Synthesis Kit and PageRuler Prestained Protein Ladder were purchased from Fermentas MBI (San Diego, CA). SYBR® Green real-time PCR Master Mix was from Bio-Rad (Hercules, CA). Primary antibodies against StAR, phosphor-eNOS (S1177) and eNOS were purchased from Abcam Ltd (Cambridge Science Park, Cambridge, UK). Antibodies against NF-κB (p65) and Histone (H3) were purchased from Proteintech Group, Inc (Chicago, IL). Phosphor-Akt (Ser473) was from Cell Signaling Technology, Inc (Boston, MA). Akt antibody was purchased from Bioworld technology, co, Ltd (Nanjing, Jiangsu, China). Primary antibody against b-actin and second antibodies against rabbit and mouse IgG were obtained from CWbiotech (Beijing, China). Cerulenin, an inhibitor of fatty acid synthase, was from Biovision (Milpitas, CA). Lovastatin, an inhibitor of HMG-CoA Reductase was purchased from Sigma-Aldrich Chemical Co (St.Louis, MO). siRNA for StAR gene and negative control were from Shanghai GenePharma., Ltd (Shanghai, China). The recombinant adenovirus encoding StAR (Ad-StAR) and the control adenovirus expressing the enhanced green fluorescence protein (Ad-EGFP) was a gift from Dr. Shunlin Ren (Dept. of Medicine, Veterans Affairs Medical Center and Virginia Commonwealth University, Richmond, VA). All other reagents were from Sigma-Aldrich Chemical Co unless stated otherwise.
Cell culture
Rat aortic endothelial cells (RAECs) were isolated and cultured as described previously with minor modifications [
21,
22]. Briefly, segments of thoracic aorta were excised from male Wistar rats (150-180 g) and immediately placed in cold PBS containing 100 U/ml penicillin and 100 mg/ml streptomycin. The aorta was cut into 1 millimeter wide rings after the periadventitial fat was removed. Following transferred to a T-25 cm2 flasks (Nunc, Rochester, NY), the rings were cultured in Medium 199 containing 20% fetal bovine serum, 2.5 ng/ml basic fibroblast growth factors, 100U/ml penicillin and 100 mg/ml streptomycin. The aorta rings were placed at 37°C in a humidified atmosphere with 5% CO2 for 72-80 h without movement. All pieces of aorta rings were removed when cells migrated. Its microvascular cytological characteristics were demonstrated by CD31 and vWF staining as shown in the previous study [
21]. In experiments involving PA treatment, M199 medium supplemented with 1% bovine serum albumin was used. All experiments were performed with RAECs up to passage 4. In the experiments with inhibitor, 5 μg/ml Cerulenin (in ethonal), or 5 μM lovastatin (in DMSO), or 3.3 μg/ml cerulenin plus 3.3 μM lovastatin was added in culture media 24 hours prior to PA treatment. The same volume of solvents was added at the same time as control. All experimental protocols were approved by the Animals Care and Use Committee of Shanghai Medical College, Fudan University which adopts the guideline for the care and use of laboratory animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).
Infection of cells with adenovirus encoding StAR
The RAECs were infected with recombinant adenovirus encoding StAR (Ad-CMV-StAR) as previously described [
16,
23]. Briefly, primary RAECs (4 × 10
5 cells/well) were planted in 6-well plates (Costar, Corning, NY) in complete culture medium. Twenty-four hours after planting, RAECs were infected with recombinant adenovirus encoding Ad-CMV-StAR at a multiplicity of 10, 20, 50 or 100 pfu/cell. The recombinant adenovirus encoding enhanced green fluorescence protein (Ad-CMV-EGFP) was used as control. The virus was allowed to dwell for at least 2 h in minimal culture medium with shaking every 15 minutes. After 2 h of infection, unbound virus was removed and replaced with fresh medium. The cells were incubated for another 48 h before treatment. After determination the effect of infection, MOI = 10 were chose for the other experiment with sufficient overexperssion and minimum harm to the cells.
Preparation of PA for vitro experiments
PA solution was prepared as described previously [
24] with minor modifications. In brief, stock PA (0.1 M) was dissolved in 0.1 M NaOH at 70°C, and stored at -20°C. PA preparation was thawed and mixed with serum- and growth factor-free media in the presence of 1% BSA the day before use.
Supression of StAR with siRNA
To down-regulate StAR mRNA expression, we transfected a siRNA specific for StAR and a non-coding control siRNA (GenePharma Ltd, Shanghai, China) using the Lipofectamine™ 2000 Transfection Reagent ( Invitrogen Life Technologies) according to the manufacturer’s protocol. Twenty-four hours later, cells were treated with PA and used for measuring gene expression (for inflammatory factor), and nitric oxide detection.
Real-time quantitative PCR
To determine the effect of adenovirus infection, RAECs were seeded in 6-well plates and infected with Ad-CMV-StAR or Ad-CMV-EGFP for 48 h before harvest. To determine the effect of StAR overexperssion on the mRNA expression of inflammatory factors, RAECs were seeded in 6-well plates and treated with PA (200 μM) at different time (0 h, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h) following with 48 h infection. RAECs were lysed and total RNA was prepared by TRIZOL reagent according to the manufacturer’s protocols. Complementary DNA (cDNA) was synthesized from 2 mg total RNA by RevertAld™ First Strand cDNA Synthesis Kit. Quantitative PCR was carried out in a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA) using SYBR® Green real-time PCR Master Mix. Reaction contained 20 ng of cDNA and 0.25 μM forward and reverse primers were performed as previously described [
25]. The sequences of primers used in this study were listed in Table
1.
Table 1
The sequences of primers used in this experiment
GAPDH | GCAAGTTCAACGGCACAG | GCCAGTAGACTCCACGACAT |
Hu-StAR | CTGAGGCAACAGGCTGTGAT | AGCCGAGAACCGAGTAGAGAG |
Rat-StAR | CACAGTCATCACCCATGAGC | AGCTCTGATGACACCGCTTT |
ACC-1 | CCCAACAGAATAAAGCTACTCTGG | TCCTTTTGTGCAACTAGGAACGT |
FAS | CCTCTTCCCTGGCACTGGCTACCT | ACTCGGCGGGGATCGGGACTT |
LDLR | AAGCCATTTTCAGTGCCAAC | AGGTGAACTTGGGTGAGTGG |
HMGR | TGCTGCTTTGGCTGTATGTC | TGAGCGTGAACAAGAACCAG |
SREBP-2 | CATCTTCCCCTCTCCTTCCTAT | CCCAGCTTGACAATCATCTGC |
IL-1β | CTGTGACTCGTGGGATGATG | GGGATTTTGTCGTTGCTTGT |
TNFα | GCTACGGGCTTGTCACTC | CCACGCTCTTCTGTCTACTG |
VCAM-1 | ACAAAACGCTCGCTCAGATT | GTCCATGGTCAGAACGGACT |
IL-6 | CACAAGTCCGGAGAGGAGAC | ACAGTGCATCATCGCTGTTC |
Western blotting
Cells were grown in either 100 mm dishes or 60 mm dishes before lysis. To determine the transfection effects of adenovirus, cells were harvested after 48 h infection with different MOI adenovirus. To determine the effect of StAR overexperssion on pAkt/peNOS/NO pathway, cells were lysed after treating with 200 μM PA for 0, 30, 60 and 120 minutes following with 48 h infection. To determine the effect of StAR overexperssion on nuclear translocation of NFκB (p65), cytosolic and nuclear fractions were isolated and lysed after treating with 200 μM PA for 0, 15, 30, and 60 minutes following with 48 h infection. Cytosolic and nuclear fractions were isolated with Cytosolic and Nuclear Isolation Kit (Beyotime It. Co, Nanjing, China). Lysate preparation and analysis was done as previously described [
16]. Fifty micrograms of total protein and thirty micrograms of cytosolic and nuclear was applied to SDS-PAGE gel electrophoresis and transferred to PVDF membrane (Invitrogen, Grand Island, NY) using a Bio-Rad transfer blotting system at 300 mA for 100 minutes. Proteins were probed with the following antibodies overnight at 4°C: StAR (1:2000), total Akt (1:1500), phospho-Akt Ser 473 (1:2000), total eNOS (1:1000), phospho-eNOS Ser 1177 (1:1000), and NFκB p65 (1:1500). To confirm equal loading of the gels, membranes were reprobed with β-actin (1:5000) for the whole lysates and Histon-H3 (1:1500) for nuclear fractions. Semi-quantitative analysis of protein expression was performed by densitometry using NIH ImageJ software (
http://rsb.info.nih.gov/ij).
Intracellular free fatty acid and total cholesterol determination
After 48 h infection, cells were harvested in PBS and lysated by sonication. Total intracellular cholesterol and free fatty acid were extracted by homogenization with 1/2 volume of chloroform/isopropanol/NP-40 (7/11/0.1, v/v) or chloroform-Triton X-100 (1% Triton X-100 in pure chloroform), respectively. The organic phase (lower phase) were collected and vacuumed dry to remove trace chloroform after spin the extracts at top speed in a microcentrifuge for 10 minutes. The extractions were redissolved and detected by Free Fatty Acid and Cholesterol Quantification Kit respectively (Applygen Technologies, Beijing, China) according to the manufacturer’s instructions.
ELISA assay for cytokines
RAECs were treated by PA (200 μM) overnight (16 h) after 48 h infection and cell culture media were collected to determine the effect of StAR overexpression on secretion of cytokines. The cytokine levels (IL-1β, TNFα, and IL-6) were determined by ELISA assay (NeoBioScience, Shenzhen, China) following with the manufacturer’s instructions.
Statistic analysis
Data are presented as the mean ± S.D. Statistical analysis was performed using Student’s t test or ANOVA as appropriate. P < 0.05 was considered statistically significant.
Discussion
Vascular endothelial dysfunction is the initiation and hallmark of various cardiovascular diseases, such as atherosclerosis, hypertension, coronary vascular disease and diabetes. Several therapeutic interventions, including changes in lifestyle and pharmacologic treatments, are used to ameliorate endothelial dysfunction under various risk factors. It is of great interest to explore new therapeutic strategies to improve endothelial function for protection and prevention of these diseases which cause significant number of deaths each year.
In the present study, we provided insight into the effect of StAR on rat aortic endothelium lipid metabolism and dysfunction. As shown in Figure
1, StAR mRNA and protein levels were significantly increased by infection with recombinant adenovirus. Following StAR overexpression, key genes involved in fatty acid synthesis (FAS, ACC-1), cholesterol synthesis (HMGR) and uptake (LDLR, SREBP-2) were greatly repressed. And, intracellular total cholesterol and FFAs were significantly reduced. Furthermore, StAR overexpression inhibited mRNA expression and secretion of inflammatory factors by blocking NFκB nuclear translocation. Finally, StAR overexpression attenuated the reduction of NO bioavailability induced by PA treatment via regulating the p-Akt/p-eNOS/NO pathway.
An elevation of circulating FFAs is supposed to be related to the onset and progression of endothelial dysfunction [
39,
40], and associate with a number of cardiovascular risk factors, including hypertension, dyslipidemia, and abnormal fibrinolysis. It has been noted that FFAs may increase the production of multiple cytokines in mononuclear cells by generation of reactive oxygen species (ROS) and activation of the pro-inflammatory NFκB pathway in human endothelial cells [
41,
42]. In the present study, we used PA as one of the major mediators to induce endothelial dysfunction by activating inflammation and reducing NO biovailability.
When the endothelium in vessels is affected by risk factors, such as pro-inflammatory factors or hyperlipidemia, it will be activated and secrete inflammatory factors. Cell adhesion molecules including intercellular adhesion molecule-1 (ICAM-1), vascular adhesion molecule-1 (VCAM-1) and E-selectin are the biomarkers of endothelial activation [
43]. As shown in our study, the mRNA expression and secretion of inflammatory factors were greatly increased after PA treatment in cultured rat aortic endothelial cells, while the mRNA expression of VCAM-1 was also upregulated significantly. However, the extent of increase is reduced when StAR is overexpressed by adenovirus infection. As shown by previous studies, the transcription factor NFκB regulates the expression of numerous genes including those related to pro-inflammatory responses, such as L-1β, IL-6, TNFα and VCAM-1, IL-1α [
35,
44]. We found that NFκB translocation from cytosol to nucleus was blocked by StAR overexpression. Thus, StAR could attenuate inflammatory responses in endothelium via its blocking of NFκB translocation.
There is strong clinical evidence that endothelial dysfunction contributes to the pathogenesis of cardiovascular disease and insulin resistance [
45,
46]. Endothelial cell dysfunction is defined by a decrease in the bioavailability of nitric oxide (NO), a critical regulator of vascular tone [
47]. Endothelial nitric oxide synthase (eNOS) serves as a critical enzyme in producing NO. As shown in previous studies, the pAkt/peNOS/NO pathway was inhibited by PA treatment [
19,
20,
46]. Our observations in this study demonstrated that StAR overexpression in endothelial cells attenuated the reduction of phosphorylation of Akt and eNOS, as well as NO production. Previous studies have shown an inverse correlation between StAR and NO in the steiodogenic tissues [
48,
49], in which NO was produced from activation of iNOS (also named NOS2). However, in our study, we observed a direct correlation between StAR and NO in vascular tissue, where NO is produced from eNOS (named NOS3). This suggests that StAR could take different roles in physiological process at different location. As shown in previous reports, NO production is regulated by a complicate network, including interactions among CaM, Cavelion-1, BH4 and ROS to regulate activation of eNOS (Ref). Each step in the network will affect the production of NO, and as a result, StAR overexpression ameliorates the reduction of NO production induced by PA treatment at a mild degree. Our results using siRNAs to inhibit StAR expression confirmed a positive role for StAR in endothelial dysfunction.
As already demonstrated in many investigations, lipids overload is a major risk factor for endothelial dysfunction. Our data obtained in the present study indicate that StAR inhibits lipid synthesis and uptake, PA-induced inflammation, and reduction in NO bioavailability in aortic endothelial cells. The inhibitor of FAS and HMGR could also ameliorate the inflammatory response induced by PA in RAECs. Taken together, the role of StAR overexpression in inhibiting inflammatory response and NO bioavailability in the cellular model of endothelial dysfunction might result from decreased lipid levels in RAECs.
Acknowledgements
This research was supported by Grant (30900716 for Dr. Ning,Y., and 81170253 for Dr. Yin, L., ) from National Natural Science Foundation of P.R. China, the Ministry of education scientific research foundation for the returned overseas for Dr. Ning, Y., and a research project (2009001) from Shanghai Municipal Bureau of Health for Dr. Wang, X.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
DT initiated and performed the majority of the laboratory work, which was designed and supervised by YN; YQ, YZ, XL, XZ, and XW carried out additional experiments, including cell culture, transfection, and partial real-time quantitative PCR and Western blotting. LY and YN was critically involved in writing, revising, drafting the paper and has given final approval of the version of the paper to be published. All authors have read and approved the final manuscript.